/data/tool/gcphrap aa.fasta.screen -ace -view -exp /data/ultra_disk/people/tomato/t1/C03HBa0141l10/workdir/all.assembly 
gcphrap version 0.990319

Run date:time  090107:092554
Query file(s):  aa.fasta.screen
Presumed sequence type: DNA

Pairwise comparison algorithm: banded Smith-Waterman

Score matrix (set by value of penalty: -2)
    A   C   G   T   N   X
A   1  -2  -2  -2   0  -3
C  -2   1  -2  -2   0  -3
G  -2  -2   1  -2   0  -3
T  -2  -2  -2   1   0  -3
N   0   0   0   0   0   0
X  -3  -3  -3  -3   0  -3

Gap penalties: gap_init: -4, gap_ext: -3, ins_gap_ext: -3, del_gap_ext: -3, 
Using complexity-adjusted scores. Assumed background frequencies:
 A: 0.250  C: 0.250  G: 0.250  T: 0.250  N: 0.000  X: 0.000  

minmatch: 14, maxmatch: 30, max_group_size: 20, minscore: 30, bandwidth: 14, indexwordsize: 10
vector_bound: 80
word_raw: 0
trim_penalty: -2, trim_score: 20, trim_qual: 13, maxgap: 30
repeat_stringency: 0.950000
qual_show: 20
confirm_length: 8, confirm_trim: 1, confirm_penalty: -5, confirm_score: 30
node_seg: 8, node_space: 4
forcelevel: 0
max_subclone_size: 5000

Sequence file: aa.fasta.screen    774 entries
Residue counts:
  A    200345
  C    119040
  G    114762
  N     3316
  T    228792
  X    212370
Total  878625

Read name analysis:
 # Reads      # templates
   1           774

 Suffix counts:
(no suffix) 774


Templates inferred from description field:     0
Templates inferred from name field:          774

Read-template multiplicity analysis:
 # Reads      # templates
   1           774

Chemistries inferred from description field:
    0  dye-primer
    0  old-dye-terminator
    0  big-dye-terminator
    0  other

Chemistries inferred from name:
  774  dye-primer
    0  old-dye-terminator
    0  big-dye-terminator
    0  other

Directions inferred from description field:
    0  fwd
    0  rev
    0  unknown (set to fwd)

Directions inferred from name:
    0  fwd
    0  rev
  774  unknown (set to fwd)

Quality file: aa.fasta.screen.qual

Input quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 56  175477  20.0  175477  20.0    0.44
 51   39171   4.5  214648  24.4    0.75
 50   21482   2.4  236130  26.9    0.97
 48    3748   0.4  239878  27.3    1.03
 47    3640   0.4  243518  27.7    1.10
 46    8642   1.0  252160  28.7    1.32
 45    7731   0.9  259891  29.6    1.56
 44   15077   1.7  274968  31.3    2.16
 43   12442   1.4  287410  32.7    2.78
 42   30186   3.4  317596  36.1    4.69
 41    2947   0.3  320543  36.5    4.92
 40   30660   3.5  351203  40.0    7.99
 39    1279   0.1  352482  40.1    8.15
 38    1568   0.2  354050  40.3    8.40
 37   10571   1.2  364621  41.5   10.51
 36    1038   0.1  365659  41.6   10.77
 35    7470   0.9  373129  42.5   13.13
 34    5043   0.6  378172  43.0   15.14
 33    5205   0.6  383377  43.6   17.75
 32    5736   0.7  389113  44.3   21.37
 31    3284   0.4  392397  44.7   23.97
 30    2425   0.3  394822  44.9   26.40
 29   12037   1.4  406859  46.3   41.55
 28    3523   0.4  410382  46.7   47.14
 27    5537   0.6  415919  47.3   58.18
 26    1943   0.2  417862  47.6   63.07
 25   10189   1.2  428051  48.7   95.29
 24    5835   0.7  433886  49.4  118.52
 23    4216   0.5  438102  49.9  139.65
 22    4891   0.6  442993  50.4  170.51
 21    6071   0.7  449064  51.1  218.73
 20    5562   0.6  454626  51.7  274.35
 19    9437   1.1  464063  52.8  393.15
 18    6734   0.8  470797  53.6  499.88
 17    6822   0.8  477619  54.4  636.00
 16    8275   0.9  485894  55.3  843.86
 15   11265   1.3  497159  56.6  1200.09
 14   10585   1.2  507744  57.8  1621.48
 13   17528   2.0  525272  59.8  2499.96
 12   17434   2.0  542706  61.8  3599.97
 11   28727   3.3  571433  65.0  5881.84
 10   39812   4.5  611245  69.6  9863.04
  9   69536   7.9  680781  77.5  18617.11
  8   68841   7.8  749622  85.3  29527.67
  7   45961   5.2  795583  90.5  38698.09
  6   64752   7.4  860335  97.9  54963.06
  4   14932   1.7  875267  99.6  60907.60
  0    3345   0.4  878612 100.0  64252.60
 -1      13   0.0  878625 100.0  64265.60   (quality -1 = terminal quality 0)

Avg. full length: 1135.2, trimmed (qual > -1): 1135.2
Avg. quality: 28.2 per base

Exact duplicate reads:  None.

Probable unremoved sequencing vector (matches excluded from assembly, quality reduced to 0): 
aa120109r1   34-65   CGGTGGCGGCGCTCTAGACTAGTGGATCCCCC
ac030109f1   23-26   CCCC
ac060109r1   14-46   CGGTGGCGGGCGCTCTAGACTAGTGGATCCCCC
ae070109f1   14-27   AATCCCTGCAGCCC
af060109f1   10-28   ACGAAATTCCTTGCAGCCC
ag010109r1    9-50   CCCCGCCGGGTGGCGGCCGCTCTAGAACTAGTAGGATCCCCC
bc010109r1   47-51   CCCCA
bc060109r1   10-47   CCCGCGGGGCGGCCGCTCTAGAACTAGTTGGATCCCCC
bd050109r1   47-48   CC
bd080109f1    7-16   ATGTATACGA
be090109f1   26-32   CCTCCTA
bf050109f1    3-28   AAAATGATACGAATCCTGCAGCCTTG
bf110109f1   26-27   CC
bh060109f1   19-26   TGCAGCCC
c03hba0141l10_sp601  1- 9   AAAAAATAG
c03hba0141l10_sp602  1- 8   AAAAACTG
c03hba0141l10_sp603  2-10   AAAAAATGC
cc020109f1   58-74   TAAATTGTAGGGCTACA
cc100109f1    6-78   TGTAGCTTGTATATAGTTATACGATACCTAGTCGTGAATACATTCTCTCTTACAAATTTATGGGCCACAGGAG
cc110109f1   17-77   TATATAGATATACGATACCTAGTCTTAAATAGATTACTTCTTACAAATTTCAGGGCCACAG
cd040109f1   21-22   CC
cd060109r1    8-47   CCCGCGGGTGGCGGCCGCTCTAGAACTAGTAGGATCCCCC
ce070109r1   49-49   C
ce090109r1   47-49   CCC
ce110109f1   25-78   TATACGATACCTAGTCTTAAATACATTACTTCTTACAAATTTCAGGGCCACAGG
cf060109f1    1-29   AAAATGGTACGTAATTCCTGCAGCCCTGC
da020109r1    7-45   ACTCACCGCCGTGGCGGCCGCTCTAGACTAGTGGATCCC
da060109r1    8-47   TCCCGNNCGGTGGCGGCCGCTCTAGAATAGTGGATCCCCC
db110109f1    5-11   ATGAATA
dc010109f1    1-78   CCAAATTTACGCTTGTCTATAGTTATACGATTCCTGACTCGTAAATGCTTCTTCTTACAAATTGTAGGGCCACAGGAG
dc040109r1   15-41   CGCGTGGCGGCCGCTCTAGAACTAGTA
dc090109r1    9-49   CCCCGTCGGTGGCGGCCGCTCTAGAACTAGTAGGATCCCCC
dc120109f1   19-26   TGCAGCCC
dd110109f1   23-25   CCC
de050109f1   11-24   AATTNCTGCAGCCC
de050109r1   13-47   CGCGTGGCGGCCGCTCTAGAACTAGTAGGATCCCC
df050109f1   12-27   AATTCTGCAGCCCTGT
dg030109r1    8-47   ACTCCCCGCCGGTGGCGGCCGCTCTAGACTAGTGGATCCC
dg090109r1   11-50   TCCCGACGGCTGGCGGCCGCTCTAGAATAGTGGATCCCCC
dh060109f1    1-76   CCAATTGTAGCTTGTATATAGATATACGATACCTGAGTCGTAAATCGATTCTTCTTACAATTTAGGGCCACAGGAG

Near duplicate reads: 
aa100109f1            ac010109r1      (imperfect: 47-1012 (0)   48-1019 (14) )
ae010109f1            bf010109f1      (imperfect: 23-1006 (14)   29-1022 (0) )
ae070109f1            de050109f1      (imperfect: 13-1032 (15)   10-1033 (46) )
af060109f1            bf050109f1      (imperfect: 20-1035 (46)   18-1023 (28) )
af060109r1            df050109r1      (imperfect: 47-1034 (30)   44-1024 (47) )
af060109r1            bf050109r1      (imperfect: 47-1032 (32)   48-1034 (13) )
bf050109r1            df050109r1      (imperfect: 48-1043 (4)   44-1031 (40) )
bh060109f1            dc120109f1      (imperfect: 18-1010 (34)   18-1007 (28) )
c03hba0141l10_sp601       c03hba0141l10_sp603 (imperfect: 0-837 (1)   1-827 (22) )
c03hba0141l10_sp601       c03hba0141l10_sp602 (imperfect: 1-837 (1)   0-832 (13) )
c03hba0141l10_sp602       c03hba0141l10_sp603 (imperfect: 0-845 (0)   1-840 (9) )
ca090109f1            ch080109r1      (imperfect: 42-1050 (0)   47-1053 (1) )
cc090109f1            cf040109f1      (imperfect: 24-1062 (4)   31-1071 (0) )
ce060109r1            df030109r1      (imperfect: 45-1032 (34)   47-1047 (21) )
ce090109r1            cg120109f1      (imperfect: 49-1021 (40)   47-1024 (0) )
cf060109r1            df050109r1      (imperfect: 48-1066 (46)   44-1065 (6) )
cf100109f1            de010109f1      (imperfect: 34-1036 (27)   25-1034 (12) )
da010109f1            dg010109f1      (imperfect: 27-1007 (6)   25-1004 (4) )
db070109f1            dd060109f1      (imperfect: 30-1056 (5)   22-1051 (34) )
de060109f1            df080109f1      (imperfect: 31-1060 (3)   24-1051 (7) )

Internal read matches (same orientation) : 
189   ag020109f1    tandem (72-mer)_4    604-959 
124   ag020109f1    tandem (143-mer)_2    604-958 
208   ba060109f1    tandem (72-mer)_4    155-513 
143   ba060109f1    tandem (143-mer)_2    155-513 
205   ba060109r1    tandem (72-mer)_4    433-791 
140   ba060109r1    tandem (144-mer)_2    433-791 
 88   ba060109r1    disjoint 145-mers  433-577 / 648-791 
 32   ba060109r1    disjoint 74-mers  432-505 / 717-791 
138   bd090109f1    tandem (72-mer)_3     25-286 
 78   bd090109f1    disjoint 118-mers  25-142 / 169-286 
208   cb100109f1    tandem (72-mer)_4    196-554 
143   cb100109f1    tandem (143-mer)_2    196-554 
208   cb120109r1    tandem (72-mer)_4    241-599 
143   cb120109r1    tandem (143-mer)_2    241-599 
 52   cd110109f1    tandem (51-mer)_3    821-1007 
178   ce090109f1    tandem (71-mer)_4     26-342 
113   ce090109f1    tandem (142-mer)_2     26-342 
166   cf120109r1    tandem (72-mer)_4    497-855 
105   cf120109r1    tandem (143-mer)_2    497-855 
 47   cg080109f1    disjoint 67-mers  26-92 / 98-164 
208   da080109f1    tandem (72-mer)_4    131-489 
143   da080109f1    tandem (143-mer)_2    131-489 
208   db050109r1    tandem (72-mer)_4    456-814 
143   db050109r1    tandem (143-mer)_2    456-814 
202   db120109f1    tandem (72-mer)_4     43-401 
137   db120109f1    tandem (143-mer)_2     43-401 
208   dh090109r1    tandem (72-mer)_4    181-539 
143   dh090109r1    tandem (143-mer)_2    181-539 

No. of node-rejected pairs: None.

Multi-segment reads (initially rejected segments in parentheses) -- XXX means segments flank X'd region: 
ab090109f1          30 200  (260 734) 
ba050109f1          (16 107)  109 233 
ba100109r1          (71 108)  113 1084 
bc050109f1          26 564  (597 964) 
bc060109r1          (10 47)  48 1057 
cb080109r1          (303 411)  602 868 
cd010109f1          (27 87)  112 1006 
ce110109f1          (25 78)  108 1036 
cg060109f1          (17 89)  (96 503)  513 1016 
ch120109f1          (20 114)  115 1020 
da100109f1          (36 113)  113 1041 
dc010109f1          (1 81)  79 1034 
dc040109r1          (15 49)  42 1117 
dd010109f1          (10 83)  82 1049 
de050109r1          (13 47)  49 1091 
df090109f1          (2 84)  82 1036 
dh010109f1          (23 96)  107 1011 
dh060109f1          (1 80)  77 1044 
dh090109f1          (1 101)  101 1061 
dh120109f1          (1 97)  103 1027 

20 reads with multiple segments.

Probable deletion reads (excluded from assembly):

de050109r1    15    47- 49  (  dc040109r1     49- 66)

1 probable deletion reads.


Revised quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90  293026  33.4  293026  33.4    0.00
 89     277   0.0  293303  33.4    0.00
 88     400   0.0  293703  33.4    0.00
 87     347   0.0  294050  33.5    0.00
 86     502   0.1  294552  33.5    0.00
 85     529   0.1  295081  33.6    0.00
 84     343   0.0  295424  33.6    0.00
 83     216   0.0  295640  33.6    0.00
 82     189   0.0  295829  33.7    0.00
 81    2398   0.3  298227  33.9    0.00
 80     134   0.0  298361  34.0    0.00
 79     147   0.0  298508  34.0    0.00
 78     118   0.0  298626  34.0    0.00
 77     131   0.0  298757  34.0    0.00
 76     439   0.0  299196  34.1    0.00
 75     269   0.0  299465  34.1    0.00
 74      93   0.0  299558  34.1    0.00
 73     204   0.0  299762  34.1    0.00
 72      79   0.0  299841  34.1    0.00
 71     198   0.0  300039  34.1    0.00
 70     119   0.0  300158  34.2    0.00
 69     160   0.0  300318  34.2    0.00
 68      81   0.0  300399  34.2    0.00
 67     245   0.0  300644  34.2    0.00
 66   19890   2.3  320534  36.5    0.01
 65     666   0.1  321200  36.6    0.01
 64      55   0.0  321255  36.6    0.01
 63      34   0.0  321289  36.6    0.01
 62     163   0.0  321452  36.6    0.01
 61    2186   0.2  323638  36.8    0.01
 60     832   0.1  324470  36.9    0.01
 59     142   0.0  324612  36.9    0.01
 58     260   0.0  324872  37.0    0.01
 57     332   0.0  325204  37.0    0.01
 56    4724   0.5  329928  37.6    0.02
 55     245   0.0  330173  37.6    0.02
 54     589   0.1  330762  37.6    0.02
 53     386   0.0  331148  37.7    0.03
 52     636   0.1  331784  37.8    0.03
 51     947   0.1  332731  37.9    0.04
 50    1261   0.1  333992  38.0    0.05
 49     326   0.0  334318  38.1    0.05
 48     434   0.0  334752  38.1    0.06
 47     390   0.0  335142  38.1    0.07
 46     543   0.1  335685  38.2    0.08
 45     441   0.1  336126  38.3    0.10
 44     831   0.1  336957  38.4    0.13
 43     668   0.1  337625  38.4    0.16
 42    1243   0.1  338868  38.6    0.24
 41     512   0.1  339380  38.6    0.28
 40   13423   1.5  352803  40.2    1.63
 39     174   0.0  352977  40.2    1.65
 38     200   0.0  353177  40.2    1.68
 37     390   0.0  353567  40.2    1.76
 36     195   0.0  353762  40.3    1.81
 35     310   0.0  354072  40.3    1.90
 34     415   0.0  354487  40.3    2.07
 33     391   0.0  354878  40.4    2.26
 32     470   0.1  355348  40.4    2.56
 31     231   0.0  355579  40.5    2.74
 30     105   0.0  355684  40.5    2.85
 29     462   0.1  356146  40.5    3.43
 28     141   0.0  356287  40.6    3.65
 27     318   0.0  356605  40.6    4.29
 26     142   0.0  356747  40.6    4.65
 25    1261   0.1  358008  40.7    8.63
 24     395   0.0  358403  40.8   10.21
 23     397   0.0  358800  40.8   12.20
 22     402   0.0  359202  40.9   14.73
 21     293   0.0  359495  40.9   17.06
 20     225   0.0  359720  40.9   19.31
 19     408   0.0  360128  41.0   24.45
 18     230   0.0  360358  41.0   28.09
 17     262   0.0  360620  41.0   33.32
 16     315   0.0  360935  41.1   41.23
 15     480   0.1  361415  41.1   56.41
 14     342   0.0  361757  41.2   70.03
 13     546   0.1  362303  41.2   97.39
 12     474   0.1  362777  41.3  127.30
 11     699   0.1  363476  41.4  182.82
 10    1078   0.1  364554  41.5  290.62
  9    1456   0.2  366010  41.7  473.92
  8    1606   0.2  367616  41.8  728.45
  7    1533   0.2  369149  42.0  1034.33
  6     678   0.1  369827  42.1  1204.63
  5      20   0.0  369847  42.1  1210.96
  4     104   0.0  369951  42.1  1252.36
  3      16   0.0  369967  42.1  1260.38
  2  209259  23.8  579226  65.9  133293.88
  0    6300   0.7  585526  66.6  139593.88
 -1  293099  33.4  878625 100.0  432692.88   (quality -1 = terminal quality 0)

