<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-01-17 08:24:16"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C06SLm0124M03-gGDTh/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C06SLm0124M03-gGDTh/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_E_tomato_potato" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C06SLm0124M03-gGDTh/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_E_tomato_potato" ref_id="SGN-E357559" ref_strand="-" ref_description="SGN-E357559 [cTOS-23-F2]">
      <seq>tgtgttggttcgtgacacctgatcccttaatctacgtgtcggtttgtgacacccgatcccctaattctacgtgtcagttcgtgacacccgatcccctaatctcattctatcaattcatcaagccttctcccttaccaaggcatcatcaatctcattactttagttcatcaagccttctcccttaccaaggcatcatcattaaaaagagattaggtttttacaagatttgggattcaataacttcatcatgcttatataataacaattatatagttacattcatgcaagcatacaattaagcacatagcagggtttacaatattatcaatacatatcattctctattaagagtttactacgaatatcgtaagagaaacaataacctacctccaccgaagacta</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C06SLm0124M03-gGDTh/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C06SLm0124M03.1" temp_strand="+" temp_description="C06SLm0124M03.1  AC211086.1 htgs_phase:1 submitted_to_sgn_as:C06SLm0124M03 sequenced_by:cbsg upload_account_name:netherlands [organism=Solanum lycopersicum]">
        <position start="4495" stop="5535"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="4794" g_stop="4933" g_length="140"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="139" r_length="139" r_score="0.921"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="4934" i_stop="4983" i_length="50">
            <donor d_prob="0.977" d_score="0.94"/>
            <acceptor a_prob="0.000" a_score="0.92"/>
          </gDNA_intron_boundary>
          <shorter_than_min_intron_len/>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="4984" g_stop="5210" g_length="227"/>
          <reference_exon_boundary r_type="cDNA" r_start="140" r_stop="364" r_length="225" r_score="0.907"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C06SLm0124M03.1" gen_strand="+" ref_id="SGN-E357559" ref_strand="-">
        <total_alignment_score>0.913</total_alignment_score>
        <cumulative_length_of_scored_exons>367</cumulative_length_of_scored_exons>
        <coverage percentage="0.913" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C06SLm0124M03.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E357559" rDNA_strand="-"/>
        <gDNA_exon_coordinates>
          <exon e_start="4794" e_stop="4933"/>
          <exon e_start="4984" e_stop="5210"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>CGTGTTGGTTCGTGACACCCGATCCCCTAAATCTATGTGTCGGTTCGTGACACCCGATCCCCTAAATCTACGTGTCGGTTCGTGACACCCGATCCCCTAATCTCATTCTATCAATTCATCAAGCCTTCTCTTATACCAAGGCATCATCAATCTCATTACTTTAGTTCATCAAGCCTTCTTTTATACCAAGGCATCATCAATCTCATTACTTTAGTTCATCAAGCCTTCTTTTATACCAAGGCATCATCATTAACAAGAGATTAGGTTTTTTATCAAGATTTGGGATTCAATAGCTTCATCATGCTTATTTCATCACAATCATATAATCACATTCATGCAAGCATACAATTAAGCATATAGCAGGGTTTACAACACTACCAATACATATCATTCGCTATTAAGTGTTTACTATGAATA</genome_strand>
        <mrna_strand>TGTGTTGGTTCGTGACACCTGAT-CCCTTAATCTACGTGTCGGTTTGTGACACCCGATCCCCTAATTCTACGTGTCAGTTCGTGACACCCGATCCCCTAATCTCATTCTATCAATTCATCAAGCCTTCTCCCTTACCAAG..................................................GCATCATCAATCTCATTACTTTAGTTCATCAAGCCTTCTCCCTTACCAAGGCATCATCATTAAAAAGAGATTAGG-TTTTTA-CAAGATTTGGGATTCAATAACTTCATCATGCTTATATAATAACAATTATATAGTTACATTCATGCAAGCATACAATTAAGCACATAGCAGGGTTTACAATATTATCAATACATATCATTCTCTATTAAGAGTTTACTACGAATA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="+" PGL_start="4794" PGL_stop="5210"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="4794" e_stop="4933"/>
