<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-01-16 17:34:16"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C06SLe0008G21-R35fh/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C06SLe0008G21-R35fh/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C06SLe0008G21-R35fh/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M1749" ref_strand="+" ref_description="SGN-M1749 T1082 [cos_markers]">
      <seq>acaaaccttattgatgagaaaagtatctttgttggtggtatatttccagacccctccggagagaaattcgagaactatttaacgctagctgaaaaactgcgaggcgagttcgattttgctcacactgttgatgctaaacacctccctcggggtggaccagtcaacaagcccactcttcgtcttctaaagccatttgatgaactctttgttgattttgaggactttgatgtcgatgcaatggagaagttcatctcagaatctagtattcctgttgttactatttttgacaatgacccaaacaaccatccttatgttaacaagttcttcgaaggcaccaacgccaaggcattgctatttgtgaactttagctctgaatttgatgcttttaagtccaagtacaacgatgttgctgtgatttacaaaggggatggggtgagctttctcttgggtgatgttgacgctggtcaaggtgcttttgagtacttcggactgaagccggaacaggcacctgtgatcatcataatggacgctgatgaacaaaagtatattaaggaccatgtggaacctgatgccattgctg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C06SLe0008G21-R35fh/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C06SLe0008G21.1" temp_strand="-" temp_description="C06SLe0008G21.1  AC211081.1 htgs_phase:1 submitted_to_sgn_as:C06SLe0008G21 sequenced_by:cbsg upload_account_name:netherlands [organism=Solanum lycopersicum]">
        <position start="43042" stop="41361"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="42742" g_stop="42710" g_length="33"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="33" r_length="33" r_score="1.000"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="42709" i_stop="42612" i_length="98">
            <donor d_prob="0.907" d_score="0.00"/>
            <acceptor a_prob="0.997" a_score="0.98"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="42611" g_stop="42426" g_length="186"/>
          <reference_exon_boundary r_type="cDNA" r_start="34" r_stop="219" r_length="186" r_score="0.995"/>
        </exon>
        <intron i_serial="2">
          <gDNA_intron_boundary i_start="42425" i_stop="42311" i_length="115">
            <donor d_prob="0.988" d_score="1.00"/>
            <acceptor a_prob="0.999" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="3">
          <gDNA_exon_boundary g_start="42310" g_stop="42185" g_length="126"/>
          <reference_exon_boundary r_type="cDNA" r_start="220" r_stop="345" r_length="126" r_score="1.000"/>
        </exon>
        <intron i_serial="3">
          <gDNA_intron_boundary i_start="42184" i_stop="41991" i_length="194">
            <donor d_prob="0.981" d_score="1.00"/>
            <acceptor a_prob="0.965" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="4">
          <gDNA_exon_boundary g_start="41990" g_stop="41856" g_length="135"/>
          <reference_exon_boundary r_type="cDNA" r_start="346" r_stop="480" r_length="135" r_score="0.993"/>
        </exon>
        <intron i_serial="4">
          <gDNA_intron_boundary i_start="41855" i_stop="41761" i_length="95">
            <donor d_prob="0.997" d_score="0.98"/>
            <acceptor a_prob="0.858" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="5">
          <gDNA_exon_boundary g_start="41760" g_stop="41661" g_length="100"/>
          <reference_exon_boundary r_type="cDNA" r_start="481" r_stop="580" r_length="100" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C06SLe0008G21.1" gen_strand="-" ref_id="SGN-M1749" ref_strand="+">
        <total_alignment_score>0.996</total_alignment_score>