Avg. full length: 1135.2, trimmed (qual > -1): 756.5
Avg. quality: 34.8 per base

LLR score histogram:
Score    #   cum # 
-95.0  2952  2952
-90.0    86  3038
-85.0    78  3116
-80.0    71  3187
-75.0    78  3265
-70.0    91  3356
-65.0    74  3430
-60.0    62  3492
-55.0    83  3575
-50.0    99  3674
-45.0    84  3758
-40.0    95  3853
-35.0   107  3960
-30.0    94  4054
-25.0   101  4155
-20.0   145  4300
-15.0   102  4402
-10.0   182  4584
 -5.0   277  4861
  0.0  2500  7361
  5.0  1775  9136
 10.0  1495  10631
 15.0  1269  11900
 20.0   227  12127

LLR score histogram:
Score    #   cum # 
-95.0  2952  2952
-90.0    85  3037
-85.0    74  3111
-80.0    74  3185
-75.0    80  3265
-70.0    88  3353
-65.0    79  3432
-60.0    61  3493
-55.0    56  3549
-50.0    98  3647
-45.0    84  3731
-40.0    94  3825
-35.0   122  3947
-30.0   101  4048
-25.0   104  4152
-20.0   148  4300
-15.0    97  4397
-10.0   180  4577
 -5.0   330  4907
  0.0  2375  7282
  5.0  1798  9080
 10.0  1507  10587
 15.0  1295  11882
 20.0   245  12127

2d revised quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90  288734  32.9  288734  32.9    0.00
 89     314   0.0  289048  32.9    0.00
 88     427   0.0  289475  32.9    0.00
 87     398   0.0  289873  33.0    0.00
 86     550   0.1  290423  33.1    0.00
 85     582   0.1  291005  33.1    0.00
 84     359   0.0  291364  33.2    0.00
 83     239   0.0  291603  33.2    0.00
 82     233   0.0  291836  33.2    0.00
 81    2008   0.2  293844  33.4    0.00
 80     151   0.0  293995  33.5    0.00
 79     167   0.0  294162  33.5    0.00
 78     126   0.0  294288  33.5    0.00
 77     135   0.0  294423  33.5    0.00
 76     384   0.0  294807  33.6    0.00
 75     243   0.0  295050  33.6    0.00
 74     101   0.0  295151  33.6    0.00
 73     211   0.0  295362  33.6    0.00
 72      88   0.0  295450  33.6    0.00
 71     262   0.0  295712  33.7    0.00
 70     108   0.0  295820  33.7    0.00
 69     148   0.0  295968  33.7    0.00
 68      63   0.0  296031  33.7    0.00
 67     219   0.0  296250  33.7    0.00
 66   22477   2.6  318727  36.3    0.01
 65     640   0.1  319367  36.3    0.01
 64      58   0.0  319425  36.4    0.01
 63      34   0.0  319459  36.4    0.01
 62     156   0.0  319615  36.4    0.01
 61    2507   0.3  322122  36.7    0.01
 60     920   0.1  323042  36.8    0.01
 59     136   0.0  323178  36.8    0.01
 58     272   0.0  323450  36.8    0.01
 57     340   0.0  323790  36.9    0.01
 56    5056   0.6  328846  37.4    0.02
 55     320   0.0  329166  37.5    0.02
 54     639   0.1  329805  37.5    0.03
 53     441   0.1  330246  37.6    0.03
 52     725   0.1  330971  37.7    0.03
 51     996   0.1  331967  37.8    0.04
 50    1393   0.2  333360  37.9    0.06
 49     321   0.0  333681  38.0    0.06
 48     427   0.0  334108  38.0    0.07
 47     407   0.0  334515  38.1    0.07
 46     551   0.1  335066  38.1    0.09
 45     445   0.1  335511  38.2    0.10
 44     894   0.1  336405  38.3    0.14
 43     714   0.1  337119  38.4    0.17
 42    1420   0.2  338539  38.5    0.26
 41     504   0.1  339043  38.6    0.30
 40   13322   1.5  352365  40.1    1.64
 39     177   0.0  352542  40.1    1.66
 38     198   0.0  352740  40.1    1.69
 37     419   0.0  353159  40.2    1.77
 36     190   0.0  353349  40.2    1.82
 35     330   0.0  353679  40.3    1.92
 34     419   0.0  354098  40.3    2.09
 33     398   0.0  354496  40.3    2.29
 32     450   0.1  354946  40.4    2.58
 31     238   0.0  355184  40.4    2.76
 30     105   0.0  355289  40.4    2.87
 29     454   0.1  355743  40.5    3.44
 28     146   0.0  355889  40.5    3.67
 27     320   0.0  356209  40.5    4.31
 26     143   0.0  356352  40.6    4.67
 25    1406   0.2  357758  40.7    9.12
 24     395   0.0  358153  40.8   10.69
 23     408   0.0  358561  40.8   12.73
 22     388   0.0  358949  40.9   15.18
 21     308   0.0  359257  40.9   17.63
 20     230   0.0  359487  40.9   19.93
 19     412   0.0  359899  41.0   25.11
 18     227   0.0  360126  41.0   28.71
 17     260   0.0  360386  41.0   33.90
 16     310   0.0  360696  41.1   41.69
 15     441   0.1  361137  41.1   55.63
 14     345   0.0  361482  41.1   69.37
 13     521   0.1  362003  41.2   95.48
 12     442   0.1  362445  41.3  123.37
 11     663   0.1  363108  41.3  176.03
 10     992   0.1  364100  41.4  275.23
  9    1321   0.2  365421  41.6  441.54
  8    1308   0.1  366729  41.7  648.84
  7    1290   0.1  368019  41.9  906.23
  6     550   0.1  368569  41.9  1044.38
  5      69   0.0  368638  42.0  1066.20
  4     179   0.0  368817  42.0  1137.46
  3      48   0.0  368865  42.0  1161.52
  2  210361  23.9  579226  65.9  133890.34
  0    6300   0.7  585526  66.6  140190.34
 -1  293099  33.4  878625 100.0  433289.34   (quality -1 = terminal quality 0)

Avg. full length: 1135.2, trimmed (qual > -1): 756.5
Avg. quality: 34.6 per base

No. confirmed reads: 478
Avg. length: 1057.2, confirmed: 795.4, str. confirmed: 743.0, trimmed: 835.1
Preliminary clone size estimate: 30639 bp, depth of coverage: 12.4

Depth histogram (max_depth, #reads, cum #reads):

25   171     171
24    28     199
23    29     228
22    12     240
21    12     252
20     8     260
19     7     267
18    25     292
17    19     311
16    18     329
15    25     354
14    11     365
13    13     378
12     3     381
11     5     386
10    10     396
 9     8     404
 8     4     408
 7    10     418
 6    11     429
 5    12     441
 4     6     447
 3    14     461
 2     6     467
 1    11     478
 0   295     773

Forward confirmed bases: 0

Substitutions by nucleotide:
       A      C      G      T      N      X      Z    Total
A      0      0      0      0      0      0      0        0
C      0      0      0      0      0      0      0        0
G      0      0      0      0      0      0      0        0
T      0      0      0      0      0      0      0        0
N      0      0      0      0      0      0      0        0
X      0      0      0      0      0      0      0        0
Z      0      0      0      0      0      0      0        0

Substitutions by quality: 
       Total

Histogram of spacings between adjacent indel pairs:


Reverse confirmed bases: 0

Substitutions by nucleotide:
       A      C      G      T      N      X      Z    Total
A      0      0      0      0      0      0      0        0
C      0      0      0      0      0      0      0        0
G      0      0      0      0      0      0      0        0
T      0      0      0      0      0      0      0        0
N      0      0      0      0      0      0      0        0
X      0      0      0      0      0      0      0        0
Z      0      0      0      0      0      0      0        0

Substitutions by quality: 
       Total

Histogram of spacings between adjacent indel pairs:


Blocked reads: 
ad030109f1 80 809  left 
ad100109f1 80 833  left 
ah020109r1 51 121   right
ba110109r1 52 108   right
bb120109r1 48 366   right
bd100109r1 86 800  left 
bd120109r1 48 306   right
be120109r1 48 485   right
bg090109r1 325 432   right
bh080109r1 60 203   right
c03hba0141l10_t702 48 351  left 
cb040109r1 47 135   right
cc110109f1 98 102  left right
cd040109r1 50 930  left 
cd110109r1 308 359  left 
ce010109r1 46 802  left 
cf050109r1 49 313   right
dc020109r1 49 349   right
dh070109r1 50 175   right
dh120109f1 58 852  left 

20 blocked reads: 8 left only, 11 right only, 1 both.
39 reads (not shown) lack a high-quality segment.
Bypassed reads:  cg110109r1
Bypassed reads:  cb040109r1
Bypassed reads:  ab090109f1
Bypassed reads:  cf050109r1
Bypassed reads:  be120109r1
Bypassed reads:  ac110109r1
UNPOSITIONED READ: cg050109f1
UNPOSITIONED READ: cg100109f1
UNPOSITIONED READ: cc110109f1

0 perfect duplicates

275 isolated singletons (having no non-vector match to any other read): 
  Read         Length      (# trimmed non-X bases)
 cb050109r1    1073   (0)
 cb080109f1    1077   (0)
 cb110109f1    1063   (0)
 cb110109r1    1036   (0)
 cc010109f1    1046   (0)
 cc040109f1    1158   (0)
 cc040109r1    1151   (0)
 cb050109f1    1059   (0)
 ca040109f1    1411   (0)
 ca040109r1    1160   (0)
 ca060109r1     894   (0)
 ca070109r1    1064   (0)
 cb010109r1    1034   (0)
 cb010109f1    1054   (0)
 ca100109r1    1039   (0)
 ca100109f1    1046   (0)
 cc050109r1    1097   (0)
 cd120109f1    1037   (0)
 cd120109r1    1503   (0)
 ce020109f1    1184   (0)
 ce020109r1    1068   (0)
 ce120109r1    1089   (0)
 ce120109f1     979   (0)
 ce050109r1    1098   (0)
 ce050109f1    1084   (0)
 cd100109r1    1057   (0)
 cc090109r1    1423   (0)
 cc110109r1    1045   (0)
 cd010109r1    1037   (0)
 cd060109f1    1131   (0)
 cd100109f1    1055   (0)
 cd090109f1    1607   (0)
 cd070109r1    1077   (0)
 cd070109f1    1069   (0)
 ca030109r1    1028   (0)
 bg060109r1    1036   (0)
 bg080109f1    1132   (0)
 bg080109r1    1874   (0)
 bg090109f1    1032   (0)
 bh010109r1    1590   (0)
 bh010109f1    1493   (0)
 bg110109r1    1016   (0)
 bg110109f1    1030   (0)
 bg060109f1    1037   (0)
 bf080109f1    1180   (0)
 bf100109f1    1034   (0)
 bf100109r1    1063   (0)
 bf120109f1    1011   (0)
 bg030109f1    3060   (0)
 bg020109r1    1099   (0)
 bg010109r1    1476   (0)
 bg010109f1    2244   (0)
 bh020109f1    1077   (0)
 bh100109f1    2118   (0)
 bh100109r1    1518   (0)
 bh110109f1    1523   (0)
 bh110109r1    1665   (0)
 ca020109r1    1092   (0)
 ca020109f1    1052   (0)
 bh120109r1    2165   (0)
 bh120109f1    1407   (0)
 bh090109r1    2920   (0)
 bh020109r1    2650   (0)
 bh040109f1    1025   (0)
 bh040109r1    1065   (0)
 bh050109f1    1108   (0)
 bh090109f1    1774   (0)
 bh070109r1    1108   (0)
 bh070109f1    1069   (0)
 bh050109r1    1118   (0)
 cf030109f1    1071   (0)
 dd120109r1    1573   (0)
 de020109r1    1907   (0)
 de090109f1    1128   (0)
 de090109r1    1962   (0)
 de100109f1    1479   (0)
 de100109r1    1515   (0)
 df020109f1    1948   (0)
 dd100109r1    1500   (0)
 dc070109r1    1065   (0)
 dc090109f1    1066   (0)
 dd040109f1    1076   (0)
 dd040109r1    1097   (0)
 dd100109f1    1317   (0)
 dd090109r1    1050   (770)
 dd090109f1    1055   (756)
 dd050109r1    1182   (0)
 df020109r1    1061   (0)
 dg090109f1    1057   (0)
 dg100109f1    1046   (0)
 dg100109r1    1043   (0)
 dg110109f1    1055   (0)
 dh110109r1    1053   (0)
 dh100109f1    1036   (0)
 dg120109r1    1000   (0)
 dg110109r1    1032   (0)
 dg080109r1    1107   (0)
 df100109f1    1054   (0)
 df100109r1    1045   (0)
 df120109f1    1034   (0)
 df120109r1    1032   (0)
 dg060109r1    1090   (0)
 dg060109f1    1196   (0)
 dg050109r1    1083   (0)
 dg050109f1    1087   (0)
 dc060109r1    1070   (0)
 cg100109r1    1371   (0)
 ch010109f1    1047   (0)
 ch010109r1    1002   (0)
 ch030109f1    1050   (772)
 ch050109r1    1058   (683)
 ch050109f1    1061   (711)
 ch040109f1    1415   (0)
 ch030109r1    1048   (773)
 cg050109r1    1089   (0)
 cf030109r1    1064   (0)
 cf080109r1    1059   (0)
 cf090109f1    1067   (0)
 cf090109r1    1051   (0)
 cg040109r1    1081   (51)
 cg010109r1    1022   (0)
 cg010109f1    1016   (0)
 cf110109r1    1048   (0)
 ch060109f1    2429   (0)
 db040109r1    1447   (0)
 db060109f1    1089   (0)
 db060109r1    1068   (0)
 db080109f1    1080   (0)
 dc060109f1    1085   (0)
 dc050109r1    1182   (0)
 dc030109r1    1089   (0)
 db080109r1    1074   (0)
 db030109r1    1082   (0)
 ch060109r1    1870   (0)
 da020109f1    1032   (0)
 da050109f1    1060   (0)
 da050109r1    1038   (0)
 db010109r1    1030   (0)
 da120109r1    1011   (0)
 da090109r1    1067   (0)
 da060109f1    1081   (0)
 bf120109r1    1008   (0)
 ad110109r1    1028   (0)
 ad120109r1    1120   (0)
 ae030109f1    1519   (0)
 ae030109r1    2554   (0)
 ae040109f1    1040   (0)
 ae040109r1    1037   (0)
 ae050109f1    1060   (728)
 ad110109f1    1385   (0)
 ad010109f1    1036   (0)
 ad010109r1    1092   (0)
 ad040109r1    1092   (0)
 ad050109f1    1066   (681)
 ad090109r1    1060   (0)
 ad070109r1    1088   (0)
 ad070109f1    1065   (0)
 ad050109r1    1074   (699)
 ae050109r1    1050   (690)
 af050109r1    1081   (0)
 af080109f1    1076   (0)
 af080109r1    1066   (0)
 af120109f1    1901   (0)
 ag050109f1    1049   (0)
 ag030109r1    1039   (0)
 ag030109f1    1053   (0)
 af120109r1    1633   (0)
 af050109f1    1066   (0)
 ae080109f1    1055   (0)
 ae080109r1    1069   (0)
 af020109f1    1029   (0)
 af020109r1    1026   (0)
 af040109r1    1059   (0)
 af040109f1    1073   (0)
 af030109r1    1281   (0)
 af030109f1    1576   (0)
 ac120109r1    1291   (49)
 aa080109f1    1052   (0)
 aa080109r1    1046   (0)
 ab020109f1    1043   (0)
 ab020109r1    1182   (0)
 ab030109f1    1059   (0)
 ab030109r1    1068   (0)
 ab040109f1    1054   (0)
 aa070109r1    1041   (0)
 aa020109f1    1085   (0)
 aa020109r1    1857   (0)
 aa030109f1    1277   (41)
 aa030109r1    1131   (0)
 aa070109f1    1040   (0)
 aa050109f1    1458   (0)
 aa040109r1    2224   (0)
 aa040109f1    1828   (0)
 ab040109r1    1061   (0)
 ac040109r1    1422   (43)
 ac050109f1    1090   (0)
 ac050109r1    1095   (0)
 ac070109f1    1046   (0)
 ac120109f1    1015   (0)
 ac090109r1    1041   (0)
 ac090109f1    1051   (0)
 ac070109r1    1077   (0)
 ac020109r1    2800   (0)
 ab060109f1    1396   (0)
 ab060109r1    1098   (0)
 ab070109r1    1118   (0)
 ab100109f1    1578   (0)
 ac020109f1    2207   (0)
 ab120109r1    1002   (0)
 ab120109f1     993   (0)
 ab100109r1    2065   (0)
 ag010109f1    1010   (0)
 bb080109f1    1060   (0)
 bb080109r1    1060   (0)
 bb090109f1    1575   (0)
 bb090109r1    2685   (0)
 bc110109r1    1016   (742)
 bc110109f1    1017   (764)
 bb100109r1    1085   (0)
 bb100109f1    1120   (0)
 bb070109r1    1042   (0)
 ba090109r1    1044   (0)
 bb010109f1    1032   (0)
 bb010109r1    1016   (0)
 bb050109f1    1065   (0)
 bb070109f1    1068   (0)
 bb060109r1    1680   (0)
 bb060109f1    2085   (0)
 bb050109r1    1073   (0)
 bd010109f1    2267   (0)
 be080109r1    1080   (0)
 bf030109f1    1642   (0)
 bf030109r1    2103   (0)
 bf040109r1    1070   (0)
 bf070109r1    1067   (0)
 bf070109f1    1057   (0)
 bf060109r1    1071   (0)
 bf060109f1    1156   (0)
 be070109r1    1103   (0)
 bd010109r1    1547   (0)
 bd020109f1    2596   (0)
 bd020109r1    1070   (0)
 bd040109f1    1075   (715)
 be070109f1    1074   (0)
 be020109r1    1063   (0)
 be020109f1    1038   (0)
 bd040109r1    1194   (0)
 ag050109r1    1023   (0)
 ah050109f1    1090   (0)
 ah050109r1    1988   (0)
 ah060109f1    2599   (0)
 ah060109r1    1642   (0)
 ah080109f1    1795   (0)
 ah100109f1    1271   (0)
 ah110109f1    2321   (0)
 ah040109r1    2650   (0)
 ag080109f1    1058   (0)
 ag080109r1    1058   (0)
 ah010109f1    1126   (0)
 ah010109r1    1512   (0)
 ah040109f1    2494   (0)
 ah030109r1    1026   (0)
 ah030109f1    1442   (0)
 ah020109f1    1024   (0)
 ah080109r1    1565   (0)
 ba080109f1    1380   (42)
 ah120109r1    1188   (0)
 ba070109r1    1382   (0)
 ba020109f1    1092   (0)
 ba020109r1    2468   (0)
 ba080109r1    1646   (0)
 ba090109f1    1066   (0)
 ba070109f1    1795   (0)
 ah110109r1    1339   (169)
 ah120109f1    1197   (0)

