<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2006-11-17 22:05:33"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-vPMej/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/cxgn-bacpublish-resources-5MJKxE/sgn_marker_seqs" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-5MJKxE/sgn_marker_seqs" ref_id="T1395" ref_strand="+" ref_description="T1395 [cos]">
      <seq>accatttagcaaacaaaaatggctaccaaacatctttttttctttgctattctctttttttcagctgcctctgtttttgcagaggaaaatcctagccttaaaatggactattacaaggacacttgccctcaagctgaagaaatcatcaaagaacaagtcaaacttctctacaaacgccacaagaatactgcattttcttggctaagaaacatattccatgactgcttcgttgagtcatgtgatgcttccttgttgctggactcaacaaggaggatgctgtctgagaaagagacagacaggagttttggtatgagaaatttcagatacattgagactattaaagaagctgtagaaagggaatgccctggtgttgtttcttgtgctgatattcttgttttgtctggtagagatggtattgttgcactaggagggccacacattcctctcaaaactggaagaagagatggaagaaaaagcagagcagacattcttgaacagcacctcccagatcacaatgaaagcatgagtgttgttcttgaaagatttgctaacattgga</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-vPMej/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C02SLm0008E03.1" temp_strand="-" temp_description="C02SLm0008E03.1  submitted_to_sgn_as:C02Mbo0008E03">
        <position start="40975" stop="39597"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="40675" g_stop="40442" g_length="234"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="234" r_length="234" r_score="0.974"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="40441" i_stop="40350" i_length="92">
            <donor d_prob="0.979" d_score="0.98"/>
            <acceptor a_prob="0.994" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="40349" g_stop="40161" g_length="189"/>
          <reference_exon_boundary r_type="cDNA" r_start="235" r_stop="423" r_length="189" r_score="0.984"/>
        </exon>
        <intron i_serial="2">
          <gDNA_intron_boundary i_start="40160" i_stop="40032" i_length="129">
            <donor d_prob="0.861" d_score="0.96"/>
            <acceptor a_prob="0.999" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="3">
          <gDNA_exon_boundary g_start="40031" g_stop="39897" g_length="135"/>
          <reference_exon_boundary r_type="cDNA" r_start="424" r_stop="558" r_length="135" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C02SLm0008E03.1" gen_strand="-" ref_id="T1395" ref_strand="+">
        <total_alignment_score>0.984</total_alignment_score>
        <cumulative_length_of_scored_exons>558</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C02SLm0008E03.1" gen_strand="-"/>
        <rDNA rDNA_id="T1395" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="40675" e_stop="40442"/>
          <exon e_start="40349" e_stop="40161"/>