        <cumulative_length_of_scored_exons>580</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C06SLe0008G21.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-M1749" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="42742" e_stop="42710"/>
          <exon e_start="42611" e_stop="42426"/>
          <exon e_start="42310" e_stop="42185"/>
          <exon e_start="41990" e_stop="41856"/>
          <exon e_start="41760" e_stop="41661"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>ACAAACCTTATTGATGAGAAAAGTATCTTTGTTGTAAGTGGTGATACTTTTGATGTTTTACTTATCATTACTGAAGTTTATTTTCAGCATGCCATAGCTTCTTGCTGTCTAAAATCTTTCTGTTTCTTTAGGTTGGTATATTTCCAGACCCCTCCGGAGAGAAATTCGAGAACTATTTAACGCTAGCTGAAAAACTGCGAGGCGAGTTCGATTTTGCTCACACTGTTGATGCTAAACACCTCCCTCGGGGTGGACCAGTCAACAAGCCCACTCTTCGTCTTCTAAAGCCATTTGATGAACTCTTTGTTGATTTTGAGGTATTACAGTTATCTGTGTATATTTTTATCTTTGATACTCATTGTATTATGGTTATGAGGCTCAACTCTGTCCTATGTTATCTTTTAATTGGCCATTGATTGTACATACTTGCAGGACTTTGATGTCGATGCAATGGAGAAGTTCATCTCAGAATCTAGTATTCCTGTTGTTACTATTTTTGACAATGACCCAAACAACCATCCTTATGTTAACAAGTTCTTCGAAGGCACCAACGCCAAGGTACTTGATTCTGCGAGCTGTAATGCTTCAATTTGACCTTATATTTCAACGTCAAGCAATTCTAGGATCTTCTCATGAATTTTACAGTTATATGCTTGTACTTGTATTATTTTCTTTTCATTCACTAATATTTGACAATTAACTTCAAAGTTCTAAGAGATTGATTTGTTTTTTTGACATTTGCAAATCTACAGGCATTGCTATTTGTGAACTTTAGCTCTGAATTTGATGCTTTTAAGTCCAAGTACAACGATGTTGCTGTGATTTACAAAGGGGATGGGGTGAGCTTTCTCTTGGGTGATGTTGAGGCTGGTCAAGGTGCTTTTGAGGTTGGTTAAAATTTTCAACTATCTGATTACAGTGTCATTGTATCCATGATCACGTAAAAAGGCGCGTTGAACATTCGTTTTATTTGGAATTGCAGTACTTCGGACTGAAGCCGGAACAGGCACCTGTGATCATCATAATGGACGCTGATGAACAAAAGTATATTAAGGACCATGTGGAACCTGATGCCATTGCTG</genome_strand>
        <mrna_strand>ACAAACCTTATTGATGAGAAAAGTATCTTTGTT..................................................................................................GGTGGTATATTTCCAGACCCCTCCGGAGAGAAATTCGAGAACTATTTAACGCTAGCTGAAAAACTGCGAGGCGAGTTCGATTTTGCTCACACTGTTGATGCTAAACACCTCCCTCGGGGTGGACCAGTCAACAAGCCCACTCTTCGTCTTCTAAAGCCATTTGATGAACTCTTTGTTGATTTTGAG...................................................................................................................GACTTTGATGTCGATGCAATGGAGAAGTTCATCTCAGAATCTAGTATTCCTGTTGTTACTATTTTTGACAATGACCCAAACAACCATCCTTATGTTAACAAGTTCTTCGAAGGCACCAACGCCAAG..................................................................................................................................................................................................GCATTGCTATTTGTGAACTTTAGCTCTGAATTTGATGCTTTTAAGTCCAAGTACAACGATGTTGCTGTGATTTACAAAGGGGATGGGGTGAGCTTTCTCTTGGGTGATGTTGACGCTGGTCAAGGTGCTTTTGAG...............................................................................................TACTTCGGACTGAAGCCGGAACAGGCACCTGTGATCATCATAATGGACGCTGATGAACAAAAGTATATTAAGGACCATGTGGAACCTGATGCCATTGCTG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C06SLe0008G21-R35fh/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M2158" ref_strand="+" ref_description="SGN-M2158 T1646 [cos_markers]">
      <seq>ttctctttctaaagctttctctcacctcccaagttttaatacagagaattgaagttatggggaatagagtggatcatgagtacgattacttgtttaagatcgtgttgattggtgattctggagttggaaaatcgaacattctgtctaggtttacgcgaaatgagttctgtttggagtcaaaatctactattggagttgagttcgccactagaactcttcaggttgagggaaag</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C06SLe0008G21-R35fh/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C06SLe0008G21.1" temp_strand="-" temp_description="C06SLe0008G21.1  AC211081.1 htgs_phase:1 submitted_to_sgn_as:C06SLe0008G21 sequenced_by:cbsg upload_account_name:netherlands [organism=Solanum lycopersicum]">
        <position start="69742" stop="68574"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="69442" g_stop="69411" g_length="32"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="32" r_length="32" r_score="0.969"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="69410" i_stop="69068" i_length="343">
