<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-12-01 08:22:51"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C02HBa0030E13-j0fao/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C02HBa0030E13-j0fao/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C02HBa0030E13-j0fao/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" ref_id="C2_At5g67620" ref_strand="+" ref_description="C2_At5g67620">
      <seq>atttcatttaccaccaaatttacttcattttctgccacgcttccgtacatcattattcacttcttcttcttcctctctttagctcatataaactccaaacaaaattacacaactgaaaaccgtgcgtacgtagtttttcttcccatattggtgattgaatttttctgtggaatcttctgcatcgttttatcaatcgatcgaccgaccggcgggtgtttgagtttaagatggggaattgccaagcggcagaggcagcaacagtagtgattcaacatccaggcaataaaattgagaggatttattggtctataagtgcacatgaagtcatgagttcgaatcctggccactacgtcgcccttgttatcacttctccaactgagagaacacacaatggttcgcccgtcaggcagcttaagcttctccgccccggtgatactttgcttcttggacaagtttatcgactcatcagcttcgaagatgtactaaaagagtttgctgcaaaaaagtgtgtgaaacttggcaagttac</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C02HBa0030E13-j0fao/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C02HBa0030E13.1" temp_strand="-" temp_description="C02HBa0030E13.1  AC226502.1 htgs_phase:3 submitted_to_sgn_as:C02HBa0030E13 sequenced_by:kribb upload_account_name:korea">
        <position start="58321" stop="56955"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="58022" g_stop="57829" g_length="194"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="184" r_length="184" r_score="0.835"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="57828" i_stop="57681" i_length="148">
            <donor d_prob="0.590" d_score="0.90"/>
            <acceptor a_prob="0.731" a_score="0.76"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="57680" g_stop="57381" g_length="300"/>
          <reference_exon_boundary r_type="cDNA" r_start="185" r_stop="477" r_length="293" r_score="0.937"/>
        </exon>
        <intron i_serial="2">
          <gDNA_intron_boundary i_start="57380" i_stop="57306" i_length="75">
            <donor d_prob="1.000" d_score="0.96"/>
            <acceptor a_prob="0.998" a_score="0.94"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="3">
          <gDNA_exon_boundary g_start="57305" g_stop="57255" g_length="51"/>
          <reference_exon_boundary r_type="cDNA" r_start="478" r_stop="528" r_length="51" r_score="0.941"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C02HBa0030E13.1" gen_strand="-" ref_id="C2_At5g67620" ref_strand="+">
        <total_alignment_score>0.901</total_alignment_score>
        <cumulative_length_of_scored_exons>545</cumulative_length_of_scored_exons>
        <coverage percentage="1.032" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C02HBa0030E13.1" gen_strand="-"/>
        <rDNA rDNA_id="C2_At5g67620" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="58022" e_stop="57829"/>
          <exon e_start="57680" e_stop="57381"/>