Contig 1.  1 read; 1102 bp (untrimmed), 814 (trimmed).
 ****  PROBABLE DELETION READ
      1  1102 de050109r1   1039 (904)  0.27 0.00 0.00    0 (1102)    0 (1101) 

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 56     416  37.7     416  37.7    0.00
 51      91   8.3     507  46.0    0.00
 50       3   0.3     510  46.3    0.00
 48       3   0.3     513  46.6    0.00
 47       1   0.1     514  46.6    0.00
 46       7   0.6     521  47.3    0.00
 45      26   2.4     547  49.6    0.00
 44       3   0.3     550  49.9    0.00
 43      11   1.0     561  50.9    0.00
 42      11   1.0     572  51.9    0.00
 40      56   5.1     628  57.0    0.01
 39       6   0.5     634  57.5    0.01
 37      10   0.9     644  58.4    0.01
 35       3   0.3     647  58.7    0.01
 34      11   1.0     658  59.7    0.02
 33       3   0.3     661  60.0    0.02
 32       8   0.7     669  60.7    0.02
 31      12   1.1     681  61.8    0.03
 29      17   1.5     698  63.3    0.06
 28      10   0.9     708  64.2    0.07
 27      16   1.5     724  65.7    0.10
 25      26   2.4     750  68.1    0.19
 24       9   0.8     759  68.9    0.22
 22      10   0.9     769  69.8    0.28
 21       5   0.5     774  70.2    0.32
 20       7   0.6     781  70.9    0.39
 19      10   0.9     791  71.8    0.52
 18       5   0.5     796  72.2    0.60
 17       2   0.2     798  72.4    0.64
 16       5   0.5     803  72.9    0.76
 15       4   0.4     807  73.2    0.89
 13       2   0.2     809  73.4    0.99
 12       2   0.2     811  73.6    1.12
  4       2   0.2     813  73.8    1.91
  0       1   0.1     814  73.9    2.91
 -1     288  26.1    1102 100.0  290.91   (quality -1 = terminal quality 0)

Avg. full length: 1102.0, trimmed (qual > -1): 814.0
Avg. quality: 34.4 per base

Initial, terminal qual 0 segments:  1-49, 864-1102

Regions of LLR- adjusted quality < 2.0:
1-51, 755-756, 760, 762-764, 799-800, 803, 809-813, 817-823, 
847, 849-851, 853-854, 860-1102, 

12 regions, avg size 26.8, avg spacing 91.8

First_start: 1102, last_end: 1

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0)     1- 1102 [18.1] (0,0)     de050109r1         1-1102 | (13 47)  49 1091 | DA:(**49 1091**) || local(+/-) (0.0,0.0), distant (22.6,0.0)

Gaps in unique-read coverage:  None.

Contig 2.  1 read; 982 bp (untrimmed), 319 (trimmed).
      1   982 bb120109r1    301 (267)  0.00 0.00 0.00   48 (982)  615 (981) 

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 56      74   7.5      74   7.5    0.00
 50      49   5.0     123  12.5    0.00
 47       7   0.7     130  13.2    0.00
 46       2   0.2     132  13.4    0.00
 44      29   3.0     161  16.4    0.00
 43       7   0.7     168  17.1    0.00
 42      53   5.4     221  22.5    0.01
 41       8   0.8     229  23.3    0.01
 40      21   2.1     250  25.5    0.01
 38       5   0.5     255  26.0    0.01
 37      13   1.3     268  27.3    0.01
 35       4   0.4     272  27.7    0.01
 34       4   0.4     276  28.1    0.01
 33       1   0.1     277  28.2    0.02
 32       3   0.3     280  28.5    0.02
 30       1   0.1     281  28.6    0.02
 29       9   0.9     290  29.5    0.03
 27       3   0.3     293  29.8    0.04
 26       1   0.1     294  29.9    0.04
 25       1   0.1     295  30.0    0.04
 24       3   0.3     298  30.3    0.05
 23       1   0.1     299  30.4    0.06
 21       2   0.2     301  30.7    0.07
 17       4   0.4     305  31.1    0.15
 16       1   0.1     306  31.2    0.18
 14       1   0.1     307  31.3    0.22
 13       1   0.1     308  31.4    0.27
 12       1   0.1     309  31.5    0.33
 11       1   0.1     310  31.6    0.41
  9       6   0.6     316  32.2    1.17
  4       3   0.3     319  32.5    2.36
 -1     663  67.5     982 100.0  665.36   (quality -1 = terminal quality 0)

Avg. full length: 982.0, trimmed (qual > -1): 319.0
Avg. quality: 14.1 per base

Initial, terminal qual 0 segments:  1-48, 368-982

Regions of LLR- adjusted quality < 2.0:
1-48, 78-89, 116-121, 368-982, 

4 regions, avg size 170.2, avg spacing 245.5

First_start: 982, last_end: 1

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0)    49-  367 [ 7.1] (0,0)     bb120109r1         49-367 | 49 360 | DA:(**49 360**) || local(+/-) (0.0,0.0), distant (6.3,0.0)

Gaps in unique-read coverage:  None.

Contig 3.  2 reads; 47 bp (untrimmed), 0 (trimmed).  Isolated contig.
      1  1063 dg030109r1     45 (  0)  0.00 0.00 0.00    0 ( 12) 1016 (1016) 
      2  1024 da020109r1     31 (  0)  2.50 0.00 2.50    6 ( 11)  977 (977) 

Overall discrep rates (%):             1.15 0.00 1.15

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 -1      47 100.0      47 100.0   47.00   (quality -1 = terminal quality 0)

Avg. full length: 47.0, trimmed (qual > -1): 0.0
Avg. quality: 0.0 per base

Initial, terminal qual 0 segments:  1-47, (None)

Regions of LLR- adjusted quality < 2.0:
1-47, 

1 regions, avg size 47.0, avg spacing 47.0

First_start: 13, last_end: 47

Slack, # used pairs (max_score), unused
 0     1  ( 0.0)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
   48 - right        0+      da020109r1   (   2)    No             45+

Bottom strand: 
 left - right       47+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
46      1      1     79 (100.00)     0  0    0   0   0   0     0 (0.00)    0    2 (2.53)
40      5      6     78 ( 98.73)     0  0    0   0   0   0     0 (0.00)    0    2 (2.56)
35      1      7     73 ( 92.41)     0  0    0   0   0   0     0 (0.00)    0    2 (2.74)
34      1      8     72 ( 91.14)     0  0    0   0   0   0     0 (0.00)    0    2 (2.78)
33      1      9     71 ( 89.87)     0  0    0   0   0   0     0 (0.00)    0    2 (2.82)
32      3     12     70 ( 88.61)     0  0    0   0   0   0     0 (0.00)    0    2 (2.86)
29      6     18     67 ( 84.81)     0  0    0   0   0   0     0 (0.00)    0    2 (2.99)
28      1     19     61 ( 77.22)     0  0    0   0   0   0     0 (0.00)    0    2 (3.28)
27      1     20     60 ( 75.95)     0  0    0   0   0   0     0 (0.00)    0    2 (3.33)
26      1     21     59 ( 74.68)     0  0    0   0   0   0     0 (0.00)    0    2 (3.39)
25      2     23     58 ( 73.42)     0  0    0   0   0   0     0 (0.00)    0    2 (3.45)
23      4     27     56 ( 70.89)     0  0    0   0   0   0     0 (0.00)    0    2 (3.57)
22      3     30     52 ( 65.82)     0  0    0   0   0   0     0 (0.00)    0    2 (3.85)
20      3     33     49 ( 62.03)     0  0    0   0   0   0     0 (0.00)    0    2 (4.08)
19      3     36     46 ( 58.23)     0  0    0   0   0   0     0 (0.00)    0    2 (4.35)
18      1     37     43 ( 54.43)     0  0    0   0   0   0     0 (0.00)    0    2 (4.65)
16      3     40     42 ( 53.16)     0  0    0   0   0   0     0 (0.00)    0    2 (4.76)
15      3     43     39 ( 49.37)     0  0    0   0   0   0     0 (0.00)    0    2 (5.13)
13      2     45     36 ( 45.57)     0  0    0   0   0   0     0 (0.00)    0    2 (5.56)
12      2     47     34 ( 43.04)     0  0    0   0   0   0     0 (0.00)    0    2 (5.88)
11      1     48     32 ( 40.51)     0  0    0   0   0   0     0 (0.00)    0    2 (6.25)
10      4     52     31 ( 39.24)     0  0    0   0   0   0     0 (0.00)    0    2 (6.45)
 9      9     61     27 ( 34.18)     0  0    0   0   0   0     0 (0.00)    0    2 (7.41)
 8      5     66     18 ( 22.78)     0  0    0   0   0   0     0 (0.00)    0    2 (11.11)
 7      9     75     13 ( 16.46)     0  0    0   1   0   1     2 (22.22)    2    2 (15.38)
 6      4     79      4 (  5.06)     0  0    0   0   0   0     0 (0.00)    2    0 (0.00)
-1      7     86      0 (  0.00)     6  0    0   0   0   0     0 (0.00)    2    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
-1     86     86      0 (  0.00)     6  0    0   1   0   1     2 (2.33)    2    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      47       47        1

SS region: 47 (100.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality):
    12  S     da020109r1      (0)/(0)  11 CCC / CAC
    18  D     da020109r1      (0)/(0)  16 CCGG / CCG

0 HQ discrepancies in 0 reads.
2 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 4.  2 reads; 319 bp (untrimmed), 25 (trimmed).  Isolated contig.
      1  1119 ad080109r1    310 (  0)  0.00 0.00 0.00    0 (294)  800 (800) 
      1  1113 ce080109r1     66 (  0)  19.29 0.96 2.89    8 (288)  794 (794) 

Overall discrep rates (%):             9.52 0.48 1.43

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 30       2   0.6       2   0.6    0.00
 23       1   0.3       3   0.9    0.01
 18       2   0.6       5   1.6    0.04
 16       1   0.3       6   1.9    0.06
 15       1   0.3       7   2.2    0.10
 14       4   1.3      11   3.4    0.25
 13       2   0.6      13   4.1    0.35
 12       1   0.3      14   4.4    0.42
 11      10   3.1      24   7.5    1.21
 10       1   0.3      25   7.8    1.31
 -1     294  92.2     319 100.0  295.31   (quality -1 = terminal quality 0)

Avg. full length: 319.0, trimmed (qual > -1): 25.0
Avg. quality: 1.1 per base

Initial, terminal qual 0 segments:  1-294, (None)

Regions of LLR- adjusted quality < 2.0:
1-312, 316-319, 

2 regions, avg size 158.0, avg spacing 159.5

First_start: 289, last_end: 319

Slack, # used pairs (max_score), unused
 0     0  ( 0.0)     0 ( 0.0)        1
 3     1  ( 5.3)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
  320 - right        0+      ad080109r1   (   1)    No            318+