            <donor d_prob="0.996" d_score="0.00"/>
            <acceptor a_prob="0.999" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="69067" g_stop="68879" g_length="189"/>
          <reference_exon_boundary r_type="cDNA" r_start="33" r_stop="221" r_length="189" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C06SLe0008G21.1" gen_strand="-" ref_id="SGN-M2158" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>221</cumulative_length_of_scored_exons>
        <coverage percentage="0.948" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C06SLe0008G21.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-M2158" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="69442" e_stop="69411"/>
          <exon e_start="69067" e_stop="68879"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>TTCTCTTTCTAAAGCTTTCTCTCACCTCCCAGGTAACCCATTTTGTACTAATTTGAGCATCAATCTATTTTTGTATGTATGCGTATGAATTGTTTTTGTATATATATACCGTGGCGGATCCAGGATTTTAACTTTATAAGTTCAATTTTTAAAGTTTTTAGCATTGAACTCGTTATAATTTTTGAAGTTAAAGAGTTTGTAACTGCTATTTATTGTGAATTTATGTTTAAATCAGTGTATTCAAATGAACCCGTACATCCGCTCTTGGAGAGTATTTTTTATTTGTATTTTCCATTTCTAGGGTTTGTTTGTGTTTGATTTGATTGGAGTGTTGCAGATCTAGATGATGTTTATCTGTTTTTTGATTTTTTGTAGGTTTTAATACAGAGAATTGAAGTTATGGGGAATAGAGTGGATCATGAGTACGATTACTTGTTTAAGATCGTGTTGATTGGTGATTCTGGAGTTGGAAAATCGAACATTCTGTCTAGGTTTACGCGAAATGAGTTCTGTTTGGAGTCAAAATCTACTATTGGAGTTGAGTTCGCCACTAGAACTCTTCAG</genome_strand>
        <mrna_strand>TTCTCTTTCTAAAGCTTTCTCTCACCTCCCAA.......................................................................................................................................................................................................................................................................................................................................................GTTTTAATACAGAGAATTGAAGTTATGGGGAATAGAGTGGATCATGAGTACGATTACTTGTTTAAGATCGTGTTGATTGGTGATTCTGGAGTTGGAAAATCGAACATTCTGTCTAGGTTTACGCGAAATGAGTTCTGTTTGGAGTCAAAATCTACTATTGGAGTTGAGTTCGCCACTAGAACTCTTCAG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>2</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="42742" PGL_stop="41661"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="42742" e_stop="42710"/>
            <exon e_start="42611" e_stop="42426"/>
            <exon e_start="42310" e_stop="42185"/>
            <exon e_start="41990" e_stop="41856"/>
            <exon e_start="41760" e_stop="41661"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.907" acc_prob="0.997" e_score="1.000"/>
          <exon-intron don_prob="0.988" acc_prob="0.999" e_score="0.995"/>
          <exon-intron don_prob="0.981" acc_prob="0.965" e_score="1.000"/>
          <exon-intron don_prob="0.997" acc_prob="0.858" e_score="0.993"/>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="42742" e_stop="42710" e_length="33"/>
          </exon>
          <intron i_serial="1" don_prob="0.907" acc_prob="0.997">
            <gDNA_intron_boundary i_start="42709" i_stop="42612" i_length="98"/>
          </intron>
          <exon e_serial="2" e_score="0.995">
            <gDNA_exon_boundary e_start="42611" e_stop="42426" e_length="186"/>
          </exon>
          <intron i_serial="2" don_prob="0.988" acc_prob="0.999">
            <gDNA_intron_boundary i_start="42425" i_stop="42311" i_length="115"/>
          </intron>
          <exon e_serial="3" e_score="1.000">
            <gDNA_exon_boundary e_start="42310" e_stop="42185" e_length="126"/>
          </exon>
          <intron i_serial="3" don_prob="0.981" acc_prob="0.965">
