<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2006-10-20 16:09:58"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-gJpfU/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/cxgn-bacpublish-resources-ARK6VE/sgn_marker_seqs" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-ARK6VE/sgn_marker_seqs" ref_id="TG266-R" ref_strand="+" ref_description="TG266-R [rflp] - REVERSE SEQUENCE">
      <seq>catgctgtagaacatgataatgagtgtaatgctcaacaaagataaatgctagaatcaaacaaaagatcataatctatcccgcataattctggcataagtcatgaggatattataatgaacagttaaatactgccaaccagacgctgcataagttatgtcgagcttattgttcttatgcagataactgagtgatacatagtt</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-gJpfU/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C02HBa0291D19.2" temp_strand="-" temp_description="C02HBa0291D19.2  submitted_to_sgn_as:C02HBa0291D19 len=136240">
        <position start="131704" stop="130904"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="131404" g_stop="131204" g_length="201"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="201" r_length="201" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C02HBa0291D19.2" gen_strand="-" ref_id="TG266-R" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>201</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C02HBa0291D19.2" gen_strand="-"/>
        <rDNA rDNA_id="TG266-R" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="131404" e_stop="131204"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>CATGCTGTAGAACATGATAATGAGTGTAATGCTCAACAAAGATAAATGCTAGAATCAAACAAAAGATCATAATCTATCCCGCATAATTCTGGCATAAGTCATGAGGATATTATAATGAACAGTTAAATACTGCCAACCAGACGCTGCATAAGTTATGTCGAGCTTATTGTTCTTATGCAGATAACTGAGTGATACATAGTT</genome_strand>
        <mrna_strand>CATGCTGTAGAACATGATAATGAGTGTAATGCTCAACAAAGATAAATGCTAGAATCAAACAAAAGATCATAATCTATCCCGCATAATTCTGGCATAAGTCATGAGGATATTATAATGAACAGTTAAATACTGCCAACCAGACGCTGCATAAGTTATGTCGAGCTTATTGTTCTTATGCAGATAACTGAGTGATACATAGTT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-ARK6VE/sgn_marker_seqs" ref_id="TG266-F" ref_strand="+" ref_description="TG266-F [rflp] - FORWARD SEQUENCE">
      <seq>acactataaactatgtatcactcagttatctgcataagaacaataagctcgacataacttatgcagcgtctggttggcagtatttaactgttcattataatatcctcatgacttatgccagaattatgcgggatagattatgatcttttgtttgattctagcatttatctttgttgagcattacactcattatcatgttctacagcatg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-gJpfU/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C02HBa0291D19.2" temp_strand="+" temp_description="C02HBa0291D19.2  submitted_to_sgn_as:C02HBa0291D19 len=136240">
        <position start="130895" stop="131704"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="131204" g_stop="131404" g_length="201"/>
          <reference_exon_boundary r_type="cDNA" r_start="9" r_stop="209" r_length="201" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C02HBa0291D19.2" gen_strand="+" ref_id="TG266-F" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>201</cumulative_length_of_scored_exons>
        <coverage percentage="0.962" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C02HBa0291D19.2" gen_strand="+"/>
        <rDNA rDNA_id="TG266-F" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="131204" e_stop="131404"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AACTATGTATCACTCAGTTATCTGCATAAGAACAATAAGCTCGACATAACTTATGCAGCGTCTGGTTGGCAGTATTTAACTGTTCATTATAATATCCTCATGACTTATGCCAGAATTATGCGGGATAGATTATGATCTTTTGTTTGATTCTAGCATTTATCTTTGTTGAGCATTACACTCATTATCATGTTCTACAGCATG</genome_strand>