Bottom strand: 
 left - right      319+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
30      2      2    616 (100.00)     0  0    0   0   0   0     0 (0.00)    0   72 (11.69)
29      1      3    614 ( 99.68)     0  0    0   0   0   0     0 (0.00)    0   72 (11.73)
27      1      4    613 ( 99.51)     0  0    0   0   0   0     0 (0.00)    0   72 (11.75)
25      2      6    612 ( 99.35)     0  0    0   0   0   0     0 (0.00)    0   72 (11.76)
23      2      8    610 ( 99.03)     0  0    0   0   0   0     0 (0.00)    0   72 (11.80)
22      2     10    608 ( 98.70)     0  0    0   0   0   0     0 (0.00)    0   72 (11.84)
21      1     11    606 ( 98.38)     0  0    0   0   0   0     0 (0.00)    0   72 (11.88)
20      1     12    605 ( 98.21)     0  0    0   0   0   0     0 (0.00)    0   72 (11.90)
19      7     19    604 ( 98.05)     0  0    0   0   0   0     0 (0.00)    0   72 (11.92)
18      7     26    597 ( 96.92)     0  0    0   1   0   0     1 (14.29)    1   72 (12.06)
17      1     27    590 ( 95.78)     0  0    0   0   0   0     0 (0.00)    1   71 (12.03)
16     19     46    589 ( 95.62)     0  0    0   0   0   0     0 (0.00)    1   71 (12.05)
15     17     63    570 ( 92.53)     0  0    0   2   0   0     2 (11.76)    3   71 (12.46)
14     38    101    553 ( 89.77)     0  0    0   1   0   0     1 (2.63)    4   69 (12.48)
13     44    145    515 ( 83.60)     0  0    0   0   0   0     0 (0.00)    4   68 (13.20)
12     45    190    471 ( 76.46)     0  0    0   3   0   0     3 (6.67)    7   68 (14.44)
11    143    333    426 ( 69.16)     0  0    0  12   1   4    17 (11.89)   24   65 (15.26)
10     80    413    283 ( 45.94)     0  0    0  16   0   2    18 (22.50)   42   48 (16.96)
 9    108    521    203 ( 32.95)     0  0    0  12   0   1    13 (12.04)   55   30 (14.78)
 8     51    572     95 ( 15.42)     0  0    0   7   1   2    10 (19.61)   65   17 (17.89)
 7     16    588     44 (  7.14)     0  0    0   0   0   0     0 (0.00)   65    7 (15.91)
 6     28    616     28 (  4.55)     0  0    0   6   1   0     7 (25.00)   72    7 (25.00)
-1      8    624      0 (  0.00)     8  0    0   0   0   0     0 (0.00)   72    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
30      2      2     50 (100.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
29      1      3     48 ( 96.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
27      1      4     47 ( 94.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
23      1      5     46 ( 92.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
19      1      6     45 ( 90.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
18      3      9     44 ( 88.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
16      2     11     41 ( 82.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
15      2     13     39 ( 78.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
14      8     21     37 ( 74.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
13      4     25     29 ( 58.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
12      7     32     25 ( 50.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
11     15     47     18 ( 36.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
10      3     50      3 (  6.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
-1    574    624      0 (  0.00)     8  0    0  60   3   9    72 (12.54)   72    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0     294      294        1
 10       1      295        2
 11      10      305        3
 12       1      306        4
 13       2      308        4
 14       4      312        3
 15       1      313        3
 16       1      314        3
 18       2      316        2
 23       1      317        2
 30       2      319        1

SS region: 319 (100.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality):
    14  D     ce080109r1      (0)/(0)  12 CCAC / CCC
    29  S     ce080109r1      (0)/(0)  19 GTGGGCATCCTC / GGGGCCAGCCCC
    37  S     ce080109r1      (0)/(0)  36 GTC / GAC
    41  S     ce080109r1      (0)/(0)  40 ATA / ACA
    47  I     ce080109r1      (0)/(0)  44 GCGGT / GGAGAT
    51  S     ce080109r1      (0)/(0)  50 CTC / CCC
    57  S     ce080109r1      (0)/(0)  55 TATT / TGCT
    63  S     ce080109r1      (0)/(0)  61 GAAT / GGCT
    70  S     ce080109r1      (0)/(0)  69 CCT / CTT
    75  S     ce080109r1      (0)/(0)  74 AAT / AGT
    91  S     ce080109r1      (0)/(0)  78 ATATTTTACAATCTG / ATTCTTCCTTTTCG
    98  S     ce080109r1      (0)/(0)  95 CTGAT / CGGCT
   103  D     ce080109r1      (0)/(0)  101 ACAT / ACT
   114  S     ce080109r1      (0)/(0)  112 CAGG / CGTG
   124  S     ce080109r1      (0)/(0)  118 ATTATATT / ACTAGACT
   133  S     ce080109r1      (0)/(0)  132 CTC / CGC
   139  S     ce080109r1      (0)/(0)  138 CTA / CCA
   149  S     ce080109r1      (0)/(0)  143 TATATCCT / TTTCTCGT
   154  S     ce080109r1      (0)/(0)  153 TTA / TCA
   160  S     ce080109r1      (0)/(0)  158 TTCT / TGTT
   179  S     ce080109r1      (0)/(0)  169 CGACATTCTAGA / CCGACTGGATA
   191  S     ce080109r1      (0)/(0)  187 TTTATC / TTAGC
   206  D     ce080109r1      (0)/(0)  199 CACCAACTT / CGCCGACT
   218  S     ce080109r1      (0)/(0)  217 GGG / GTG
   227  S     ce080109r1      (0)/(0)  221 ATGCACCC / AGTCATTC
   235  S     ce080109r1      (0)/(0)  234 TTG / TCG
   248  S     ce080109r1      (0)/(0)  239 CCCTATTAATG / CTCTTAAGAGG
   254  S     ce080109r1      (0)/(0)  253 CTA / CGA
   261  D     ce080109r1      (0)/(0)  259 GCAT / GCT
   268  S     ce080109r1      (0)/(0)  267 TGA / TTA
   279  S     ce080109r1      (0)/(0)  273 TGTCTGGG / TATCAGTG
   285  S     ce080109r1      (0)/(0)  282 CATAT / CGTGT

0 HQ discrepancies in 0 reads.
32 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 5.  2 reads; 102 bp (untrimmed), 16 (trimmed).  Isolated contig.
   -973   102 ad040109f1     95 (  0)  1.96 0.00 0.00  974 (983)    0 ( 77) 
   -968   119 be080109f1     47 (  0)  15.69 0.00 0.98  969 (978)   17 ( 93) 

Overall discrep rates (%):             8.82 0.00 0.49

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 14       2   2.0       2   2.0    0.08
 12       2   2.0       4   3.9    0.21
 11       3   2.9       7   6.9    0.44
 10       3   2.9      10   9.8    0.74
  9       2   2.0      12  11.8    1.00
  8       4   3.9      16  15.7    1.63
 -1      86  84.3     102 100.0   87.63   (quality -1 = terminal quality 0)

Avg. full length: 102.0, trimmed (qual > -1): 16.0
Avg. quality: 1.6 per base

Initial, terminal qual 0 segments:  1-9, 26-102

Regions of LLR- adjusted quality < 2.0:
1-102, 

1 regions, avg size 102.0, avg spacing 102.0

First_start: 10, last_end: 26

Slack, # used pairs (max_score), unused
 0     1  ( 1.8)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
  103 - right        0+      be080109f1   (-968)    No           1070+

Bottom strand: 
 left - right      102+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
34      0      0    203 (100.00)     0  0    0   0   0   0     0 (0.00)    0   19 (9.36)
29      0      0    203 (100.00)     0  0    0   0   0   0     0 (0.00)    0   19 (9.36)
25      0      0    203 (100.00)     0  0    0   0   0   0     0 (0.00)    0   19 (9.36)
24      2      2    203 (100.00)     0  0    0   0   0   0     0 (0.00)    0   19 (9.36)
23      1      3    201 ( 99.01)     0  0    0   0   0   0     0 (0.00)    0   19 (9.45)
22      1      4    200 ( 98.52)     0  0    0   0   0   0     0 (0.00)    0   19 (9.50)
21      0      4    199 ( 98.03)     0  0    0   0   0   0     0 (0.00)    0   19 (9.55)
20      1      5    199 ( 98.03)     0  0    0   0   0   0     0 (0.00)    0   19 (9.55)
19      0      5    198 ( 97.54)     0  0    0   0   0   0     0 (0.00)    0   19 (9.60)
17      4      9    198 ( 97.54)     0  0    0   0   0   0     0 (0.00)    0   19 (9.60)
16      1     10    194 ( 95.57)     0  0    0   0   0   0     0 (0.00)    0   19 (9.79)
15      5     15    193 ( 95.07)     0  0    0   0   0   0     0 (0.00)    0   19 (9.84)
14      5     20    188 ( 92.61)     0  0    0   0   0   0     0 (0.00)    0   19 (10.11)
13      6     26    183 ( 90.15)     0  0    0   0   0   0     0 (0.00)    0   19 (10.38)
12     13     39    177 ( 87.19)     0  0    0   2   0   0     2 (15.38)    2   19 (10.73)
11     17     56    164 ( 80.79)     0  0    0   2   0   0     2 (11.76)    4   17 (10.37)
10     18     74    147 ( 72.41)     0  0    0   2   0   0     2 (11.11)    6   15 (10.20)
 9     41    115    129 ( 63.55)     0  0    0   3   0   1     4 (9.76)   10   13 (10.08)
 8     27    142     88 ( 43.35)     0  0    0   3   0   0     3 (11.11)   13    9 (10.23)
 7     36    178     61 ( 30.05)     0  0    0   2   0   0     2 (5.56)   15    6 (9.84)
 6     25    203     25 ( 12.32)     0  0    0   4   0   0     4 (16.00)   19    4 (16.00)
 0      0    203      0 (  0.00)     0  0    0   0   0   0     0 (0.00)   19    0 (0.00)
-1      0    203      0 (  0.00)     0  0    0   0   0   0     0 (0.00)   19    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
14      2      2     32 (100.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
12      2      4     30 ( 93.75)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
11      4      8     28 ( 87.50)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
10      3     11     24 ( 75.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
 9      3     14     21 ( 65.62)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
 8      6     20     18 ( 56.25)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
 7      3     23     12 ( 37.50)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
 6      9     32      9 ( 28.12)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
-1    171    203      0 (  0.00)     0  0    0  18   0   1    19 (11.11)   19    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      86       86        2
  8       4       90        4
  9       2       92        4
 10       3       95        4
 11       3       98        4
 12       2      100        3
 14       2      102        1

SS region: 102 (100.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality):
     9  S     be080109f1      (9)/(9)  6 AACCA / ATCAA
    33  D     be080109f1      (0)/(0)  31 GTTA / GTA
    40  S     be080109f1      (0)/(0)  36 CTTCCA / CATCGA
    48  S     be080109f1      (0)/(0)  47 GGA / GAA
    53  S     be080109f1      (0)/(0)  52 CTC / CCC
    59  S     be080109f1      (0)/(0)  56 AACCG / ACAAG
    65  S     be080109f1      (0)/(0)  64 GTA / GAA
    69  S     be080109f1      (0)/(0)  68 AAA / AGA
    79  S     be080109f1      (0)/(0)  78 GAA / GGA
    84  S     be080109f1      (0)/(0)  82 AATT / AGGT
    92  S     be080109f1      (0)/(0)  89 TCCCC / TTCGC

0 HQ discrepancies in 0 reads.
11 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 6.  2 reads; 301 bp (untrimmed), 301 (trimmed).
C  -700   350 dc020109r1    292 (266)  0.66 0.00 0.00  701 (701)   49 ( 49) 
     -9  1051 dc020109f1    283 (269)  0.66 0.33 0.33   10 ( 10)  750 (750) 

Overall discrep rates (%):             0.66 0.17 0.17

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90     170  56.5     170  56.5    0.00
 89       5   1.7     175  58.1    0.00
 88       6   2.0     181  60.1    0.00
 87       6   2.0     187  62.1    0.00
 86       8   2.7     195  64.8    0.00
 85       5   1.7     200  66.4    0.00
 84       5   1.7     205  68.1    0.00
 83       3   1.0     208  69.1    0.00
 82       6   2.0     214  71.1    0.00
 81       1   0.3     215  71.4    0.00
 79       4   1.3     219  72.8    0.00
 77       1   0.3     220  73.1    0.00
 76       2   0.7     222  73.8    0.00
 75       1   0.3     223  74.1    0.00
 74       4   1.3     227  75.4    0.00
 73       1   0.3     228  75.7    0.00
 71      23   7.6     251  83.4    0.00
 69       2   0.7     253  84.1    0.00
 66       6   2.0     259  86.0    0.00
 65       2   0.7     261  86.7    0.00
 62       1   0.3     262  87.0    0.00
 61       1   0.3     263  87.4    0.00
 58       6   2.0     269  89.4    0.00
 56      18   6.0     287  95.3    0.00
 51       3   1.0     290  96.3    0.00
 50       2   0.7     292  97.0    0.00
 46       3   1.0     295  98.0    0.00
 44       1   0.3     296  98.3    0.00
 43       2   0.7     298  99.0    0.00
 42       3   1.0     301 100.0    0.00   (quality -1 = terminal quality 0)

Avg. full length: 301.0, trimmed (qual > -1): 301.0
Avg. quality: 81.6 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:


1 regions, avg size 0.0, avg spacing 301.0

First_start: 1, last_end: 301

Slack, # used pairs (max_score), unused
 0     1  ( 6.4)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
  302 - right        0+      dc020109f1   (  -9)    No            310+

