<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-12-01 10:23:10"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C02HBa0280E02-TYinW/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C02HBa0280E02-TYinW/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C02HBa0280E02-TYinW/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" ref_id="T0869" ref_strand="+" ref_description="T0869">
      <seq>gtcatccggaatatcaccttgcaaagaaacaaatgactggctttggtggtgtggtcagttttgaggttgatggagacctcctaactactgcaaaatttgtggatgctctgaggattccttatattgctccatcgtttggaggttgtgagaacattgtggaccaaccaacaataatggcttattgggatcttagccagtctgatagagcaaagtatggcatcttggataacttggtccgatttagctttggagtggaagattttgaagatgtgaaagctgatgttcttcaagctttggattccattt</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C02HBa0280E02-TYinW/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C02HBa0280E02.2" temp_strand="-" temp_description="C02HBa0280E02.2  AC215433.2 htgs_phase:3 submitted_to_sgn_as:C02HBa0280E02 sequenced_by:kribb upload_account_name:korea">
        <position start="113885" stop="112733"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="113585" g_stop="113521" g_length="65"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="65" r_length="65" r_score="1.000"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="113520" i_stop="113432" i_length="89">
            <donor d_prob="0.628" d_score="1.00"/>
            <acceptor a_prob="0.864" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="113431" g_stop="113313" g_length="119"/>
          <reference_exon_boundary r_type="cDNA" r_start="66" r_stop="184" r_length="119" r_score="0.975"/>
        </exon>
        <intron i_serial="2">
          <gDNA_intron_boundary i_start="113312" i_stop="113155" i_length="158">
            <donor d_prob="0.977" d_score="0.94"/>
            <acceptor a_prob="0.965" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="3">
          <gDNA_exon_boundary g_start="113154" g_stop="113033" g_length="122"/>
          <reference_exon_boundary r_type="cDNA" r_start="185" r_stop="306" r_length="122" r_score="0.992"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C02HBa0280E02.2" gen_strand="-" ref_id="T0869" ref_strand="+">
        <total_alignment_score>0.987</total_alignment_score>
        <cumulative_length_of_scored_exons>306</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C02HBa0280E02.2" gen_strand="-"/>
        <rDNA rDNA_id="T0869" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="113585" e_stop="113521"/>
          <exon e_start="113431" e_stop="113313"/>
          <exon e_start="113154" e_stop="113033"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GTCATCCGGAATATCACCTTGCAAAGAAACAAATGACTGGCTTTGGTGGTGTGGTCAGTTTTGAGGTCTGTAGATCTATGGTCTTTTTTTAGCCAGGAATCCCTGTCAGTTCTCTCGCTTTCAGTATATTAAAGGGCTATATTTTTTCTATAAGGTTGATGGAGACCTCCTAACTACTGCAAAATTTGTGGATGCTCTGAGGATTCCTTATATTGCTCCATCGTTTGGAGGTTGTGAGAGCATTGTGGACCAACCAGCAATAATGTCTTATTGGTATGTCAATGTTCTATTTCATGGTTACTTATCAATAAAGTATACTCTATTATGGGGAGAGAATCTGGAAACTATAACTTTTCTATCAACACTACTAACATATCGAGTGCTAAATGAAAACATTGTGGATAACATGCTCGATTTGAACTGTAAAACAGGGATCTTAGCCAGTCTGATAGAGCAAAGTATGGCATCTTGGATAACTTGGTCCGATTTAGCTTTGGAGTGGAAGATTTTGAAGATGTGAAAGCTGATGTTCTTCAGGCTTTGGATTCCATTT</genome_strand>
        <mrna_strand>GTCATCCGGAATATCACCTTGCAAAGAAACAAATGACTGGCTTTGGTGGTGTGGTCAGTTTTGAG.........................................................................................GTTGATGGAGACCTCCTAACTACTGCAAAATTTGTGGATGCTCTGAGGATTCCTTATATTGCTCCATCGTTTGGAGGTTGTGAGAACATTGTGGACCAACCAACAATAATGGCTTATTG..............................................................................................................................................................GGATCTTAGCCAGTCTGATAGAGCAAAGTATGGCATCTTGGATAACTTGGTCCGATTTAGCTTTGGAGTGGAAGATTTTGAAGATGTGAAAGCTGATGTTCTTCAAGCTTTGGATTCCATTT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="113585" PGL_stop="113033"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="113585" e_stop="113521"/>