        <mrna_strand>AACTATGTATCACTCAGTTATCTGCATAAGAACAATAAGCTCGACATAACTTATGCAGCGTCTGGTTGGCAGTATTTAACTGTTCATTATAATATCCTCATGACTTATGCCAGAATTATGCGGGATAGATTATGATCTTTTGTTTGATTCTAGCATTTATCTTTGTTGAGCATTACACTCATTATCATGTTCTACAGCATG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>2</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="131404" PGL_stop="131204"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="131404" e_stop="131204"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="131404" e_stop="131204" e_length="201"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="131404" stop="131204"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="TG266-R" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>CATGCTGTAGAACATGATAATGAGTGTAATGCTCAACAAAGATAAATGCTAGAATCAAACAAAAGATCATAATCTATCCCGCATAATTCTGGCATAAGTCATGAGGATATTATAATGAACAGTTAAATACTGCCAACCAGACGCTGCATAAGTTATGTCGAGCTTATTGTTCTTATGCAGATAACTGAGTGATACATAGTT</gDNA_template>
            <first_frame> H  A  V  E  H  D  N  E  C  N  A  Q  Q  R  *  M  L  E  S  N  K  R  S  *  S  I  P  H  N  S  G  I  S  H  E  D  I  I  M  N  S  *  I  L  P  T  R  R  C  I  S  Y  V  E  L  I  V  L  M  Q  I  T  E  *  Y  I  V </first_frame>
            <second_frame>  M  L  *  N  M  I  M  S  V  M  L  N  K  D  K  C  *  N  Q  T  K  D  H  N  L  S  R  I  I  L  A  *  V  M  R  I  L  *  *  T  V  K  Y  C  Q  P  D  A  A  *  V  M  S  S  L  L  F  L  C  R  *  L  S  D  T  *   </second_frame>
            <third_frame>   C  C  R  T  *  *  *  V  *  C  S  T  K  I  N  A  R  I  K  Q  K  I  I  I  Y  P  A  *  F  W  H  K  S  *  G  Y  Y  N  E  Q  L  N  T  A  N  Q  T  L  H  K  L  C  R  A  Y  C  S  Y  A  D  N  *  V  I  H  S  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <none gDNA_id="C02HBa0291D19.2"/>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="2" PGL_strand="+" PGL_start="131204" PGL_stop="131404"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="131204" e_stop="131404"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="131204" e_stop="131404" e_length="201"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="131204" stop="131404"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="TG266-F" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="2" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>AACTATGTATCACTCAGTTATCTGCATAAGAACAATAAGCTCGACATAACTTATGCAGCGTCTGGTTGGCAGTATTTAACTGTTCATTATAATATCCTCATGACTTATGCCAGAATTATGCGGGATAGATTATGATCTTTTGTTTGATTCTAGCATTTATCTTTGTTGAGCATTACACTCATTATCATGTTCTACAGCATG</gDNA_template>
            <first_frame> N  Y  V  S  L  S  Y  L  H  K  N  N  K  L  D  I  T  Y  A  A  S  G  W  Q  Y  L  T  V  H  Y  N  I  L  M  T  Y  A  R  I  M  R  D  R  L  *  S  F  V  *  F  *  H  L  S  L  L  S  I  T  L  I  I  M  F  Y  S  M </first_frame>
            <second_frame>  T  M  Y  H  S  V  I  C  I  R  T  I  S  S  T  *  L  M  Q  R  L  V  G  S  I  *  L  F  I  I  I  S  S  *  L  M  P  E  L  C  G  I  D  Y  D  L  L  F  D  S  S  I  Y  L  C  *  A  L  H  S  L  S  C  S  T  A   </second_frame>
            <third_frame>   L  C  I  T  Q  L  S  A  *  E  Q  *  A  R  H  N  L  C  S  V  W  L  A  V  F  N  C  S  L  *  Y  P  H  D  L  C  Q  N  Y  A  G  *  I  M  I  F  C  L  I  L  A  F  I  F  V  E  H  Y  T  H  Y  H  V  L  Q  H  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <none gDNA_id="C02HBa0291D19.2"/>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 4 chains have been computed
$ 
$ memory statistics:
$ 3568 bytes spliced alignments in total
$ 2 spliced alignments have been stored
$ 1784 bytes was the average size of a spliced alignment
$ 6704 bytes predicted gene locations in total
$ 2 predicted gene locations have been stored
$ 3352 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 4 backtrace matrices have been allocated
$ 
$ date finished: 2006-10-20 16:10:00
-->