Bottom strand: 
 left -     0        0+      dc020109r1   ( 350)    Yes           350+
  302 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56    220    220    602 (100.00)     0  0    0   0   0   0     0 (0.00)    0    6 (1.00)
51     27    247    382 ( 63.46)     0  0    0   0   0   0     0 (0.00)    0    6 (1.57)
50     31    278    355 ( 58.97)     0  0    0   0   0   0     0 (0.00)    0    6 (1.69)
48      5    283    324 ( 53.82)     0  0    0   0   0   0     0 (0.00)    0    6 (1.85)
47      7    290    319 ( 52.99)     0  0    0   0   0   0     0 (0.00)    0    6 (1.88)
46     20    310    312 ( 51.83)     0  0    0   0   0   0     0 (0.00)    0    6 (1.92)
45      2    312    292 ( 48.50)     0  0    0   0   0   0     0 (0.00)    0    6 (2.05)
44     36    348    290 ( 48.17)     0  0    0   0   0   0     0 (0.00)    0    6 (2.07)
43     28    376    254 ( 42.19)     0  0    0   0   0   0     0 (0.00)    0    6 (2.36)
42     75    451    226 ( 37.54)     0  0    0   0   0   0     0 (0.00)    0    6 (2.65)
41      1    452    151 ( 25.08)     0  0    0   0   0   0     0 (0.00)    0    6 (3.97)
40     44    496    150 ( 24.92)     0  0    0   0   0   0     0 (0.00)    0    6 (4.00)
38      2    498    106 ( 17.61)     0  0    0   0   0   0     0 (0.00)    0    6 (5.66)
37     24    522    104 ( 17.28)     0  0    0   0   0   0     0 (0.00)    0    6 (5.77)
36      2    524     80 ( 13.29)     0  0    0   0   0   0     0 (0.00)    0    6 (7.50)
35      5    529     78 ( 12.96)     0  0    0   0   0   0     0 (0.00)    0    6 (7.69)
34      0    529     73 ( 12.13)     0  0    0   0   0   0     0 (0.00)    0    6 (8.22)
33      5    534     73 ( 12.13)     0  0    0   0   0   0     0 (0.00)    0    6 (8.22)
32      3    537     68 ( 11.30)     0  0    0   0   0   0     0 (0.00)    0    6 (8.82)
31      3    540     65 ( 10.80)     0  0    0   0   0   0     0 (0.00)    0    6 (9.23)
29      5    545     62 ( 10.30)     0  0    0   0   0   0     0 (0.00)    0    6 (9.68)
28      3    548     57 (  9.47)     0  0    0   0   0   0     0 (0.00)    0    6 (10.53)
27      4    552     54 (  8.97)     0  0    0   0   0   0     0 (0.00)    0    6 (11.11)
26      0    552     50 (  8.31)     0  0    0   0   0   0     0 (0.00)    0    6 (12.00)
25      4    556     50 (  8.31)     0  0    0   0   0   0     0 (0.00)    0    6 (12.00)
24      4    560     46 (  7.64)     0  0    0   0   0   0     0 (0.00)    0    6 (13.04)
23      5    565     42 (  6.98)     0  0    0   0   0   0     0 (0.00)    0    6 (14.29)
22      0    565     37 (  6.15)     0  0    0   0   0   0     0 (0.00)    0    6 (16.22)
21      2    567     37 (  6.15)     0  0    0   0   0   0     0 (0.00)    0    6 (16.22)
20      3    570     35 (  5.81)     0  0    0   0   0   0     0 (0.00)    0    6 (17.14)
19      2    572     32 (  5.32)     0  0    0   0   0   0     0 (0.00)    0    6 (18.75)
18      2    574     30 (  4.98)     0  0    0   0   0   0     0 (0.00)    0    6 (20.00)
17      1    575     28 (  4.65)     0  0    0   0   0   0     0 (0.00)    0    6 (21.43)
16      1    576     27 (  4.49)     0  0    0   0   0   0     0 (0.00)    0    6 (22.22)
15      1    577     26 (  4.32)     0  0    0   0   0   0     0 (0.00)    0    6 (23.08)
14      2    579     25 (  4.15)     0  0    0   0   0   0     0 (0.00)    0    6 (24.00)
13      0    579     23 (  3.82)     0  0    0   0   0   0     0 (0.00)    0    6 (26.09)
12      3    582     23 (  3.82)     0  0    0   1   0   0     1 (33.33)    1    6 (26.09)
11      2    584     20 (  3.32)     0  0    0   0   0   0     0 (0.00)    1    5 (25.00)
10      4    588     18 (  2.99)     0  0    0   0   0   0     0 (0.00)    1    5 (27.78)
 9     10    598     14 (  2.33)     0  0    0   3   1   1     5 (50.00)    6    5 (35.71)
 8      1    599      4 (  0.66)     0  0    0   0   0   0     0 (0.00)    6    0 (0.00)
 6      3    602      3 (  0.50)     0  0    0   0   0   0     0 (0.00)    6    0 (0.00)
-1      0    602      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    6    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90    340    340    602 (100.00)     0  0    0   0   0   0     0 (0.00)    0    6 (1.00)
89     10    350    262 ( 43.52)     0  0    0   0   0   0     0 (0.00)    0    6 (2.29)
88     12    362    252 ( 41.86)     0  0    0   0   0   0     0 (0.00)    0    6 (2.38)
87     12    374    240 ( 39.87)     0  0    0   0   0   0     0 (0.00)    0    6 (2.50)
86     16    390    228 ( 37.87)     0  0    0   0   0   0     0 (0.00)    0    6 (2.63)
85     10    400    212 ( 35.22)     0  0    0   0   0   0     0 (0.00)    0    6 (2.83)
84     10    410    202 ( 33.55)     0  0    0   0   0   0     0 (0.00)    0    6 (2.97)
83      6    416    192 ( 31.89)     0  0    0   0   0   0     0 (0.00)    0    6 (3.12)
82     12    428    186 ( 30.90)     0  0    0   0   0   0     0 (0.00)    0    6 (3.23)
81      2    430    174 ( 28.90)     0  0    0   0   0   0     0 (0.00)    0    6 (3.45)
79      8    438    172 ( 28.57)     0  0    0   0   0   0     0 (0.00)    0    6 (3.49)
77      2    440    164 ( 27.24)     0  0    0   0   0   0     0 (0.00)    0    6 (3.66)
76      4    444    162 ( 26.91)     0  0    0   0   0   0     0 (0.00)    0    6 (3.70)
75      2    446    158 ( 26.25)     0  0    0   0   0   0     0 (0.00)    0    6 (3.80)
74      8    454    156 ( 25.91)     0  0    0   0   0   0     0 (0.00)    0    6 (3.85)
73      2    456    148 ( 24.58)     0  0    0   0   0   0     0 (0.00)    0    6 (4.05)
71     24    480    146 ( 24.25)     0  0    0   0   0   0     0 (0.00)    0    6 (4.11)
70      1    481    122 ( 20.27)     0  0    0   0   0   0     0 (0.00)    0    6 (4.92)
69      4    485    121 ( 20.10)     0  0    0   0   0   0     0 (0.00)    0    6 (4.96)
66      7    492    117 ( 19.44)     0  0    0   0   0   0     0 (0.00)    0    6 (5.13)
65      2    494    110 ( 18.27)     0  0    0   0   0   0     0 (0.00)    0    6 (5.45)
62      2    496    108 ( 17.94)     0  0    0   0   0   0     0 (0.00)    0    6 (5.56)
61      1    497    106 ( 17.61)     0  0    0   0   0   0     0 (0.00)    0    6 (5.66)
58      6    503    105 ( 17.44)     0  0    0   0   0   0     0 (0.00)    0    6 (5.71)
57      3    506     99 ( 16.45)     0  0    0   0   0   0     0 (0.00)    0    6 (6.06)
56     18    524     96 ( 15.95)     0  0    0   0   0   0     0 (0.00)    0    6 (6.25)
55     11    535     78 ( 12.96)     0  0    0   0   0   0     0 (0.00)    0    6 (7.69)
53      2    537     67 ( 11.13)     0  0    0   0   0   0     0 (0.00)    0    6 (8.96)
51      3    540     65 ( 10.80)     0  0    0   0   0   0     0 (0.00)    0    6 (9.23)
50      4    544     62 ( 10.30)     0  0    0   0   0   0     0 (0.00)    0    6 (9.68)
47      1    545     58 (  9.63)     0  0    0   0   0   0     0 (0.00)    0    6 (10.34)
46      4    549     57 (  9.47)     0  0    0   0   0   0     0 (0.00)    0    6 (10.53)
44      5    554     53 (  8.80)     0  0    0   0   0   0     0 (0.00)    0    6 (11.32)
43      3    557     48 (  7.97)     0  0    0   0   0   0     0 (0.00)    0    6 (12.50)
42      6    563     45 (  7.48)     0  0    0   0   0   0     0 (0.00)    0    6 (13.33)
40      2    565     39 (  6.48)     0  0    0   0   0   0     0 (0.00)    0    6 (15.38)
39      1    566     37 (  6.15)     0  0    0   0   0   0     0 (0.00)    0    6 (16.22)
38      4    570     36 (  5.98)     0  0    0   0   0   0     0 (0.00)    0    6 (16.67)
35      2    572     32 (  5.32)     0  0    0   0   0   0     0 (0.00)    0    6 (18.75)
32      1    573     30 (  4.98)     0  0    0   0   0   0     0 (0.00)    0    6 (20.00)
24      2    575     29 (  4.82)     0  0    0   0   0   0     0 (0.00)    0    6 (20.69)
23      1    576     27 (  4.49)     0  0    0   0   0   0     0 (0.00)    0    6 (22.22)
21      1    577     26 (  4.32)     0  0    0   0   0   0     0 (0.00)    0    6 (23.08)
20      1    578     25 (  4.15)     0  0    0   0   0   0     0 (0.00)    0    6 (24.00)
16      1    579     24 (  3.99)     0  0    0   0   0   0     0 (0.00)    0    6 (25.00)
15      1    580     23 (  3.82)     0  0    0   0   0   0     0 (0.00)    0    6 (26.09)
14      1    581     22 (  3.65)     0  0    0   0   0   0     0 (0.00)    0    6 (27.27)
12      3    584     21 (  3.49)     0  0    0   1   0   0     1 (33.33)    1    6 (28.57)
11      2    586     18 (  2.99)     0  0    0   0   0   0     0 (0.00)    1    5 (27.78)
10      2    588     16 (  2.66)     0  0    0   0   0   0     0 (0.00)    1    5 (31.25)
 9     10    598     14 (  2.33)     0  0    0   3   1   1     5 (50.00)    6    5 (35.71)
 8      1    599      4 (  0.66)     0  0    0   0   0   0     0 (0.00)    6    0 (0.00)
 6      3    602      3 (  0.50)     0  0    0   0   0   0     0 (0.00)    6    0 (0.00)
-1      0    602      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    6    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
 42       3        3        2
 43       2        5        3
 44       1        6        3
 46       3        9        2
 50       2       11        2
 51       3       14        3
 56      18       32        6
 58       6       38        8
 61       1       39        7
 62       1       40        7
 65       2       42        8
 66       6       48        8
 69       2       50        9
 71      23       73        7
 73       1       74        6
 74       4       78        7
 75       1       79        7
 76       2       81        7
 77       1       82        6
 79       4       86        6
 81       1       87        6
 82       6       93        9
 83       3       96       10
 84       5      101       14
 85       5      106       15
 86       8      114       17
 87       6      120       17
 88       6      126       16
 89       5      131       17
 90     170      301        1

SS region: 0 (0.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:   E 1- 301

Contig 7.  2 reads; 90 bp (untrimmed), 26 (trimmed).  Isolated contig.
     -1  1081 cc050109f1     74 (  0)  2.35 1.18 0.00    7 ( 56)  991 (1002) 
      1  1046 cc100109f1     58 (  0)  6.33 0.00 1.27    0 ( 52)  967 (967) 

Overall discrep rates (%):             4.27 0.61 0.61

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 23       1   1.1       1   1.1    0.01
 20       2   2.2       3   3.3    0.03
 18       6   6.7       9  10.0    0.12
 17       1   1.1      10  11.1    0.14
 16       4   4.4      14  15.6    0.24
 14       1   1.1      15  16.7    0.28
 13       2   2.2      17  18.9    0.38
 12       2   2.2      19  21.1    0.51
 11       2   2.2      21  23.3    0.67
 10       2   2.2      23  25.6    0.87
  9       1   1.1      24  26.7    0.99
  8       2   2.2      26  28.9    1.31
 -1      64  71.1      90 100.0   65.31   (quality -1 = terminal quality 0)

Avg. full length: 90.0, trimmed (qual > -1): 26.0
Avg. quality: 4.3 per base

Initial, terminal qual 0 segments:  1-53, 80-90

Regions of LLR- adjusted quality < 2.0:
1-73, 75, 78-90, 

3 regions, avg size 29.0, avg spacing 30.0

First_start: 53, last_end: 79

Slack, # used pairs (max_score), unused
 0     0  ( 0.0)     0 ( 0.0)        1
 1     1  ( 0.0)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
   91 - right        0+      cc100109f1   (   1)    No             89+

Bottom strand: 
 left - right       90+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
33      0      0    159 (100.00)     0  0    0   0   0   0     0 (0.00)    0    9 (5.66)
31      1      1    159 (100.00)     0  0    0   0   0   0     0 (0.00)    0    9 (5.66)
29      1      2    158 ( 99.37)     0  0    0   0   0   0     0 (0.00)    0    9 (5.70)
27      1      3    157 ( 98.74)     0  0    0   0   0   0     0 (0.00)    0    9 (5.73)
26      1      4    156 ( 98.11)     0  0    0   0   0   0     0 (0.00)    0    9 (5.77)
25      1      5    155 ( 97.48)     0  0    0   0   0   0     0 (0.00)    0    9 (5.81)
24      1      6    154 ( 96.86)     0  0    0   0   0   0     0 (0.00)    0    9 (5.84)
23      6     12    153 ( 96.23)     0  0    0   0   0   0     0 (0.00)    0    9 (5.88)
21      4     16    147 ( 92.45)     0  0    0   0   0   0     0 (0.00)    0    9 (6.12)
20      4     20    143 ( 89.94)     0  0    0   0   0   0     0 (0.00)    0    9 (6.29)
19      0     20    139 ( 87.42)     0  0    0   0   0   0     0 (0.00)    0    9 (6.47)
18      6     26    139 ( 87.42)     0  0    0   0   0   0     0 (0.00)    0    9 (6.47)
17      6     32    133 ( 83.65)     0  0    0   2   0   0     2 (33.33)    2    9 (6.77)
16      9     41    127 ( 79.87)     0  0    0   0   0   0     0 (0.00)    2    7 (5.51)
15      3     44    118 ( 74.21)     0  0    0   0   0   1     1 (33.33)    3    7 (5.93)
14      8     52    115 ( 72.33)     0  0    0   0   0   0     0 (0.00)    3    6 (5.22)
13      9     61    107 ( 67.30)     0  0    0   0   0   0     0 (0.00)    3    6 (5.61)
12     12     73     98 ( 61.64)     0  0    0   0   0   0     0 (0.00)    3    6 (6.12)
11     16     89     86 ( 54.09)     0  0    0   0   0   0     0 (0.00)    3    6 (6.98)
10     22    111     70 ( 44.03)     0  0    0   0   0   0     0 (0.00)    3    6 (8.57)
 9      7    118     48 ( 30.19)     1  0    0   0   0   0     0 (0.00)    3    6 (12.50)
 8     19    137     41 ( 25.79)     0  0    0   1   0   0     1 (5.26)    4    6 (14.63)
 7      9    146     22 ( 13.84)     0  0    0   2   0   0     2 (22.22)    6    5 (22.73)
 6     13    159     13 (  8.18)     1  0    0   2   1   0     3 (23.08)    9    3 (23.08)
-1      5    164      0 (  0.00)    14  0    0   0   0   0     0 (0.00)    9    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
23      1      1     26 (100.00)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
20      2      3     25 ( 96.15)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
18      6      9     23 ( 88.46)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
17      1     10     17 ( 65.38)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
16      4     14     16 ( 61.54)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
14      1     15     12 ( 46.15)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
13      2     17     11 ( 42.31)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
12      2     19      9 ( 34.62)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
11      2     21      7 ( 26.92)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
10      2     23      5 ( 19.23)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
 9      1     24      3 ( 11.54)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
 8      2     26      2 (  7.69)     0  0    0   0   0   0     0 (0.00)    0    0 (0.00)
-1    138    164      0 (  0.00)    16  0    0   7   1   1     9 (6.52)    9    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      64       64        2
  8       2       66        3
  9       1       67        3
 10       2       69        3
 11       2       71        3
 12       2       73        4
 13       2       75        4
 14       1       76        4
 16       4       80        3
 17       1       81        2
 18       6       87        3
 20       2       89        2
 23       1       90        1

SS region: 90 (100.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality):
    12  I     cc050109f1      (0)/(0)  12 TT / TAT
    16  S     cc050109f1      (0)/(0)  15 TAT / TTT
    23  S     cc050109f1      (0)/(0)  22 TTA / TGA
    37  S     cc100109f1      (0)/(0)  33 CTGACT / CTAGT
    43  S     cc100109f1      (0)/(0)  42 GTA / GAA
    48  S     cc100109f1      (0)/(0)  47 CTT / CAT

0 HQ discrepancies in 0 reads.
6 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 8.  2 reads; 91 bp (untrimmed), 52 (trimmed).  Isolated contig.
   -982    77 bg030109r1     61 (  0)  4.05 1.35 0.00  983 (997)    3 ( 12) 
   -932    91 de120109r1     76 (  0)  5.49 0.00 0.00  933 (946)    0 ( 26) 

Overall discrep rates (%):             4.85 0.61 0.00

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 32       2   2.2       2   2.2    0.00
 20       1   1.1       3   3.3    0.01
 19       1   1.1       4   4.4    0.02
 17       1   1.1       5   5.5    0.04
 16       1   1.1       6   6.6    0.07
 15       1   1.1       7   7.7    0.10
 13       4   4.4      11  12.1    0.30
 12       4   4.4      15  16.5    0.55
 11       5   5.5      20  22.0    0.95
 10      10  11.0      30  33.0    1.95
  9       6   6.6      36  39.6    2.71
  8       6   6.6      42  46.2    3.66
  7       9   9.9      51  56.0    5.45
  6       1   1.1      52  57.1    5.70
 -1      39  42.9      91 100.0   44.70   (quality -1 = terminal quality 0)

Avg. full length: 91.0, trimmed (qual > -1): 52.0
Avg. quality: 6.3 per base

Initial, terminal qual 0 segments:  1-13, 66-91

Regions of LLR- adjusted quality < 2.0:
1-53, 57-91, 

2 regions, avg size 44.0, avg spacing 45.5

First_start: 14, last_end: 65

Slack, # used pairs (max_score), unused
 0     1  ( 1.4)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
   92 - right        0+      de120109r1   (-932)    No           1023+