          <exon e_start="40031" e_stop="39897"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>ACCATTTAGCAAAGTAAAATGGCTACCAAACATCTTTTTTTCTTTGCTATTCTCTTGTTTTCAGCTGCCTCTGTTTTTGCAGAGGAAAATCCTAGCCTTGTAATGGACTATTACAAGGACACTTGCCCTCAAGCTGAAGAAATCATCAAAGAACAAGTCAAACTTCTCTACAAACGCCACAAGAATACTGCATTTTCTTGGCTAAGAAACATATTCCATGACTGCTTTGTTGAGGTACTAAAAAAAATGAAACTTTCTTTTCATTTTTAGACACCCTTTTTGGAGATGTTGAATTTACTGTTCTTTTTTTTTATTTTTAAATACAGTCATGTGATGCTTCCTTGTTGCTGGACTCAACAAGGAGGATGCTGTCTGAGAAAGAGACAGACAGGAGTTTTGGTATGAGAAATTTCAGATACATTGAGACTATTAAAGAAGCTGTAGAAAGGGAGTGCCCTGGTGTTGTTTCTTGTGCTGATATTCTTGTGTTGTCTGGTAGAGATGGTATTGTTGCTGTAAGTTGTTACTTTGTAGTAGATCTGGACTTGTTTATGTATTTTTGAGAAGCTTAGATATTTGGTTCTGAAAAGTGGTTTAGTTAAATATTGCTTGTACTAATATGTATAATGGTGTCTTGTACATAGCTAGGAGGGCCACACATTCCTCTCAAAACTGGAAGAAGAGATGGAAGAAAAAGCAGAGCAGACATTCTTGAACAGCACCTCCCAGATCACAATGAAAGCATGAGTGTTGTTCTTGAAAGATTTGCTAACATTGGA</genome_strand>
        <mrna_strand>ACCATTTAGCAAACAAAAATGGCTACCAAACATCTTTTTTTCTTTGCTATTCTCTTTTTTTCAGCTGCCTCTGTTTTTGCAGAGGAAAATCCTAGCCTTAAAATGGACTATTACAAGGACACTTGCCCTCAAGCTGAAGAAATCATCAAAGAACAAGTCAAACTTCTCTACAAACGCCACAAGAATACTGCATTTTCTTGGCTAAGAAACATATTCCATGACTGCTTCGTTGAG............................................................................................TCATGTGATGCTTCCTTGTTGCTGGACTCAACAAGGAGGATGCTGTCTGAGAAAGAGACAGACAGGAGTTTTGGTATGAGAAATTTCAGATACATTGAGACTATTAAAGAAGCTGTAGAAAGGGAATGCCCTGGTGTTGTTTCTTGTGCTGATATTCTTGTTTTGTCTGGTAGAGATGGTATTGTTGCA.................................................................................................................................CTAGGAGGGCCACACATTCCTCTCAAAACTGGAAGAAGAGATGGAAGAAAAAGCAGAGCAGACATTCTTGAACAGCACCTCCCAGATCACAATGAAAGCATGAGTGTTGTTCTTGAAAGATTTGCTAACATTGGA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="40675" PGL_stop="39897"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="40675" e_stop="40442"/>
            <exon e_start="40349" e_stop="40161"/>
            <exon e_start="40031" e_stop="39897"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.979" acc_prob="0.994" e_score="0.974"/>
          <exon-intron don_prob="0.861" acc_prob="0.999" e_score="0.984"/>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.974">
            <gDNA_exon_boundary e_start="40675" e_stop="40442" e_length="234"/>
          </exon>
          <intron i_serial="1" don_prob="0.979" acc_prob="0.994">
            <gDNA_intron_boundary i_start="40441" i_stop="40350" i_length="92"/>
          </intron>
          <exon e_serial="2" e_score="0.984">
            <gDNA_exon_boundary e_start="40349" e_stop="40161" e_length="189"/>
          </exon>
          <intron i_serial="2" don_prob="0.861" acc_prob="0.999">
            <gDNA_intron_boundary i_start="40160" i_stop="40032" i_length="129"/>
          </intron>
          <exon e_serial="3" e_score="1.000">
            <gDNA_exon_boundary e_start="40031" e_stop="39897" e_length="135"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="40675" stop="40442"/>
              <exon start="40349" stop="40161"/>
              <exon start="40031" stop="39897"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="T1395" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>ACCATTTAGCAAAGTAAAATGGCTACCAAACATCTTTTTTTCTTTGCTATTCTCTTGTTTTCAGCTGCCTCTGTTTTTGCAGAGGAAAATCCTAGCCTTGTAATGGACTATTACAAGGACACTTGCCCTCAAGCTGAAGAAATCATCAAAGAACAAGTCAAACTTCTCTACAAACGCCACAAGAATACTGCATTTTCTTGGCTAAGAAACATATTCCATGACTGCTTTGTTGAG : TCATGTGATGCTTCCTTGTTGCTGGACTCAACAAGGAGGATGCTGTCTGAGAAAGAGACAGACAGGAGTTTTGGTATGAGAAATTTCAGATACATTGAGACTATTAAAGAAGCTGTAGAAAGGGAGTGCCCTGGTGTTGTTTCTTGTGCTGATATTCTTGTGTTGTCTGGTAGAGATGGTATTGTTGCT : CTAGGAGGGCCACACATTCCTCTCAAAACTGGAAGAAGAGATGGAAGAAAAAGCAGAGCAGACATTCTTGAACAGCACCTCCCAGATCACAATGAAAGCATGAGTGTTGTTCTTGAAAGATTTGCTAACATTGGA</gDNA_template>