          <exon e_start="57305" e_stop="57255"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GTTTCATTTACCACCAAATTTACTTCATTTTCTGCCACGCTTCCTTACATCATTATTTTCCCCCTGTTACTACTTCTTCTTCTTCCTTCTCTTTAGCTCATATAAACTCCAAA-AAATTTACACAACTGAAAACCGTGCGT----AGTTTTTCTTCCTTTATTGGTGATTGAATTTTTTGTGTGGATTCTTCTGCATCGGTGAGTGTGTAGACTGTCAGAGTTCTCTCTGTTTTCATTCCTTTATTATTACTTGACAAGTCAGTTTTGGAGTAATCAATCATCTTCTTCTATTCATCTTTAACTTAACGCAGAAAATTAAAATTAAAATTTGTGCATTTTGATATAGTTTGCGCTCTGCATTATTAATCGATCGACCGGCCGGTGTTTGAGTTTAAGATGGGGAATTGCCAAGCGGCAGAGGCAGCAACTGTAGTGATTCAACATCCAGGCAATAAAATTGAGAGGATTTACTGGTCTATAAGTGCACATGAAGTCATGAGTTCGAATCCTGGCCACTACGTCGCCCTTGTTATCACTTCTCCAACGGGGAGAACACACAACGGTTCGCCCGTCAGGCAGCTTAAGCTTCTCCGCCCCGGAGATACTTTGCTTCTTGGACAAGTTTATCGACTCATCTGCTTCGAAGGTAAAAATAAAATATCTCAATTTGTTTTTTCTTCAATAATTTCTTATAATCTGATCGATCATTTTTTTTTTCCAGATGTACTAAAAGAGTTTGCTGCAAAGAAGTGCGTGAAACTTGGCAAGTTGC</genome_strand>
        <mrna_strand>ATTTCATTTACCACCAAATTTACTTCATTTTCTGCCACGCTTCCGTACATCATTA---T-----T----C-ACTTCTTCTTCTTCC-TCTCTTTAGCTCATATAAACTCCAAACAAAATTACACAACTGAAAACCGTGCGTACGTAGTTTTTCTTCCCATATTGGTGATTGAA-TTTTTCTGTGGAATCTTCTGCATCG....................................................................................................................................................TTT----TAT-CA--ATCGATCGACCGACCGGCGGGTGTTTGAGTTTAAGATGGGGAATTGCCAAGCGGCAGAGGCAGCAACAGTAGTGATTCAACATCCAGGCAATAAAATTGAGAGGATTTATTGGTCTATAAGTGCACATGAAGTCATGAGTTCGAATCCTGGCCACTACGTCGCCCTTGTTATCACTTCTCCAACTGAGAGAACACACAATGGTTCGCCCGTCAGGCAGCTTAAGCTTCTCCGCCCCGGTGATACTTTGCTTCTTGGACAAGTTTATCGACTCATCAGCTTCGAAG...........................................................................ATGTACTAAAAGAGTTTGCTGCAAAAAAGTGTGTGAAACTTGGCAAGTTAC</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="58022" PGL_stop="57255"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="58022" e_stop="57829"/>
            <exon e_start="57680" e_stop="57381"/>
            <exon e_start="57305" e_stop="57255"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.590" acc_prob="0.731" e_score="0.835"/>
          <exon-intron don_prob="1.000" acc_prob="0.998" e_score="0.937"/>
          <exon-only e_score="0.941"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.835">
            <gDNA_exon_boundary e_start="58022" e_stop="57829" e_length="194"/>
          </exon>
          <intron i_serial="1" don_prob="0.590" acc_prob="0.731">
            <gDNA_intron_boundary i_start="57828" i_stop="57681" i_length="148"/>
          </intron>
          <exon e_serial="2" e_score="0.937">
            <gDNA_exon_boundary e_start="57680" e_stop="57381" e_length="300"/>
          </exon>
          <intron i_serial="2" don_prob="1.000" acc_prob="0.998">
            <gDNA_intron_boundary i_start="57380" i_stop="57306" i_length="75"/>
          </intron>
          <exon e_serial="3" e_score="0.941">
            <gDNA_exon_boundary e_start="57305" e_stop="57255" e_length="51"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="58022" stop="57829"/>
              <exon start="57680" stop="57381"/>