Bottom strand: 
 left - right       91+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
37      0      0    149 (100.00)     0  0    0   0   0   0     0 (0.00)    0    9 (6.04)
34      0      0    149 (100.00)     0  0    0   0   0   0     0 (0.00)    0    9 (6.04)
32      2      2    149 (100.00)     0  0    0   0   0   0     0 (0.00)    0    9 (6.04)
29      0      2    147 ( 98.66)     0  0    0   0   0   0     0 (0.00)    0    9 (6.12)
23      0      2    147 ( 98.66)     0  0    0   0   0   0     0 (0.00)    0    9 (6.12)
20      1      3    147 ( 98.66)     0  0    0   0   0   0     0 (0.00)    0    9 (6.12)
19      1      4    146 ( 97.99)     0  0    0   0   0   0     0 (0.00)    0    9 (6.16)
17      1      5    145 ( 97.32)     0  0    0   0   0   0     0 (0.00)    0    9 (6.21)
16      1      6    144 ( 96.64)     0  0    0   0   0   0     0 (0.00)    0    9 (6.25)
15      1      7    143 ( 95.97)     0  0    0   0   0   0     0 (0.00)    0    9 (6.29)
14      1      8    142 ( 95.30)     0  0    0   0   0   0     0 (0.00)    0    9 (6.34)
13      7     15    141 ( 94.63)     0  0    0   1   0   0     1 (14.29)    1    9 (6.38)
12      9     24    134 ( 89.93)     0  0    0   0   0   0     0 (0.00)    1    8 (5.97)
11     12     36    125 ( 83.89)     0  0    0   0   0   0     0 (0.00)    1    8 (6.40)
10     20     56    113 ( 75.84)     0  0    0   1   0   0     1 (5.00)    2    8 (7.08)
 9     40     96     93 ( 62.42)     0  0    0   3   1   0     4 (10.00)    6    7 (7.53)
 8     12    108     53 ( 35.57)     0  0    0   1   0   0     1 (8.33)    7    3 (5.66)
 7     24    132     41 ( 27.52)     0  0    0   0   0   0     0 (0.00)    7    2 (4.88)
 6     17    149     17 ( 11.41)     0  0    0   2   0   0     2 (11.76)    9    2 (11.76)
 0      0    149      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    9    0 (0.00)
-1     17    166      0 (  0.00)     3  0    0   0   0   0     0 (0.00)    9    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
32      2      2    104 (100.00)     0  0    0   0   0   0     0 (0.00)    0    4 (3.85)
20      1      3    102 ( 98.08)     0  0    0   0   0   0     0 (0.00)    0    4 (3.92)
19      1      4    101 ( 97.12)     0  0    0   0   0   0     0 (0.00)    0    4 (3.96)
17      1      5    100 ( 96.15)     0  0    0   0   0   0     0 (0.00)    0    4 (4.00)
16      1      6     99 ( 95.19)     0  0    0   0   0   0     0 (0.00)    0    4 (4.04)
15      1      7     98 ( 94.23)     0  0    0   0   0   0     0 (0.00)    0    4 (4.08)
13      4     11     97 ( 93.27)     0  0    0   0   0   0     0 (0.00)    0    4 (4.12)
12      6     17     93 ( 89.42)     0  0    0   0   0   0     0 (0.00)    0    4 (4.30)
11      5     22     87 ( 83.65)     0  0    0   0   0   0     0 (0.00)    0    4 (4.60)
10     15     37     82 ( 78.85)     0  0    0   1   0   0     1 (6.67)    1    4 (4.88)
 9     21     58     67 ( 64.42)     0  0    0   1   0   0     1 (4.76)    2    3 (4.48)
 8     11     69     46 ( 44.23)     0  0    0   0   0   0     0 (0.00)    2    2 (4.35)
 7     18     87     35 ( 33.65)     0  0    0   0   0   0     0 (0.00)    2    2 (5.71)
 6     17    104     17 ( 16.35)     0  0    0   2   0   0     2 (11.76)    4    2 (11.76)
-1     62    166      0 (  0.00)     3  0    0   4   1   0     5 (8.06)    9    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      39       39        2
  6       1       40        3
  7       9       49        6
  8       6       55        9
  9       6       61        9
 10      10       71        9
 11       5       76        8
 12       4       80        7
 13       4       84        4
 15       1       85        4
 16       1       86        3
 17       1       87        2
 19       1       88        2
 20       1       89        2
 32       2       91        1

SS region: 91 (100.00%), flagged: 2 (2.20%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality):
     7  I     bg030109r1      (0)/(0)  7 TT / TCT
    13  S     bg030109r1      (9)/(9)  10 GGATC / GAACC

0 HQ discrepancies in 0 reads.
2 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 9.  2 reads; 50 bp (untrimmed), 0 (trimmed).  Isolated contig.
      1  1072 dg090109r1     48 (  0)  0.00 0.00 0.00    0 ( 20) 1022 (1022) 
      4  1050 da060109r1     30 (  0)  10.00 0.00 0.00    7 ( 17) 1000 (1000) 

Overall discrep rates (%):             4.44 0.00 0.00

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 -1      50 100.0      50 100.0   50.00   (quality -1 = terminal quality 0)

Avg. full length: 50.0, trimmed (qual > -1): 0.0
Avg. quality: 0.0 per base

Initial, terminal qual 0 segments:  1-50, (None)

Regions of LLR- adjusted quality < 2.0:
1-50, 

1 regions, avg size 50.0, avg spacing 50.0

First_start: 21, last_end: 50

Slack, # used pairs (max_score), unused
 0     1  ( 0.0)     0 ( 0.0)        1

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
   51 - right        0+      da060109r1   (   4)    No             46+

Bottom strand: 
 left - right       50+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
48      1      1     80 (100.00)     0  0    0   0   0   0     0 (0.00)    0    4 (5.00)
40      8      9     79 ( 98.75)     0  0    0   0   0   0     0 (0.00)    0    4 (5.06)
39      1     10     71 ( 88.75)     0  0    0   0   0   0     0 (0.00)    0    4 (5.63)
32      1     11     70 ( 87.50)     0  0    0   0   0   0     0 (0.00)    0    4 (5.71)
31      1     12     69 ( 86.25)     0  0    0   0   0   0     0 (0.00)    0    4 (5.80)
30      1     13     68 ( 85.00)     0  0    0   0   0   0     0 (0.00)    0    4 (5.88)
29      1     14     67 ( 83.75)     0  0    0   0   0   0     0 (0.00)    0    4 (5.97)
26      1     15     66 ( 82.50)     0  0    0   0   0   0     0 (0.00)    0    4 (6.06)
25      2     17     65 ( 81.25)     0  0    0   0   0   0     0 (0.00)    0    4 (6.15)
24      1     18     63 ( 78.75)     0  0    0   0   0   0     0 (0.00)    0    4 (6.35)
23      4     22     62 ( 77.50)     0  0    0   0   0   0     0 (0.00)    0    4 (6.45)
21      2     24     58 ( 72.50)     0  0    0   0   0   0     0 (0.00)    0    4 (6.90)
20      2     26     56 ( 70.00)     0  0    0   0   0   0     0 (0.00)    0    4 (7.14)
19      5     31     54 ( 67.50)     0  0    0   0   0   0     0 (0.00)    0    4 (7.41)
18      4     35     49 ( 61.25)     0  0    0   0   0   0     0 (0.00)    0    4 (8.16)
17      1     36     45 ( 56.25)     0  0    0   0   0   0     0 (0.00)    0    4 (8.89)
16      3     39     44 ( 55.00)     0  0    0   0   0   0     0 (0.00)    0    4 (9.09)
15      1     40     41 ( 51.25)     0  0    0   0   0   0     0 (0.00)    0    4 (9.76)
14      2     42     40 ( 50.00)     0  0    0   0   0   0     0 (0.00)    0    4 (10.00)
13      7     49     38 ( 47.50)     0  0    0   1   0   0     1 (14.29)    1    4 (10.53)
12      3     52     31 ( 38.75)     0  0    0   0   0   0     0 (0.00)    1    3 (9.68)
10      3     55     28 ( 35.00)     0  0    0   0   0   0     0 (0.00)    1    3 (10.71)
 9      1     56     25 ( 31.25)     0  0    0   0   0   0     0 (0.00)    1    3 (12.00)
 8      7     63     24 ( 30.00)     0  0    0   0   0   0     0 (0.00)    1    3 (12.50)
 7      7     70     17 ( 21.25)     0  0    0   0   0   0     0 (0.00)    1    3 (17.65)
 6      6     76     10 ( 12.50)     0  0    0   0   0   0     0 (0.00)    1    3 (30.00)
 4      2     78      4 (  5.00)     0  0    0   1   0   0     1 (50.00)    2    3 (75.00)
 0      2     80      2 (  2.50)     0  0    2   0   0   0     2 (100.00)    4    2 (100.00)
-1     10     90      0 (  0.00)     7  0    0   0   0   0     0 (0.00)    4    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
-1     90     90      0 (  0.00)     7  0    2   2   0   0     4 (4.44)    4    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      50       50        1

SS region: 50 (100.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality):
    20  S     da060109r1      (0)/(0)  15 GACGGCT / GNNCGGT

0 HQ discrepancies in 0 reads.
1 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 10.  3 reads; 1760 bp (untrimmed), 1264 (trimmed).
    -45   971 dh120109r1    854 (467)  0.42 0.74 0.11   46 (278)   23 ( 23) 
    201  1242 ba110109f1     33 ( 33)  0.00 0.00 2.44   32 ( 32)  969 (969) 
    668  1760 ca010109r1    967 (  0)  0.19 0.00 0.00   49 ( 49)    0 (812) 

Overall discrep rates (%):             0.30 0.34 0.10

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 66      32   1.8      32   1.8    0.00
 61      11   0.6      43   2.4    0.00
 60       4   0.2      47   2.7    0.00
 57       1   0.1      48   2.7    0.00
 56     400  22.7     448  25.5    0.00
 55       1   0.1     449  25.5    0.00
 54       3   0.2     452  25.7    0.00
 53       4   0.2     456  25.9    0.00
 52       5   0.3     461  26.2    0.00
 51      39   2.2     500  28.4    0.00
 50     145   8.2     645  36.6    0.00
 48       5   0.3     650  36.9    0.00
 47      17   1.0     667  37.9    0.00
 46      23   1.3     690  39.2    0.00
 45       1   0.1     691  39.3    0.00
 44      76   4.3     767  43.6    0.01
 43      46   2.6     813  46.2    0.01
 42     165   9.4     978  55.6    0.02
 41      11   0.6     989  56.2    0.02
 40      66   3.8    1055  59.9    0.03
 39       4   0.2    1059  60.2    0.03
 38       5   0.3    1064  60.5    0.03
 37      24   1.4    1088  61.8    0.03
 36       2   0.1    1090  61.9    0.03
 35      26   1.5    1116  63.4    0.04
 34      14   0.8    1130  64.2    0.05
 33      15   0.9    1145  65.1    0.05
 32       9   0.5    1154  65.6    0.06
 31       7   0.4    1161  66.0    0.07
 30       9   0.5    1170  66.5    0.08
 29      12   0.7    1182  67.2    0.09
 28       7   0.4    1189  67.6    0.10
 27       4   0.2    1193  67.8    0.11
 26       1   0.1    1194  67.8    0.11
 25       6   0.3    1200  68.2    0.13
 24       2   0.1    1202  68.3    0.14
 23       4   0.2    1206  68.5    0.16
 22       5   0.3    1211  68.8    0.19
 21       3   0.2    1214  69.0    0.21
 20       3   0.2    1217  69.1    0.24
 19       9   0.5    1226  69.7    0.36
 18       6   0.3    1232  70.0    0.45
 17       2   0.1    1234  70.1    0.49
 16       3   0.2    1237  70.3    0.57
 15       4   0.2    1241  70.5    0.69
 14       5   0.3    1246  70.8    0.89
 13       5   0.3    1251  71.1    1.14
 12       3   0.2    1254  71.2    1.33
 11       2   0.1    1256  71.4    1.49
 10       2   0.1    1258  71.5    1.69
  9       1   0.1    1259  71.5    1.82
  7       3   0.2    1262  71.7    2.42
  6       2   0.1    1264  71.8    2.92
 -1     496  28.2    1760 100.0  498.92   (quality -1 = terminal quality 0)

Avg. full length: 1760.0, trimmed (qual > -1): 1264.0
Avg. quality: 33.4 per base

Initial, terminal qual 0 segments:  1-42, 1307-1760

Regions of LLR- adjusted quality < 2.0:
1-43, 67-73, 121-127, 696, 708-709, 711-712, 746-749, 783-787, 
1283-1284, 1288-1290, 1292-1294, 1296-1301, 1303-1760, 

13 regions, avg size 41.8, avg spacing 135.4

First_start: 233, last_end: 948

Slack, # used pairs (max_score), unused
 0     1  ( 4.8)     0 ( 0.0)        2
 1     1  ( 0.8)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
 1761 - right        0+      ca010109r1   ( 668)    No           1092+