            <first_frame> T  I  *  Q  S  K  M  A  T  K  H  L  F  F  F  A  I  L  L  F  S  A  A  S  V  F  A  E  E  N  P  S  L  V  M  D  Y  Y  K  D  T  C  P  Q  A  E  E  I  I  K  E  Q  V  K  L  L  Y  K  R  H  K  N  T  A  F  S  W  L  R  N  I  F  H  D  C  F  V  E  :  S  C  D  A  S  L  L  L  D  S  T  R  R  M  L  S  E  K  E  T  D  R  S  F  G  M  R  N  F  R  Y  I  E  T  I  K  E  A  V  E  R  E  C  P  G  V  V  S  C  A  D  I  L  V  L  S  G  R  D  G  I  V  A  :  L  G  G  P  H  I  P  L  K  T  G  R  R  D  G  R  K  S  R  A  D  I  L  E  Q  H  L  P  D  H  N  E  S  M  S  V  V  L  E  R  F  A  N  I  G </first_frame>
            <second_frame>  P  F  S  K  V  K  W  L  P  N  I  F  F  S  L  L  F  S  C  F  Q  L  P  L  F  L  Q  R  K  I  L  A  L  *  W  T  I  T  R  T  L  A  L  K  L  K  K  S  S  K  N  K  S  N  F  S  T  N  A  T  R  I  L  H  F  L  G  *  E  T  Y  S  M  T  A  L  L  S :   H  V  M  L  P  C  C  W  T  Q  Q  G  G  C  C  L  R  K  R  Q  T  G  V  L  V  *  E  I  S  D  T  L  R  L  L  K  K  L  *  K  G  S  A  L  V  L  F  L  V  L  I  F  L  C  C  L  V  E  M  V  L  L  L :   *  E  G  H  T  F  L  S  K  L  E  E  E  M  E  E  K  A  E  Q  T  F  L  N  S  T  S  Q  I  T  M  K  A  *  V  L  F  L  K  D  L  L  T  L   </second_frame>
            <third_frame>   H  L  A  K  *  N  G  Y  Q  T  S  F  F  L  C  Y  S  L  V  F  S  C  L  C  F  C  R  G  K  S  *  P  C  N  G  L  L  Q  G  H  L  P  S  S  *  R  N  H  Q  R  T  S  Q  T  S  L  Q  T  P  Q  E  Y  C  I  F  L  A  K  K  H  I  P  *  L  L  C  *   : V  M  *  C  F  L  V  A  G  L  N  K  E  D  A  V  *  E  R  D  R  Q  E  F  W  Y  E  K  F  Q  I  H  *  D  Y  *  R  S  C  R  K  G  V  P  W  C  C  F  L  C  *  Y  S  C  V  V  W  *  R  W  Y  C  C   : S  R  R  A  T  H  S  S  Q  N  W  K  K  R  W  K  K  K  Q  S  R  H  S  *  T  A  P  P  R  S  Q  *  K  H  E  C  C  S  *  K  I  C  *  H  W  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C02SLm0008E03.1" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="40666" stop="40442"/>
                    <exon start="40349" stop="40161"/>
                    <exon start="40031" stop="39897"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>549</number_coding_nucleotides>
                  <number_encoded_amino_acids>183</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>QSKMATKHLFFFAILLFSAASVFAEENPSLVMDYYKDTCPQAEEIIKEQVKLLYKRHKNTAFSWLRNIFHDCFVESCDASLLLDSTRRMLSEKETDRSFGMRNFRYIETIKEAVERECPGVVSCADILVLSGRDGIVALGGPHIPLKTGRRDGRKSRADILEQHLPDHNESMSVVLERFANIG</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 2 chains have been computed
$ 
$ memory statistics:
$ 2280 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 2280 bytes was the average size of a spliced alignment
$ 5592 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5592 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 2 backtrace matrices have been allocated
$ 
$ date finished: 2006-11-17 22:05:34
-->