            <gDNA_intron_boundary i_start="42184" i_stop="41991" i_length="194"/>
          </intron>
          <exon e_serial="4" e_score="0.993">
            <gDNA_exon_boundary e_start="41990" e_stop="41856" e_length="135"/>
          </exon>
          <intron i_serial="4" don_prob="0.997" acc_prob="0.858">
            <gDNA_intron_boundary i_start="41855" i_stop="41761" i_length="95"/>
          </intron>
          <exon e_serial="5" e_score="1.000">
            <gDNA_exon_boundary e_start="41760" e_stop="41661" e_length="100"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="42742" stop="42710"/>
              <exon start="42611" stop="42426"/>
              <exon start="42310" stop="42185"/>
              <exon start="41990" stop="41856"/>
              <exon start="41760" stop="41661"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M1749" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>ACAAACCTTATTGATGAGAAAAGTATCTTTGTT : GTTGGTATATTTCCAGACCCCTCCGGAGAGAAATTCGAGAACTATTTAACGCTAGCTGAAAAACTGCGAGGCGAGTTCGATTTTGCTCACACTGTTGATGCTAAACACCTCCCTCGGGGTGGACCAGTCAACAAGCCCACTCTTCGTCTTCTAAAGCCATTTGATGAACTCTTTGTTGATTTTGAG : GACTTTGATGTCGATGCAATGGAGAAGTTCATCTCAGAATCTAGTATTCCTGTTGTTACTATTTTTGACAATGACCCAAACAACCATCCTTATGTTAACAAGTTCTTCGAAGGCACCAACGCCAAG : GCATTGCTATTTGTGAACTTTAGCTCTGAATTTGATGCTTTTAAGTCCAAGTACAACGATGTTGCTGTGATTTACAAAGGGGATGGGGTGAGCTTTCTCTTGGGTGATGTTGAGGCTGGTCAAGGTGCTTTTGAG : TACTTCGGACTGAAGCCGGAACAGGCACCTGTGATCATCATAATGGACGCTGATGAACAAAAGTATATTAAGGACCATGTGGAACCTGATGCCATTGCTG</gDNA_template>
            <first_frame> T  N  L  I  D  E  K  S  I  F  V  :  V  G  I  F  P  D  P  S  G  E  K  F  E  N  Y  L  T  L  A  E  K  L  R  G  E  F  D  F  A  H  T  V  D  A  K  H  L  P  R  G  G  P  V  N  K  P  T  L  R  L  L  K  P  F  D  E  L  F  V  D  F  E  :  D  F  D  V  D  A  M  E  K  F  I  S  E  S  S  I  P  V  V  T  I  F  D  N  D  P  N  N  H  P  Y  V  N  K  F  F  E  G  T  N  A  K  :  A  L  L  F  V  N  F  S  S  E  F  D  A  F  K  S  K  Y  N  D  V  A  V  I  Y  K  G  D  G  V  S  F  L  L  G  D  V  E  A  G  Q  G  A  F  E  :  Y  F  G  L  K  P  E  Q  A  P  V  I  I  I  M  D  A  D  E  Q  K  Y  I  K  D  H  V  E  P  D  A  I  A  </first_frame>
            <second_frame>  Q  T  L  L  M  R  K  V  S  L  L :   L  V  Y  F  Q  T  P  P  E  R  N  S  R  T  I  *  R  *  L  K  N  C  E  A  S  S  I  L  L  T  L  L  M  L  N  T  S  L  G  V  D  Q  S  T  S  P  L  F  V  F  *  S  H  L  M  N  S  L  L  I  L  R :   T  L  M  S  M  Q  W  R  S  S  S  Q  N  L  V  F  L  L  L  L  F  L  T  M  T  Q  T  T  I  L  M  L  T  S  S  S  K  A  P  T  P  R :   H  C  Y  L  *  T  L  A  L  N  L  M  L  L  S  P  S  T  T  M  L  L  *  F  T  K  G  M  G  *  A  F  S  W  V  M  L  R  L  V  K  V  L  L  S :   T  S  D  *  S  R  N  R  H  L  *  S  S  *  W  T  L  M  N  K  S  I  L  R  T  M  W  N  L  M  P  L  L </second_frame>
            <third_frame>   K  P  Y  *  *  E  K  Y  L  C   : C  W  Y  I  S  R  P  L  R  R  E  I  R  E  L  F  N  A  S  *  K  T  A  R  R  V  R  F  C  S  H  C  *  C  *  T  P  P  S  G  W  T  S  Q  Q  A  H  S  S  S  S  K  A  I  *  *  T  L  C  *  F  *   : G  L  *  C  R  C  N  G  E  V  H  L  R  I  *  Y  S  C  C  Y  Y  F  *  Q  *  P  K  Q  P  S  L  C  *  Q  V  L  R  R  H  Q  R  Q   : G  I  A  I  C  E  L  *  L  *  I  *  C  F  *  V  Q  V  Q  R  C  C  C  D  L  Q  R  G  W  G  E  L  S  L  G  *  C  *  G  W  S  R  C  F  *   : V  L  R  T  E  A  G  T  G  T  C  D  H  H  N  G  R  *  *  T  K  V  Y  *  G  P  C  G  T  *  C  H  C   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C06SLe0008G21.1" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="42742" stop="42710"/>
                    <exon start="42611" stop="42426"/>
                    <exon start="42310" stop="42185"/>