Bottom strand: 
 left - right     1760+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56    431    431   1585 (100.00)     0  0    0   0   0   0     0 (0.00)    0   15 (0.95)
51     50    481   1154 ( 72.81)     0  0    0   0   0   0     0 (0.00)    0   15 (1.30)
50    129    610   1104 ( 69.65)     0  0    0   0   0   0     0 (0.00)    0   15 (1.36)
48      5    615    975 ( 61.51)     0  0    0   0   0   0     0 (0.00)    0   15 (1.54)
47     11    626    970 ( 61.20)     0  0    0   0   0   0     0 (0.00)    0   15 (1.55)
46     23    649    959 ( 60.50)     0  0    0   0   0   0     0 (0.00)    0   15 (1.56)
45      2    651    936 ( 59.05)     0  0    0   0   0   0     0 (0.00)    0   15 (1.60)
44     76    727    934 ( 58.93)     0  0    0   0   0   0     0 (0.00)    0   15 (1.61)
43     50    777    858 ( 54.13)     0  0    0   0   0   0     0 (0.00)    0   15 (1.75)
42    175    952    808 ( 50.98)     0  0    0   0   0   0     0 (0.00)    0   15 (1.86)
41      8    960    633 ( 39.94)     0  0    0   0   0   0     0 (0.00)    0   15 (2.37)
40     91   1051    625 ( 39.43)     3  0    0   0   0   0     0 (0.00)    0   15 (2.40)
39      3   1054    534 ( 33.69)     0  0    0   0   0   0     0 (0.00)    0   15 (2.81)
38      5   1059    531 ( 33.50)     0  0    0   0   0   0     0 (0.00)    0   15 (2.82)
37     35   1094    526 ( 33.19)     2  0    0   0   0   0     0 (0.00)    0   15 (2.85)
36      3   1097    491 ( 30.98)     0  0    0   0   0   0     0 (0.00)    0   15 (3.05)
35     30   1127    488 ( 30.79)     0  0    0   0   0   0     0 (0.00)    0   15 (3.07)
34     25   1152    458 ( 28.90)     0  0    0   0   0   0     0 (0.00)    0   15 (3.28)
33     21   1173    433 ( 27.32)     1  0    0   0   0   0     0 (0.00)    0   15 (3.46)
32     12   1185    412 ( 25.99)     1  0    0   0   0   0     0 (0.00)    0   15 (3.64)
31      9   1194    400 ( 25.24)     0  0    0   0   0   0     0 (0.00)    0   15 (3.75)
30     11   1205    391 ( 24.67)     0  0    0   0   0   0     0 (0.00)    0   15 (3.84)
29     26   1231    380 ( 23.97)     1  0    0   0   0   0     0 (0.00)    0   15 (3.95)
28      9   1240    354 ( 22.33)     0  0    0   0   0   0     0 (0.00)    0   15 (4.24)
27      8   1248    345 ( 21.77)     0  0    0   0   0   0     0 (0.00)    0   15 (4.35)
26      4   1252    337 ( 21.26)     0  0    0   0   0   0     0 (0.00)    0   15 (4.45)
25     15   1267    333 ( 21.01)     1  0    0   0   0   0     0 (0.00)    0   15 (4.50)
24      4   1271    318 ( 20.06)     1  0    0   0   0   0     0 (0.00)    0   15 (4.72)
23      8   1279    314 ( 19.81)     1  0    0   0   0   0     0 (0.00)    0   15 (4.78)
22     11   1290    306 ( 19.31)     1  0    0   0   0   0     0 (0.00)    0   15 (4.90)
21      6   1296    295 ( 18.61)     0  0    0   0   0   0     0 (0.00)    0   15 (5.08)
20      7   1303    289 ( 18.23)     4  0    0   0   0   0     0 (0.00)    0   15 (5.19)
19     16   1319    282 ( 17.79)     2  0    0   0   0   0     0 (0.00)    0   15 (5.32)
18     13   1332    266 ( 16.78)     0  0    0   0   0   0     0 (0.00)    0   15 (5.64)
17     10   1342    253 ( 15.96)     0  0    0   0   0   0     0 (0.00)    0   15 (5.93)
16     15   1357    243 ( 15.33)     0  0    0   0   0   0     0 (0.00)    0   15 (6.17)
15     14   1371    228 ( 14.38)     2  0    0   0   0   0     0 (0.00)    0   15 (6.58)
14     14   1385    214 ( 13.50)     0  0    0   0   0   0     0 (0.00)    0   15 (7.01)
13     12   1397    200 ( 12.62)     0  0    0   0   0   0     0 (0.00)    0   15 (7.50)
12     18   1415    188 ( 11.86)     0  0    0   0   0   0     0 (0.00)    0   15 (7.98)
11     14   1429    170 ( 10.73)     1  0    0   0   0   0     0 (0.00)    0   15 (8.82)
10     34   1463    156 (  9.84)     2  0    0   2   0   2     4 (11.76)    4   15 (9.62)
 9     31   1494    122 (  7.70)     4  0    0   1   0   0     1 (3.23)    5   11 (9.02)
 8     39   1533     91 (  5.74)     0  0    0   1   3   0     4 (10.26)    9   10 (10.99)
 7     43   1576     52 (  3.28)     0  0    0   2   4   0     6 (13.95)   15    6 (11.54)
 6      9   1585      9 (  0.57)     0  0    0   0   0   0     0 (0.00)   15    0 (0.00)
-1    453   2038      0 (  0.00)  1046  0    0   0   0   0     0 (0.00)   15    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
66     44     44   1542 (100.00)     0  0    0   0   0   0     0 (0.00)    0   15 (0.97)
61     13     57   1498 ( 97.15)     0  0    0   0   0   0     0 (0.00)    0   15 (1.00)
60      7     64   1485 ( 96.30)     0  0    0   0   0   0     0 (0.00)    0   15 (1.01)
57      1     65   1478 ( 95.85)     0  0    0   0   0   0     0 (0.00)    0   15 (1.01)
56    444    509   1477 ( 95.78)     0  0    0   0   0   0     0 (0.00)    0   15 (1.02)
55      1    510   1033 ( 66.99)     0  0    0   0   0   0     0 (0.00)    0   15 (1.45)
54      5    515   1032 ( 66.93)     0  0    0   0   0   0     0 (0.00)    0   15 (1.45)
53      6    521   1027 ( 66.60)     0  0    0   0   0   0     0 (0.00)    0   15 (1.46)
52      9    530   1021 ( 66.21)     0  0    0   0   0   0     0 (0.00)    0   15 (1.47)
51     51    581   1012 ( 65.63)     0  0    0   0   0   0     0 (0.00)    0   15 (1.48)
50    160    741    961 ( 62.32)     0  0    0   0   0   0     0 (0.00)    0   15 (1.56)
48      5    746    801 ( 51.95)     0  0    0   0   0   0     0 (0.00)    0   15 (1.87)
47     20    766    796 ( 51.62)     0  0    0   0   0   0     0 (0.00)    0   15 (1.88)
46     24    790    776 ( 50.32)     0  0    0   0   0   0     0 (0.00)    0   15 (1.93)
45      2    792    752 ( 48.77)     0  0    0   0   0   0     0 (0.00)    0   15 (1.99)
44     81    873    750 ( 48.64)     0  0    0   0   0   0     0 (0.00)    0   15 (2.00)
43     53    926    669 ( 43.39)     0  0    0   0   0   0     0 (0.00)    0   15 (2.24)
42    175   1101    616 ( 39.95)     0  0    0   0   0   0     0 (0.00)    0   15 (2.44)
41     13   1114    441 ( 28.60)     0  0    0   0   0   0     0 (0.00)    0   15 (3.40)
40     74   1188    428 ( 27.76)     0  0    0   0   0   0     0 (0.00)    0   15 (3.50)
39      7   1195    354 ( 22.96)     0  0    0   0   0   0     0 (0.00)    0   15 (4.24)
38      5   1200    347 ( 22.50)     0  0    0   0   0   0     0 (0.00)    0   15 (4.32)
37     29   1229    342 ( 22.18)     0  0    0   0   0   0     0 (0.00)    0   15 (4.39)
36      2   1231    313 ( 20.30)     0  0    0   0   0   0     0 (0.00)    0   15 (4.79)
35     27   1258    311 ( 20.17)     0  0    0   0   0   0     0 (0.00)    0   15 (4.82)
34     17   1275    284 ( 18.42)     0  0    0   0   0   0     0 (0.00)    0   15 (5.28)
33     15   1290    267 ( 17.32)     0  0    0   0   0   0     0 (0.00)    0   15 (5.62)
32      9   1299    252 ( 16.34)     0  0    0   0   0   0     0 (0.00)    0   15 (5.95)
31      7   1306    243 ( 15.76)     0  0    0   0   0   0     0 (0.00)    0   15 (6.17)
30     10   1316    236 ( 15.30)     0  0    0   0   0   0     0 (0.00)    0   15 (6.36)
29     14   1330    226 ( 14.66)     0  0    0   0   0   0     0 (0.00)    0   15 (6.64)
28      8   1338    212 ( 13.75)     0  0    0   0   0   0     0 (0.00)    0   15 (7.08)
27      5   1343    204 ( 13.23)     0  0    0   0   0   0     0 (0.00)    0   15 (7.35)
26      3   1346    199 ( 12.91)     0  0    0   0   0   0     0 (0.00)    0   15 (7.54)
25     25   1371    196 ( 12.71)     0  0    0   0   0   0     0 (0.00)    0   15 (7.65)
24      7   1378    171 ( 11.09)     0  0    0   0   0   0     0 (0.00)    0   15 (8.77)
23      8   1386    164 ( 10.64)     0  0    0   0   0   0     0 (0.00)    0   15 (9.15)
22      8   1394    156 ( 10.12)     0  0    0   0   0   0     0 (0.00)    0   15 (9.62)
21      5   1399    148 (  9.60)     0  0    0   0   0   0     0 (0.00)    0   15 (10.14)
20      3   1402    143 (  9.27)     0  0    0   0   0   0     0 (0.00)    0   15 (10.49)
19     12   1414    140 (  9.08)     0  0    0   0   0   0     0 (0.00)    0   15 (10.71)
18      7   1421    128 (  8.30)     0  0    0   0   0   0     0 (0.00)    0   15 (11.72)
17      4   1425    121 (  7.85)     0  0    0   0   0   0     0 (0.00)    0   15 (12.40)
16      3   1428    117 (  7.59)     0  0    0   0   0   0     0 (0.00)    0   15 (12.82)
15      5   1433    114 (  7.39)     0  0    0   0   0   0     0 (0.00)    0   15 (13.16)
14      6   1439    109 (  7.07)     0  0    0   0   0   0     0 (0.00)    0   15 (13.76)
13      7   1446    103 (  6.68)     0  0    0   0   0   0     0 (0.00)    0   15 (14.56)
12      6   1452     96 (  6.23)     0  0    0   0   0   0     0 (0.00)    0   15 (15.62)
11     12   1464     90 (  5.84)     0  0    0   0   0   0     0 (0.00)    0   15 (16.67)
10     15   1479     78 (  5.06)     0  0    0   2   0   2     4 (26.67)    4   15 (19.23)
 9     19   1498     63 (  4.09)     0  0    0   1   0   0     1 (5.26)    5   11 (17.46)
 8     17   1515     44 (  2.85)     0  0    0   1   3   0     4 (23.53)    9   10 (22.73)
 7     23   1538     27 (  1.75)     0  0    0   2   4   0     6 (26.09)   15    6 (22.22)
 6      4   1542      4 (  0.26)     0  0    0   0   0   0     0 (0.00)   15    0 (0.00)
-1    496   2038      0 (  0.00)  1073  0    0   0   0   0     0 (0.00)   15    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0     496      496        2
  6       2      498        3
  7       3      501        4
  9       1      502        4
 10       2      504        4
 11       2      506        5
 12       3      509        6
 13       5      514       10
 14       5      519       11
 15       4      523       11
 16       3      526       12
 17       2      528       12
 18       6      534       11
 19       9      543       13
 20       3      546       14
 21       3      549       12
 22       5      554       13
 23       4      558       13
 24       2      560       13
 25       6      566       11
 26       1      567       11
 27       4      571       11
 28       7      578       13
 29      12      590       14
 30       9      599       19
 31       7      606       17
 32       9      615       18
 33      15      630       21
 34      14      644       21
 35      26      670       25
 36       2      672       25
 37      24      696       28
 38       5      701       29
 39       4      705       30
 40      66      771       28
 41      11      782       30
 42     165      947       71
 43      46      993       79
 44      76     1069       90
 45       1     1070       89
 46      23     1093       88
 47      17     1110       86
 48       5     1115       84
 50     145     1260       78
 51      39     1299       67
 52       5     1304       68
 53       4     1308       70
 54       3     1311       68
 55       1     1312       67
 56     400     1712       11
 57       1     1713       11
 60       4     1717       12
 61      11     1728       10
 66      32     1760        1

SS region: 1760 (100.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0)     1-  948 [19.4] (0,0)     dh120109r1         47-1000 | 47 1000 | DA:(**47 278**)(**320 762**) || local(+/-) (4.8,0.0), distant (8.5,0.7)
(0, 0)   717- 1760 [12.8] (0,0)     ca010109r1         50-1093 | 50 640 | DA:(**282 640**) || local(+/-) (4.8,0.0), distant (0.0,0.0)

Gaps in unique-read coverage:   S 233- 716

Contig 11.  3 reads; 48 bp (untrimmed), 0 (trimmed).  Isolated contig.
     -1  1007 ag010109r1     39 (  0)  0.00 0.00 0.00    9 (  9)  959 (959) 
      0  1072 dc090109r1     33 (  0)  0.00 0.00 0.00   15 ( 15) 1024 (1024) 
      1  1085 cd060109r1     41 (  0)  0.00 0.00 2.08    0 (  7) 1037 (1037) 

Overall discrep rates (%):             0.00 0.00 0.81

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 -1      48 100.0      48 100.0   48.00   (quality -1 = terminal quality 0)

Avg. full length: 48.0, trimmed (qual > -1): 0.0
Avg. quality: 0.0 per base

Initial, terminal qual 0 segments:  1-48, (None)

Regions of LLR- adjusted quality < 2.0:
1-48, 

1 regions, avg size 48.0, avg spacing 48.0

First_start: 8, last_end: 48

Slack, # used pairs (max_score), unused
 0     2  ( 0.0)     0 ( 0.0)        3
 1     1  ( 0.0)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
   49 - right        0+      cd060109r1   (   1)    No             47+

Bottom strand: 
 left - right       48+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56      0      0    115 (100.00)     0  0    0   0   0   0     0 (0.00)    0    1 (0.87)
50      0      0    115 (100.00)     0  0    0   0   0   0     0 (0.00)    0    1 (0.87)
48      2      2    115 (100.00)     0  0    0   0   0   0     0 (0.00)    0    1 (0.87)
46      1      3    113 ( 98.26)     0  0    0   0   0   0     0 (0.00)    0    1 (0.88)
44      2      5    112 ( 97.39)     0  0    0   0   0   0     0 (0.00)    0    1 (0.89)
43      0      5    110 ( 95.65)     0  0    0   0   0   0     0 (0.00)    0    1 (0.91)
42      0      5    110 ( 95.65)     0  0    0   0   0   0     0 (0.00)    0    1 (0.91)
40      9     14    110 ( 95.65)     0  0    0   0   0   0     0 (0.00)    0    1 (0.91)
33      1     15    101 ( 87.83)     0  0    0   0   0   0     0 (0.00)    0    1 (0.99)
32      1     16    100 ( 86.96)     0  0    0   0   0   0     0 (0.00)    0    1 (1.00)
28      1     17     99 ( 86.09)     0  0    0   0   0   0     0 (0.00)    0    1 (1.01)
27      5     22     98 ( 85.22)     0  0    0   0   0   0     0 (0.00)    0    1 (1.02)
26      2     24     93 ( 80.87)     0  0    0   0   0   0     0 (0.00)    0    1 (1.08)
25      6     30     91 ( 79.13)     0  0    0   0   0   0     0 (0.00)    0    1 (1.10)
24      1     31     85 ( 73.91)     0  0    0   0   0   0     0 (0.00)    0    1 (1.18)
22      1     32     84 ( 73.04)     0  0    0   0   0   0     0 (0.00)    0    1 (1.19)
21      2     34     83 ( 72.17)     0  0    0   0   0   0     0 (0.00)    0    1 (1.20)
20      3     37     81 ( 70.43)     0  0    0   0   0   0     0 (0.00)    0    1 (1.23)
19      9     46     78 ( 67.83)     0  0    0   0   0   0     0 (0.00)    0    1 (1.28)
18      5     51     69 ( 60.00)     0  0    0   0   0   0     0 (0.00)    0    1 (1.45)
17      1     52     64 ( 55.65)     0  0    0   0   0   0     0 (0.00)    0    1 (1.56)
16      3     55     63 ( 54.78)     0  0    0   0   0   0     0 (0.00)    0    1 (1.59)
15      5     60     60 ( 52.17)     0  0    0   0   0   0     0 (0.00)    0    1 (1.67)
14      7     67     55 ( 47.83)     0  0    0   0   0   0     0 (0.00)    0    1 (1.82)
13     11     78     48 ( 41.74)     0  0    0   0   0   1     1 (9.09)    1    1 (2.08)
12      1     79     37 ( 32.17)     0  0    0   0   0   0     0 (0.00)    1    0 (0.00)
10      9     88     36 ( 31.30)     1  0    0   0   0   0     0 (0.00)    1    0 (0.00)
 9      7     95     27 ( 23.48)     0  0    0   0   0   0     0 (0.00)    1    0 (0.00)
 8      6    101     20 ( 17.39)     4  0    0   0   0   0     0 (0.00)    1    0 (0.00)
 7     10    111     14 ( 12.17)     2  0    0   0   0   0     0 (0.00)    1    0 (0.00)
 6      4    115      4 (  3.48)     1  0    0   0   0   0     0 (0.00)    1    0 (0.00)
 0      0    115      0 (  0.00)     0  0    0   0   0   0     0 (0.00)    1    0 (0.00)
-1      7    122      0 (  0.00)    13  0    0   0   0   0     0 (0.00)    1    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
-1    122    122      0 (  0.00)    21  0    0   0   0   1     1 (0.82)    1    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      48       48        1

SS region: 48 (100.00%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality):
    13  D     cd060109r1      (0)/(0)  11 GCCG / GCG

0 HQ discrepancies in 0 reads.
1 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:  None.

Contig 12.  4 reads; 365 bp (untrimmed), 365 (trimmed).
C  -701   379 bd080109f1    328 (320)  1.10 0.00 0.28  702 (702)   16 ( 16) 
C  -653   375 db110109f1    328 (321)  1.11 0.28 0.00  654 (654)   15 ( 17) 
   -118  1039 bd080109r1    329 (216)  1.64 0.00 0.00  119 (119)  674 (674) 
    -45   978 db110109r1    341 (225)  0.55 0.00 0.00   46 ( 46)  613 (613) 

Overall discrep rates (%):             1.10 0.07 0.07

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90     294  80.5     294  80.5    0.00
 89       1   0.3     295  80.8    0.00
 88       2   0.5     297  81.4    0.00
 86       1   0.3     298  81.6    0.00
 85       1   0.3     299  81.9    0.00
 84       2   0.5     301  82.5    0.00
 81      15   4.1     316  86.6    0.00
 79       1   0.3     317  86.8    0.00
 76       9   2.5     326  89.3    0.00
 75       2   0.5     328  89.9    0.00
 66      23   6.3     351  96.2    0.00
 61       3   0.8     354  97.0    0.00
 60       2   0.5     356  97.5    0.00
 56       7   1.9     363  99.5    0.00
 44       1   0.3     364  99.7    0.00
 42       1   0.3     365 100.0    0.00   (quality -1 = terminal quality 0)

Avg. full length: 365.0, trimmed (qual > -1): 365.0
Avg. quality: 86.3 per base

Initial, terminal qual 0 segments:  (None), (None)

Regions of LLR- adjusted quality < 2.0:


1 regions, avg size 0.0, avg spacing 365.0

First_start: 1, last_end: 365

Slack, # used pairs (max_score), unused
 0     6  ( 8.0)     0 ( 0.0)        6

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
  366 - right        0+      db110109r1   ( -45)    No            410+

