<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-12-01 10:29:16"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C02HBa0303I24-4gKwB/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C02HBa0303I24-4gKwB/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C02HBa0303I24-4gKwB/gth_cdna_fileCXGN::TomatoGenome::BACSubmission::Analysis::GenomeThreader::SGN_markers" ref_id="T1238" ref_strand="+" ref_description="T1238">
      <seq>tgaattcttgcaagctacatgaggtcctgcccaatactgctgtgttatctcagttttataaggccagtatgcaggagaaatttcaaaagaggagcactctagtagttccacttgatgagctcgaggatgatgacatgttgcctcttgtcgatatattgcttaatgtccacctttacaatgttgatgcggtagacatactttccacgtcaaaatcggttgtgaatcaagaatctatcgtgtctttaatgcgtgcagtcaattcaatactccgaagggttgatcttcaggatacactattaagaaaggacatcttgtgggatctttttcaaggtggtttgaattgccaattgctaaagttgaggtccactgagattcaaaagttgaatatggttggaagcttcatgcagttacacacccttaatctggacttttgttcttctctcactagcttagagaaggattgctttacttgcatgccaaaattgatgtgcctctccatgtgtggaactagaatagctgatctgtggacaacccgtgaggctttgtctcggcttcattctttgacag</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C02HBa0303I24-4gKwB/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C02HBa0303I24.2" temp_strand="+" temp_description="C02HBa0303I24.2  AC215436.2 htgs_phase:3 submitted_to_sgn_as:C02HBa0303I24 sequenced_by:kribb upload_account_name:korea">
        <position start="52116" stop="53931"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="52416" g_stop="52477" g_length="62"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="62" r_length="62" r_score="1.000"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="52478" i_stop="52850" i_length="373">
            <donor d_prob="0.980" d_score="1.00"/>
            <acceptor a_prob="0.000" a_score="0.98"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="52851" g_stop="53104" g_length="254"/>
          <reference_exon_boundary r_type="cDNA" r_start="63" r_stop="316" r_length="254" r_score="0.980"/>
        </exon>
        <intron i_serial="2">
          <gDNA_intron_boundary i_start="53105" i_stop="53380" i_length="276">
            <donor d_prob="0.612" d_score="0.98"/>
            <acceptor a_prob="0.992" a_score="0.98"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="3">
          <gDNA_exon_boundary g_start="53381" g_stop="53631" g_length="251"/>
          <reference_exon_boundary r_type="cDNA" r_start="317" r_stop="567" r_length="251" r_score="0.988"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C02HBa0303I24.2" gen_strand="+" ref_id="T1238" ref_strand="+">
        <total_alignment_score>0.986</total_alignment_score>
        <cumulative_length_of_scored_exons>567</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C02HBa0303I24.2" gen_strand="+"/>
        <rDNA rDNA_id="T1238" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="52416" e_stop="52477"/>
          <exon e_start="52851" e_stop="53104"/>
          <exon e_start="53381" e_stop="53631"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>TGAATTCTTGCAAGCTACATGAGGTCCTGCCCAATACTGCTGTGTTATCTCAGTTTTATAAGGTGGACATCTTTTTAATTTTTAGTTACTCTCCTCTAATATATGAAAATAAACTATTGTATCTTAATTGAGCTATTTTCATTATTTTATCTCTTTCTCTCTGAATCTGTTGTTAAGTTTTTTTCTGGTTGATGTAAGATTTAGATAATTAGAGGGTTCAATATTTTGTTTATGACCAGGTGAAATATTAGTGAACTGATGGTTTGCAATAATAATGTTAGACTTACATCTAATCATAAATTTTACTGCAGTATTGCAATGTTCGATAATCTCTATTTCGTATTATTGTGAACTGATTATCTTGTTCTGTTAATAGTGTATCTTTGACGAATCAAATTTGATCACGATCATTAAGAGTTTAGTCGCCTTTTTCAGGCCAGTATGCAGGAGAAAGTTCAAAAGAGGAGCACTCTAGTAGTTCCACTTGATGAGCTTGAGGATGATGATATGTTGCCTCTTGTCGATATATTGCTTAATGTCCACCTTTACAATGTTGATGCGGTAGACATACTTTCCACGTCAAAATCGGTTGTGAATCAAGAATCTGTCGTGTCTTTAATGCGTGCAGTCAATTCAATACTCCGAAGTGTTGATCTTCAGGATACACTATTAAGAAAGGACATCTTGTGGTATGCCTGAATACTATTGTTTAATAGTGAAGTTTGGATATCATCTTGCCTTTCTCATTTGATCCTTCTCCAGCAACTAAAAGACTTAGAAAAAGAAACTATTTTTCTCTTAAATATATGACAATTAGAAAGAGGTGATATATAAGATGATGCGCATAAGATGATAGATTGTATCTGCGGTTTGACAATACTAAGAAATGACGAATTGTGAAAAAGAGATATCTGTAAGTTCACAATGCTATTGCTAACTTCTTTTTTGAATTCTGGCCTCTGCAGGGATCTTTTTCAAGGTGGTTTGAATTGCCAATTACTAAAGTTGAGGTCCACTGAGATTCAAAAGTTGAATATGGTTGGAAGCTTCATGCAGTTACACACCCTTACTCTGGACTTTTGTTCTTCTCTCACTAGCTTAGAGAAGGATTGCTTTACTTGCATGCCAAAATTGATGCGCCTCTCCATGTGTGGAACTAGAATAGCTGATCTGTGGACAACCCGTGAGGCTTTGTCTCGGCTTCATTCTTTGACAG</genome_strand>
        <mrna_strand>TGAATTCTTGCAAGCTACATGAGGTCCTGCCCAATACTGCTGTGTTATCTCAGTTTTATAAG.....................................................................................................................................................................................................................................................................................................................................................................................GCCAGTATGCAGGAGAAATTTCAAAAGAGGAGCACTCTAGTAGTTCCACTTGATGAGCTCGAGGATGATGACATGTTGCCTCTTGTCGATATATTGCTTAATGTCCACCTTTACAATGTTGATGCGGTAGACATACTTTCCACGTCAAAATCGGTTGTGAATCAAGAATCTATCGTGTCTTTAATGCGTGCAGTCAATTCAATACTCCGAAGGGTTGATCTTCAGGATACACTATTAAGAAAGGACATCTTGTG....................................................................................................................................................................................................................................................................................GGATCTTTTTCAAGGTGGTTTGAATTGCCAATTGCTAAAGTTGAGGTCCACTGAGATTCAAAAGTTGAATATGGTTGGAAGCTTCATGCAGTTACACACCCTTAATCTGGACTTTTGTTCTTCTCTCACTAGCTTAGAGAAGGATTGCTTTACTTGCATGCCAAAATTGATGTGCCTCTCCATGTGTGGAACTAGAATAGCTGATCTGTGGACAACCCGTGAGGCTTTGTCTCGGCTTCATTCTTTGACAG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="+" PGL_start="52416" PGL_stop="53631"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="52416" e_stop="52477"/>
            <exon e_start="52851" e_stop="53104"/>
            <exon e_start="53381" e_stop="53631"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.980" acc_prob="0.000" e_score="1.000"/>
          <exon-intron don_prob="0.612" acc_prob="0.992" e_score="0.980"/>
          <exon-only e_score="0.988"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="52416" e_stop="52477" e_length="62"/>
          </exon>
          <intron i_serial="1" don_prob="0.980" acc_prob="0.000">
            <gDNA_intron_boundary i_start="52478" i_stop="52850" i_length="373"/>
          </intron>
          <exon e_serial="2" e_score="0.980">
            <gDNA_exon_boundary e_start="52851" e_stop="53104" e_length="254"/>
          </exon>
          <intron i_serial="2" don_prob="0.612" acc_prob="0.992">
            <gDNA_intron_boundary i_start="53105" i_stop="53380" i_length="276"/>
          </intron>
          <exon e_serial="3" e_score="0.988">
            <gDNA_exon_boundary e_start="53381" e_stop="53631" e_length="251"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="52416" stop="52477"/>
              <exon start="52851" stop="53104"/>