            <exon e_start="113431" e_stop="113313"/>
            <exon e_start="113154" e_stop="113033"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.628" acc_prob="0.864" e_score="1.000"/>
          <exon-intron don_prob="0.977" acc_prob="0.965" e_score="0.975"/>
          <exon-only e_score="0.992"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="113585" e_stop="113521" e_length="65"/>
          </exon>
          <intron i_serial="1" don_prob="0.628" acc_prob="0.864">
            <gDNA_intron_boundary i_start="113520" i_stop="113432" i_length="89"/>
          </intron>
          <exon e_serial="2" e_score="0.975">
            <gDNA_exon_boundary e_start="113431" e_stop="113313" e_length="119"/>
          </exon>
          <intron i_serial="2" don_prob="0.977" acc_prob="0.965">
            <gDNA_intron_boundary i_start="113312" i_stop="113155" i_length="158"/>
          </intron>
          <exon e_serial="3" e_score="0.992">
            <gDNA_exon_boundary e_start="113154" e_stop="113033" e_length="122"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="113585" stop="113521"/>
              <exon start="113431" stop="113313"/>
              <exon start="113154" stop="113033"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="T0869" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>GTCATCCGGAATATCACCTTGCAAAGAAACAAATGACTGGCTTTGGTGGTGTGGTCAGTTTTGAG : GTTGATGGAGACCTCCTAACTACTGCAAAATTTGTGGATGCTCTGAGGATTCCTTATATTGCTCCATCGTTTGGAGGTTGTGAGAGCATTGTGGACCAACCAGCAATAATGTCTTATTG : GGATCTTAGCCAGTCTGATAGAGCAAAGTATGGCATCTTGGATAACTTGGTCCGATTTAGCTTTGGAGTGGAAGATTTTGAAGATGTGAAAGCTGATGTTCTTCAGGCTTTGGATTCCATTT</gDNA_template>
            <first_frame> V  I  R  N  I  T  L  Q  R  N  K  *  L  A  L  V  V  W  S  V  L  R :   L  M  E  T  S  *  L  L  Q  N  L  W  M  L  *  G  F  L  I  L  L  H  R  L  E  V  V  R  A  L  W  T  N  Q  Q  *  C  L  I   : G  I  L  A  S  L  I  E  Q  S  M  A  S  W  I  T  W  S  D  L  A  L  E  W  K  I  L  K  M  *  K  L  M  F  F  R  L  W  I  P  F </first_frame>
            <second_frame>  S  S  G  I  S  P  C  K  E  T  N  D  W  L  W  W  C  G  Q  F  *   : G  *  W  R  P  P  N  Y  C  K  I  C  G  C  S  E  D  S  L  Y  C  S  I  V  W  R  L  *  E  H  C  G  P  T  S  N  N  V  L  L  :  G  S  *  P  V  *  *  S  K  V  W  H  L  G  *  L  G  P  I  *  L  W  S  G  R  F  *  R  C  E  S  *  C  S  S  G  F  G  F  H   </second_frame>
            <third_frame>   H  P  E  Y  H  L  A  K  K  Q  M  T  G  F  G  G  V  V  S  F  E  :  V  D  G  D  L  L  T  T  A  K  F  V  D  A  L  R  I  P  Y  I  A  P  S  F  G  G  C  E  S  I  V  D  Q  P  A  I  M  S  Y  W :   D  L  S  Q  S  D  R  A  K  Y  G  I  L  D  N  L  V  R  F  S  F  G  V  E  D  F  E  D  V  K  A  D  V  L  Q  A  L  D  S  I  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C02HBa0280E02.2" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="113583" stop="113521"/>
                    <exon start="113431" stop="113313"/>
                    <exon start="113154" stop="113034"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>303</number_coding_nucleotides>
                  <number_encoded_amino_acids>101</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>HPEYHLAKKQMTGFGGVVSFEVDGDLLTTAKFVDALRIPYIAPSFGGCESIVDQPAIMSYWDLSQSDRAKYGILDNLVRFSFGVEDFEDVKADVLQALDSI</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 3 chains have been computed
$ 
$ memory statistics:
$ 2280 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 2280 bytes was the average size of a spliced alignment
$ 5592 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5592 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 3 backtrace matrices have been allocated
$ 
$ date finished: 2009-12-01 10:23:12
-->