              <exon start="57305" stop="57255"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="C2_At5g67620" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>GTTTCATTTACCACCAAATTTACTTCATTTTCTGCCACGCTTCCTTACATCATTATTTTCCCCCTGTTACTACTTCTTCTTCTTCCTTCTCTTTAGCTCATATAAACTCCAAAAAATTTACACAACTGAAAACCGTGCGTAGTTTTTCTTCCTTTATTGGTGATTGAATTTTTTGTGTGGATTCTTCTGCATCG : TTTGCGCTCTGCATTATTAATCGATCGACCGGCCGGTGTTTGAGTTTAAGATGGGGAATTGCCAAGCGGCAGAGGCAGCAACTGTAGTGATTCAACATCCAGGCAATAAAATTGAGAGGATTTACTGGTCTATAAGTGCACATGAAGTCATGAGTTCGAATCCTGGCCACTACGTCGCCCTTGTTATCACTTCTCCAACGGGGAGAACACACAACGGTTCGCCCGTCAGGCAGCTTAAGCTTCTCCGCCCCGGAGATACTTTGCTTCTTGGACAAGTTTATCGACTCATCTGCTTCGAAG : ATGTACTAAAAGAGTTTGCTGCAAAGAAGTGCGTGAAACTTGGCAAGTTGC</gDNA_template>
            <first_frame> V  S  F  T  T  K  F  T  S  F  S  A  T  L  P  Y  I  I  I  F  P  L  L  L  L  L  L  L  P  S  L  *  L  I  *  T  P  K  N  L  H  N  *  K  P  C  V  V  F  L  P  L  L  V  I  E  F  F  V  W  I  L  L  H  R :   L  R  S  A  L  L  I  D  R  P  A  G  V  *  V  *  D  G  E  L  P  S  G  R  G  S  N  C  S  D  S  T  S  R  Q  *  N  *  E  D  L  L  V  Y  K  C  T  *  S  H  E  F  E  S  W  P  L  R  R  P  C  Y  H  F  S  N  G  E  N  T  Q  R  F  A  R  Q  A  A  *  A  S  P  P  R  R  Y  F  A  S  W  T  S  L  S  T  H  L  L  R  R :   C  T  K  R  V  C  C  K  E  V  R  E  T  W  Q  V   </first_frame>
            <second_frame>  F  H  L  P  P  N  L  L  H  F  L  P  R  F  L  T  S  L  F  S  P  C  Y  Y  F  F  F  F  L  L  F  S  S  Y  K  L  Q  K  I  Y  T  T  E  N  R  A  *  F  F  F  L  Y  W  *  L  N  F  L  C  G  F  F  C  I   : V  C  A  L  H  Y  *  S  I  D  R  P  V  F  E  F  K  M  G  N  C  Q  A  A  E  A  A  T  V  V  I  Q  H  P  G  N  K  I  E  R  I  Y  W  S  I  S  A  H  E  V  M  S  S  N  P  G  H  Y  V  A  L  V  I  T  S  P  T  G  R  T  H  N  G  S  P  V  R  Q  L  K  L  L  R  P  G  D  T  L  L  L  G  Q  V  Y  R  L  I  C  F  E   : D  V  L  K  E  F  A  A  K  K  C  V  K  L  G  K  L  </second_frame>
            <third_frame>   F  I  Y  H  Q  I  Y  F  I  F  C  H  A  S  L  H  H  Y  F  P  P  V  T  T  S  S  S  S  F  S  L  A  H  I  N  S  K  K  F  T  Q  L  K  T  V  R  S  F  S  S  F  I  G  D  *  I  F  C  V  D  S  S  A  S  :  F  A  L  C  I  I  N  R  S  T  G  R  C  L  S  L  R  W  G  I  A  K  R  Q  R  Q  Q  L  *  *  F  N  I  Q  A  I  K  L  R  G  F  T  G  L  *  V  H  M  K  S  *  V  R  I  L  A  T  T  S  P  L  L  S  L  L  Q  R  G  E  H  T  T  V  R  P  S  G  S  L  S  F  S  A  P  E  I  L  C  F  L  D  K  F  I  D  S  S  A  S  K  :  M  Y  *  K  S  L  L  Q  R  S  A  *  N  L  A  S  C </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C02HBa0030E13.1" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="57660" stop="57381"/>
                    <exon start="57305" stop="57256"/>
                  </exon_boundaries>
                  <frame>1</frame>
                  <number_coding_nucleotides>330</number_coding_nucleotides>
                  <number_encoded_amino_acids>110</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>SIDRPVFEFKMGNCQAAEAATVVIQHPGNKIERIYWSISAHEVMSSNPGHYVALVITSPTGRTHNGSPVRQLKLLRPGDTLLLGQVYRLICFEDVLKEFAAKKCVKLGKL</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 155 chains have been computed
$ 
$ memory statistics:
$ 2536 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 2536 bytes was the average size of a spliced alignment
$ 5592 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5592 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 155 backtrace matrices have been allocated
$ 
$ date finished: 2009-12-01 08:22:54
-->