                    <exon start="41990" stop="41856"/>
                    <exon start="41760" stop="41662"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>579</number_coding_nucleotides>
                  <number_encoded_amino_acids>193</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>TNLIDEKSIFVVGIFPDPSGEKFENYLTLAEKLRGEFDFAHTVDAKHLPRGGPVNKPTLRLLKPFDELFVDFEDFDVDAMEKFISESSIPVVTIFDNDPNNHPYVNKFFEGTNAKALLFVNFSSEFDAFKSKYNDVAVIYKGDGVSFLLGDVEAGQGAFEYFGLKPEQAPVIIIMDADEQKYIKDHVEPDAIA</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="2" PGL_strand="-" PGL_start="69442" PGL_stop="68879"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="69442" e_stop="69411"/>
            <exon e_start="69067" e_stop="68879"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.996" acc_prob="0.999" e_score="0.969"/>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.969">
            <gDNA_exon_boundary e_start="69442" e_stop="69411" e_length="32"/>
          </exon>
          <intron i_serial="1" don_prob="0.996" acc_prob="0.999">
            <gDNA_intron_boundary i_start="69410" i_stop="69068" i_length="343"/>
          </intron>
          <exon e_serial="2" e_score="1.000">
            <gDNA_exon_boundary e_start="69067" e_stop="68879" e_length="189"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="69442" stop="69411"/>
              <exon start="69067" stop="68879"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M2158" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="2" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>TTCTCTTTCTAAAGCTTTCTCTCACCTCCCAG : GTTTTAATACAGAGAATTGAAGTTATGGGGAATAGAGTGGATCATGAGTACGATTACTTGTTTAAGATCGTGTTGATTGGTGATTCTGGAGTTGGAAAATCGAACATTCTGTCTAGGTTTACGCGAAATGAGTTCTGTTTGGAGTCAAAATCTACTATTGGAGTTGAGTTCGCCACTAGAACTCTTCAG</gDNA_template>
            <first_frame> F  S  F  *  S  F  L  S  P  P  R :   F  *  Y  R  E  L  K  L  W  G  I  E  W  I  M  S  T  I  T  C  L  R  S  C  *  L  V  I  L  E  L  E  N  R  T  F  C  L  G  L  R  E  M  S  S  V  W  S  Q  N  L  L  L  E  L  S  S  P  L  E  L  F   </first_frame>
            <second_frame>  S  L  S  K  A  F  S  H  L  P   : G  F  N  T  E  N  *  S  Y  G  E  *  S  G  S  *  V  R  L  L  V  *  D  R  V  D  W  *  F  W  S  W  K  I  E  H  S  V  *  V  Y  A  K  *  V  L  F  G  V  K  I  Y  Y  W  S  *  V  R  H  *  N  S  S  </second_frame>
            <third_frame>   L  F  L  K  L  S  L  T  S  Q  :  V  L  I  Q  R  I  E  V  M  G  N  R  V  D  H  E  Y  D  Y  L  F  K  I  V  L  I  G  D  S  G  V  G  K  S  N  I  L  S  R  F  T  R  N  E  F  C  L  E  S  K  S  T  I  G  V  E  F  A  T  R  T  L  Q </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C06SLe0008G21.1" strand="-"/>
                <serials PGL_serial="2" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="69440" stop="69411"/>
                    <exon start="69067" stop="68879"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>219</number_coding_nucleotides>
                  <number_encoded_amino_acids>73</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>LFLKLSLTSQVLIQRIEVMGNRVDHEYDYLFKIVLIGDSGVGKSNILSRFTRNEFCLESKSTIGVEFATRTLQ</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 23 chains have been computed
$ 
$ memory statistics:
$ 4048 bytes spliced alignments in total
$ 2 spliced alignments have been stored
$ 2024 bytes was the average size of a spliced alignment
$ 6864 bytes predicted gene locations in total
$ 2 predicted gene locations have been stored
$ 3432 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 23 backtrace matrices have been allocated
$ 
$ date finished: 2009-01-16 17:34:19
-->