              <exon start="53381" stop="53631"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="T1238" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>TGAATTCTTGCAAGCTACATGAGGTCCTGCCCAATACTGCTGTGTTATCTCAGTTTTATAAG : GCCAGTATGCAGGAGAAAGTTCAAAAGAGGAGCACTCTAGTAGTTCCACTTGATGAGCTTGAGGATGATGATATGTTGCCTCTTGTCGATATATTGCTTAATGTCCACCTTTACAATGTTGATGCGGTAGACATACTTTCCACGTCAAAATCGGTTGTGAATCAAGAATCTGTCGTGTCTTTAATGCGTGCAGTCAATTCAATACTCCGAAGTGTTGATCTTCAGGATACACTATTAAGAAAGGACATCTTGTG : GGATCTTTTTCAAGGTGGTTTGAATTGCCAATTACTAAAGTTGAGGTCCACTGAGATTCAAAAGTTGAATATGGTTGGAAGCTTCATGCAGTTACACACCCTTACTCTGGACTTTTGTTCTTCTCTCACTAGCTTAGAGAAGGATTGCTTTACTTGCATGCCAAAATTGATGCGCCTCTCCATGTGTGGAACTAGAATAGCTGATCTGTGGACAACCCGTGAGGCTTTGTCTCGGCTTCATTCTTTGACAG</gDNA_template>
            <first_frame> *  I  L  A  S  Y  M  R  S  C  P  I  L  L  C  Y  L  S  F  I  R :   P  V  C  R  R  K  F  K  R  G  A  L  *  *  F  H  L  M  S  L  R  M  M  I  C  C  L  L  S  I  Y  C  L  M  S  T  F  T  M  L  M  R  *  T  Y  F  P  R  Q  N  R  L  *  I  K  N  L  S  C  L  *  C  V  Q  S  I  Q  Y  S  E  V  L  I  F  R  I  H  Y  *  E  R  T  S  C   : G  I  F  F  K  V  V  *  I  A  N  Y  *  S  *  G  P  L  R  F  K  S  *  I  W  L  E  A  S  C  S  Y  T  P  L  L  W  T  F  V  L  L  S  L  A  *  R  R  I  A  L  L  A  C  Q  N  *  C  A  S  P  C  V  E  L  E  *  L  I  C  G  Q  P  V  R  L  C  L  G  F  I  L  *  Q </first_frame>
            <second_frame>  E  F  L  Q  A  T  *  G  P  A  Q  Y  C  C  V  I  S  V  L  *   : G  Q  Y  A  G  E  S  S  K  E  E  H  S  S  S  S  T  *  *  A  *  G  *  *  Y  V  A  S  C  R  Y  I  A  *  C  P  P  L  Q  C  *  C  G  R  H  T  F  H  V  K  I  G  C  E  S  R  I  C  R  V  F  N  A  C  S  Q  F  N  T  P  K  C  *  S  S  G  Y  T  I  K  K  G  H  L  V  :  G  S  F  S  R  W  F  E  L  P  I  T  K  V  E  V  H  *  D  S  K  V  E  Y  G  W  K  L  H  A  V  T  H  P  Y  S  G  L  L  F  F  S  H  *  L  R  E  G  L  L  Y  L  H  A  K  I  D  A  P  L  H  V  W  N  *  N  S  *  S  V  D  N  P  *  G  F  V  S  A  S  F  F  D   </second_frame>
            <third_frame>   N  S  C  K  L  H  E  V  L  P  N  T  A  V  L  S  Q  F  Y  K  :  A  S  M  Q  E  K  V  Q  K  R  S  T  L  V  V  P  L  D  E  L  E  D  D  D  M  L  P  L  V  D  I  L  L  N  V  H  L  Y  N  V  D  A  V  D  I  L  S  T  S  K  S  V  V  N  Q  E  S  V  V  S  L  M  R  A  V  N  S  I  L  R  S  V  D  L  Q  D  T  L  L  R  K  D  I  L  W :   D  L  F  Q  G  G  L  N  C  Q  L  L  K  L  R  S  T  E  I  Q  K  L  N  M  V  G  S  F  M  Q  L  H  T  L  T  L  D  F  C  S  S  L  T  S  L  E  K  D  C  F  T  C  M  P  K  L  M  R  L  S  M  C  G  T  R  I  A  D  L  W  T  T  R  E  A  L  S  R  L  H  S  L  T  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C02HBa0303I24.2" strand="+"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="52418" stop="52477"/>
                    <exon start="52851" stop="53104"/>
                    <exon start="53381" stop="53630"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>564</number_coding_nucleotides>
                  <number_encoded_amino_acids>188</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>NSCKLHEVLPNTAVLSQFYKASMQEKVQKRSTLVVPLDELEDDDMLPLVDILLNVHLYNVDAVDILSTSKSVVNQESVVSLMRAVNSILRSVDLQDTLLRKDILWDLFQGGLNCQLLKLRSTEIQKLNMVGSFMQLHTLTLDFCSSLTSLEKDCFTCMPKLMRLSMCGTRIADLWTTREALSRLHSLT</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 64 chains have been computed
$ 
$ memory statistics:
$ 2280 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 2280 bytes was the average size of a spliced alignment
$ 5592 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5592 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 64 backtrace matrices have been allocated
$ 
$ date finished: 2009-12-01 10:29:24
-->