            <exon e_start="4984" e_stop="5210"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.977" acc_prob="0.000" e_score="0.921"/>
          <exon-only e_score="0.907"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.921">
            <gDNA_exon_boundary e_start="4794" e_stop="4933" e_length="140"/>
          </exon>
          <intron i_serial="1" don_prob="0.977" acc_prob="0.000">
            <gDNA_intron_boundary i_start="4934" i_stop="4983" i_length="50"/>
          </intron>
          <exon e_serial="2" e_score="0.907">
            <gDNA_exon_boundary e_start="4984" e_stop="5210" e_length="227"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="4794" stop="4933"/>
              <exon start="4984" stop="5210"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E357559" strand="-"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>CGTGTTGGTTCGTGACACCCGATCCCCTAAATCTATGTGTCGGTTCGTGACACCCGATCCCCTAAATCTACGTGTCGGTTCGTGACACCCGATCCCCTAATCTCATTCTATCAATTCATCAAGCCTTCTCTTATACCAAG : GCATCATCAATCTCATTACTTTAGTTCATCAAGCCTTCTTTTATACCAAGGCATCATCATTAACAAGAGATTAGGTTTTTTATCAAGATTTGGGATTCAATAGCTTCATCATGCTTATTTCATCACAATCATATAATCACATTCATGCAAGCATACAATTAAGCATATAGCAGGGTTTACAACACTACCAATACATATCATTCGCTATTAAGTGTTTACTATGAATA</gDNA_template>
            <first_frame> R  V  G  S  *  H  P  I  P  *  I  Y  V  S  V  R  D  T  R  S  P  K  S  T  C  R  F  V  T  P  D  P  L  I  S  F  Y  Q  F  I  K  P  S  L  I  P  R :   H  H  Q  S  H  Y  F  S  S  S  S  L  L  L  Y  Q  G  I  I  I  N  K  R  L  G  F  L  S  R  F  G  I  Q  *  L  H  H  A  Y  F  I  T  I  I  *  S  H  S  C  K  H  T  I  K  H  I  A  G  F  T  T  L  P  I  H  I  I  R  Y  *  V  F  T  M  N  </first_frame>
            <second_frame>  V  L  V  R  D  T  R  S  P  K  S  M  C  R  F  V  T  P  D  P  L  N  L  R  V  G  S  *  H  P  I  P  *  S  H  S  I  N  S  S  S  L  L  L  Y  Q   : G  I  I  N  L  I  T  L  V  H  Q  A  F  F  Y  T  K  A  S  S  L  T  R  D  *  V  F  Y  Q  D  L  G  F  N  S  F  I  M  L  I  S  S  Q  S  Y  N  H  I  H  A  S  I  Q  L  S  I  *  Q  G  L  Q  H  Y  Q  Y  I  S  F  A  I  K  C  L  L  *  I </second_frame>
            <third_frame>   C  W  F  V  T  P  D  P  L  N  L  C  V  G  S  *  H  P  I  P  *  I  Y  V  S  V  R  D  T  R  S  P  N  L  I  L  S  I  H  Q  A  F  S  Y  T  K  :  A  S  S  I  S  L  L  *  F  I  K  P  S  F  I  P  R  H  H  H  *  Q  E  I  R  F  F  I  K  I  W  D  S  I  A  S  S  C  L  F  H  H  N  H  I  I  T  F  M  Q  A  Y  N  *  A  Y  S  R  V  Y  N  T  T  N  T  Y  H  S  L  L  S  V  Y  Y  E   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C06SLm0124M03.1" strand="+"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="4824" stop="4933"/>
                    <exon start="4984" stop="5086"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>210</number_coding_nucleotides>
                  <number_encoded_amino_acids>70</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>IYVSVRDTRSPKSTCRFVTPDPLISFYQFIKPSLIPRHHQSHYFSSSSLLLYQGIIINKRLGFLSRFGIQ*</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 150 chains have been computed
$ 
$ memory statistics:
$ 2024 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 2024 bytes was the average size of a spliced alignment
$ 5560 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5560 bytes was the average size of a predicted gene location
$ 1 megabytes was the average size of the backtrace matrix
$ 179 backtrace matrices have been allocated
$ 
$ date finished: 2009-01-17 08:26:48
-->