Bottom strand: 
 left -     0        0+      db110109f1   ( 375)    Yes           375+
  364 - right        2+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56    571    571   1453 (100.00)     0  0    0   0   0   0     0 (0.00)    0   18 (1.24)
51    117    688    882 ( 60.70)     0  0    0   0   0   0     0 (0.00)    0   18 (2.04)
50    101    789    765 ( 52.65)     0  0    0   0   0   0     0 (0.00)    0   18 (2.35)
48      6    795    664 ( 45.70)     0  0    0   0   0   0     0 (0.00)    0   18 (2.71)
47     10    805    658 ( 45.29)     0  0    0   0   0   0     0 (0.00)    0   18 (2.74)
46     46    851    648 ( 44.60)     0  0    0   0   0   0     0 (0.00)    0   18 (2.78)
45     15    866    602 ( 41.43)     0  0    0   0   0   0     0 (0.00)    0   18 (2.99)
44     69    935    587 ( 40.40)     0  0    0   0   0   0     0 (0.00)    0   18 (3.07)
43     23    958    518 ( 35.65)     0  0    0   0   0   0     0 (0.00)    0   18 (3.47)
42     88   1046    495 ( 34.07)     0  0    0   0   0   0     0 (0.00)    0   18 (3.64)
41     10   1056    407 ( 28.01)     0  0    0   0   0   0     0 (0.00)    0   18 (4.42)
40     70   1126    397 ( 27.32)     0  0    0   0   0   0     0 (0.00)    0   18 (4.53)
39      1   1127    327 ( 22.51)     0  0    0   0   0   0     0 (0.00)    0   18 (5.50)
38      2   1129    326 ( 22.44)     0  0    0   0   0   0     0 (0.00)    0   18 (5.52)
37     38   1167    324 ( 22.30)     0  0    0   0   0   0     0 (0.00)    0   18 (5.56)
36      0   1167    286 ( 19.68)     0  0    0   0   0   0     0 (0.00)    0   18 (6.29)
35     32   1199    286 ( 19.68)     0  0    0   0   0   0     0 (0.00)    0   18 (6.29)
34     17   1216    254 ( 17.48)     0  0    0   0   0   0     0 (0.00)    0   18 (7.09)
33     12   1228    237 ( 16.31)     0  0    0   0   0   0     0 (0.00)    0   18 (7.59)
32     14   1242    225 ( 15.49)     0  0    0   0   0   0     0 (0.00)    0   18 (8.00)
31      7   1249    211 ( 14.52)     0  0    0   0   0   0     0 (0.00)    0   18 (8.53)
30      4   1253    204 ( 14.04)     0  0    0   0   0   0     0 (0.00)    0   18 (8.82)
29     32   1285    200 ( 13.76)     0  0    0   0   0   0     0 (0.00)    0   18 (9.00)
28     12   1297    168 ( 11.56)     0  0    0   0   0   0     0 (0.00)    0   18 (10.71)
27      7   1304    156 ( 10.74)     0  0    0   0   0   0     0 (0.00)    0   18 (11.54)
26      3   1307    149 ( 10.25)     0  0    0   0   0   0     0 (0.00)    0   18 (12.08)
25     11   1318    146 ( 10.05)     0  0    0   0   0   0     0 (0.00)    0   18 (12.33)
24     13   1331    135 (  9.29)     0  0    0   0   0   0     0 (0.00)    0   18 (13.33)
23     12   1343    122 (  8.40)     0  0    0   0   0   0     0 (0.00)    0   18 (14.75)
22      6   1349    110 (  7.57)     0  0    0   0   0   0     0 (0.00)    0   18 (16.36)
21      4   1353    104 (  7.16)     0  0    0   0   0   0     0 (0.00)    0   18 (17.31)
20      6   1359    100 (  6.88)     0  0    0   0   0   0     0 (0.00)    0   18 (18.00)
19      2   1361     94 (  6.47)     0  0    0   0   0   0     0 (0.00)    0   18 (19.15)
18      2   1363     92 (  6.33)     0  0    0   0   0   0     0 (0.00)    0   18 (19.57)
17      4   1367     90 (  6.19)     0  0    0   0   0   0     0 (0.00)    0   18 (20.00)
16      6   1373     86 (  5.92)     0  0    0   0   0   0     0 (0.00)    0   18 (20.93)
15      9   1382     80 (  5.51)     0  0    0   1   0   0     1 (11.11)    1   18 (22.50)
14      7   1389     71 (  4.89)     0  0    0   0   0   0     0 (0.00)    1   17 (23.94)
13      6   1395     64 (  4.40)     0  0    0   0   0   0     0 (0.00)    1   17 (26.56)
12      2   1397     58 (  3.99)     0  0    0   1   0   0     1 (50.00)    2   17 (29.31)
11     10   1407     56 (  3.85)     0  0    0   1   0   0     1 (10.00)    3   16 (28.57)
10      7   1414     46 (  3.17)     0  0    0   0   0   0     0 (0.00)    3   15 (32.61)
 9      9   1423     39 (  2.68)     0  0    0   2   0   0     2 (22.22)    5   15 (38.46)
 8     15   1438     30 (  2.06)     2  0    0   6   0   1     7 (46.67)   12   13 (43.33)
 7      4   1442     15 (  1.03)     1  0    0   1   0   0     1 (25.00)   13    6 (40.00)
 6      5   1447     11 (  0.76)     4  0    0   3   0   0     3 (60.00)   16    5 (45.45)
 4      4   1451      6 (  0.41)     0  0    0   0   0   0     0 (0.00)   16    2 (33.33)
 0      2   1453      2 (  0.14)     0  0    1   0   1   0     2 (100.00)   18    2 (100.00)
-1      0   1453      0 (  0.00)     0  0    0   0   0   0     0 (0.00)   18    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90   1148   1148   1451 (100.00)     0  0    0   0   0   0     0 (0.00)    0   17 (1.17)
89      4   1152    303 ( 20.88)     0  0    0   0   0   0     0 (0.00)    0   17 (5.61)
88      4   1156    299 ( 20.61)     0  0    0   0   0   0     0 (0.00)    0   17 (5.69)
86      4   1160    295 ( 20.33)     0  0    0   0   0   0     0 (0.00)    0   17 (5.76)
85      3   1163    291 ( 20.06)     0  0    0   0   0   0     0 (0.00)    0   17 (5.84)
84      6   1169    288 ( 19.85)     0  0    0   0   0   0     0 (0.00)    0   17 (5.90)
81     32   1201    282 ( 19.43)     0  0    0   0   0   0     0 (0.00)    0   17 (6.03)
79      3   1204    250 ( 17.23)     0  0    0   0   0   0     0 (0.00)    0   17 (6.80)
77      2   1206    247 ( 17.02)     0  0    0   0   0   0     0 (0.00)    0   17 (6.88)
76     19   1225    245 ( 16.88)     0  0    0   0   0   0     0 (0.00)    0   17 (6.94)
75      4   1229    226 ( 15.58)     0  0    0   0   0   0     0 (0.00)    0   17 (7.52)
66     52   1281    222 ( 15.30)     0  0    0   0   0   0     0 (0.00)    0   17 (7.66)
65      4   1285    170 ( 11.72)     0  0    0   0   0   0     0 (0.00)    0   17 (10.00)
62      2   1287    166 ( 11.44)     0  0    0   0   0   0     0 (0.00)    0   17 (10.24)
61      6   1293    164 ( 11.30)     0  0    0   0   0   0     0 (0.00)    0   17 (10.37)
60      4   1297    158 ( 10.89)     0  0    0   0   0   0     0 (0.00)    0   17 (10.76)
59      2   1299    154 ( 10.61)     0  0    0   0   0   0     0 (0.00)    0   17 (11.04)
58      1   1300    152 ( 10.48)     0  0    0   0   0   0     0 (0.00)    0   17 (11.18)
57      7   1307    151 ( 10.41)     0  0    0   0   0   0     0 (0.00)    0   17 (11.26)
56     13   1320    144 (  9.92)     0  0    0   0   0   0     0 (0.00)    0   17 (11.81)
55      2   1322    131 (  9.03)     0  0    0   0   0   0     0 (0.00)    0   17 (12.98)
54      4   1326    129 (  8.89)     0  0    0   0   0   0     0 (0.00)    0   17 (13.18)
53      5   1331    125 (  8.61)     0  0    0   0   0   0     0 (0.00)    0   17 (13.60)
52      4   1335    120 (  8.27)     0  0    0   0   0   0     0 (0.00)    0   17 (14.17)
50      6   1341    116 (  7.99)     0  0    0   0   0   0     0 (0.00)    0   17 (14.66)
49      4   1345    110 (  7.58)     0  0    0   0   0   0     0 (0.00)    0   17 (15.45)
48      7   1352    106 (  7.31)     0  0    0   0   0   0     0 (0.00)    0   17 (16.04)
47      1   1353     99 (  6.82)     0  0    0   0   0   0     0 (0.00)    0   17 (17.17)
46      1   1354     98 (  6.75)     0  0    0   0   0   0     0 (0.00)    0   17 (17.35)
45      1   1355     97 (  6.69)     0  0    0   0   0   0     0 (0.00)    0   17 (17.53)
44      3   1358     96 (  6.62)     0  0    0   0   0   0     0 (0.00)    0   17 (17.71)
42      4   1362     93 (  6.41)     0  0    0   0   0   0     0 (0.00)    0   17 (18.28)
41      2   1364     89 (  6.13)     0  0    0   0   0   0     0 (0.00)    0   17 (19.10)
40      6   1370     87 (  6.00)     0  0    0   0   0   0     0 (0.00)    0   17 (19.54)
39      1   1371     81 (  5.58)     0  0    0   0   0   0     0 (0.00)    0   17 (20.99)
38      1   1372     80 (  5.51)     0  0    0   0   0   0     0 (0.00)    0   17 (21.25)
36      1   1373     79 (  5.44)     0  0    0   0   0   0     0 (0.00)    0   17 (21.52)
35      2   1375     78 (  5.38)     0  0    0   0   0   0     0 (0.00)    0   17 (21.79)
33      1   1376     76 (  5.24)     0  0    0   0   0   0     0 (0.00)    0   17 (22.37)
32      1   1377     75 (  5.17)     0  0    0   0   0   0     0 (0.00)    0   17 (22.67)
31      2   1379     74 (  5.10)     0  0    0   0   0   0     0 (0.00)    0   17 (22.97)
29      2   1381     72 (  4.96)     0  0    0   0   0   0     0 (0.00)    0   17 (23.61)
25      1   1382     70 (  4.82)     0  0    0   0   0   0     0 (0.00)    0   17 (24.29)
23      1   1383     69 (  4.76)     0  0    0   0   0   0     0 (0.00)    0   17 (24.64)
22      1   1384     68 (  4.69)     0  0    0   0   0   0     0 (0.00)    0   17 (25.00)
21      2   1386     67 (  4.62)     0  0    0   0   0   0     0 (0.00)    0   17 (25.37)
20      2   1388     65 (  4.48)     0  0    0   0   0   0     0 (0.00)    0   17 (26.15)
19      1   1389     63 (  4.34)     0  0    0   0   0   0     0 (0.00)    0   17 (26.98)
17      1   1390     62 (  4.27)     0  0    0   0   0   0     0 (0.00)    0   17 (27.42)
16      3   1393     61 (  4.20)     0  0    0   0   0   0     0 (0.00)    0   17 (27.87)
15      5   1398     58 (  4.00)     0  0    0   1   0   0     1 (20.00)    1   17 (29.31)
14      4   1402     53 (  3.65)     0  0    0   0   0   0     0 (0.00)    1   16 (30.19)
13      3   1405     49 (  3.38)     0  0    0   0   0   0     0 (0.00)    1   16 (32.65)
12      2   1407     46 (  3.17)     0  0    0   1   0   0     1 (50.00)    2   16 (34.78)
11      6   1413     44 (  3.03)     0  0    0   1   0   0     1 (16.67)    3   15 (34.09)
10      4   1417     38 (  2.62)     0  0    0   0   0   0     0 (0.00)    3   14 (36.84)
 9      8   1425     34 (  2.34)     0  0    0   2   0   0     2 (25.00)    5   14 (41.18)
 8     14   1439     26 (  1.79)     0  0    0   6   0   1     7 (50.00)   12   12 (46.15)
 7      3   1442     12 (  0.83)     0  0    0   1   0   0     1 (33.33)   13    5 (41.67)
 6      5   1447      9 (  0.62)     0  0    0   3   0   0     3 (60.00)   16    4 (44.44)
 4      3   1450      4 (  0.28)     0  0    0   0   0   0     0 (0.00)   16    1 (25.00)
 0      1   1451      1 (  0.07)     0  0    0   0   1   0     1 (100.00)   17    1 (100.00)
-1      2   1453      0 (  0.00)     7  0    1   0   0   0     1 (50.00)   18    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
 42       1        1        1
 44       1        2        1
 56       7        9        2
 60       2       11        4
 61       3       14        5
 66      23       37        5
 75       2       39        5
 76       9       48        7
 79       1       49        7
 81      15       64        6
 84       2       66        8
 85       1       67        8
 86       1       68        9
 88       2       70        9
 89       1       71       10
 90     294      365        1

SS region: 2 (0.55%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem: None.

Gaps in unique-read coverage:   E 1- 365

Contig 13.  5 reads; 1414 bp (untrimmed), 1236 (trimmed).
      1  1070 ab090109f1    606 ( 93)  2.64 2.26 0.00    0 (1088)  274 (1087) 
    238  1274 bb020109f1    881 (  0)  1.09 0.79 0.10   22 ( 56)    2 (  2) 
    244  1290 aa060109f1    823 (  0)  1.26 0.95 0.00   50 ( 50)   46 ( 76) 
    368  1414 cd110109f1    950 (  0)  0.20 0.00 0.00   26 ( 26)    0 (142) 
    796  1877 dh100109r1     44 (  0)  13.51 2.70 0.00  216 (216)  755 (827) 

Overall discrep rates (%):             1.57 0.98 0.03

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 66     603  42.6     603  42.6    0.00
 61     110   7.8     713  50.4    0.00
 60      14   1.0     727  51.4    0.00
 57       2   0.1     729  51.6    0.00
 56      54   3.8     783  55.4    0.00
 55       3   0.2     786  55.6    0.00
 54       8   0.6     794  56.2    0.00
 53      23   1.6     817  57.8    0.00
 52      27   1.9     844  59.7    0.00
 51       5   0.4     849  60.0    0.00
 50      16   1.1     865  61.2    0.00
 48       5   0.4     870  61.5    0.00
 47       9   0.6     879  62.2    0.00
 46       3   0.2     882  62.4    0.00
 45       6   0.4     888  62.8    0.00
 44      26   1.8     914  64.6    0.00
 43       5   0.4     919  65.0    0.00
 42      55   3.9     974  68.9    0.01
 41       6   0.4     980  69.3    0.01
 40      59   4.2    1039  73.5    0.01
 38       2   0.1    1041  73.6    0.01
 37       3   0.2    1044  73.8    0.01
 35       5   0.4    1049  74.2    0.02
 34       5   0.4    1054  74.5    0.02
 33       5   0.4    1059  74.9    0.02
 32       9   0.6    1068  75.5    0.03
 31       2   0.1    1070  75.7    0.03
 29      17   1.2    1087  76.9    0.05
 28       4   0.3    1091  77.2    0.05
 27       6   0.4    1097  77.6    0.07
 26       2   0.1    1099  77.7    0.07
 25      20   1.4    1119  79.1    0.13
 24      10   0.7    1129  79.8    0.17
 23      11   0.8    1140  80.6    0.23
 22      11   0.8    1151  81.4    0.30
 21       6   0.4    1157  81.8    0.35
 20       6   0.4    1163  82.2    0.41
 19       6   0.4    1169  82.7    0.48
 18       3   0.2    1172  82.9    0.53
 17       2   0.1    1174  83.0    0.57
 16       8   0.6    1182  83.6    0.77
 15       4   0.3    1186  83.9    0.90
 14       2   0.1    1188  84.0    0.98
 13       4   0.3    1192  84.3    1.18
 12       9   0.6    1201  84.9    1.75
 11       3   0.2    1204  85.1    1.98
 10       8   0.6    1212  85.7    2.78
  9      11   0.8    1223  86.5    4.17
  8       9   0.6    1232  87.1    5.59
  7       1   0.1    1233  87.2    5.79
  4       3   0.2    1236  87.4    6.99
 -1     178  12.6    1414 100.0  184.99   (quality -1 = terminal quality 0)

Avg. full length: 1414.0, trimmed (qual > -1): 1236.0
Avg. quality: 46.9 per base

Initial, terminal qual 0 segments:  1-36, 1273-1414

Regions of LLR- adjusted quality < 2.0:
1-36, 62-67, 83-88, 120-125, 1181, 1183-1184, 1189-1191, 1193-1194, 
1199, 1203, 1216-1223, 1228, 1230-1232, 1237-1244, 1246-1251, 1254-1414, 


16 regions, avg size 15.7, avg spacing 88.4

First_start: 294, last_end: 1272

Slack, # used pairs (max_score), unused
 0     1  (19.2)     0 ( 0.0)        9
 1     7  (21.2)     0 ( 0.0)        0
 2     1  (18.6)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
 1415 - right        0+      dh100109r1   ( 796)    No            618+

Bottom strand: 
 left - right     1414+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56   1098   1098   3678 (100.00)     0  0    0   0   0   0     0 (0.00)    0   80 (2.18)
51    237   1335   2580 ( 70.15)     0  0    0   0   0   0     0 (0.00)    0   80 (3.10)
50    133   1468   2343 ( 63.70)     0  0    0   0   0   0     0 (0.00)    0   80 (3.41)
48     16   1484   2210 ( 60.09)     0  0    0   0   0   0     0 (0.00)    0   80 (3.62)
47     32   1516   2194 ( 59.65)     0  0    0   0   0   0     0 (0.00)    0   80 (3.65)
46     47   1563   2162 ( 58.78)     0  0    0   0   0   0     0 (0.00)    0   80 (3.70)
45     34   1597   2115 ( 57.50)     0  0    0   0   0   0     0 (0.00)    0   80 (3.78)
44    115   1712   2081 ( 56.58)     0  0    0   0   0   0     0 (0.00)    0   80 (3.84)
43     71   1783   1966 ( 53.45)     0  0    0   0   0   0     0 (0.00)    0   80 (4.07)
42    239   2022   1895 ( 51.52)     0  0    0   0   0   0     0 (0.00)    0   80 (4.22)
41     16   2038   1656 ( 45.02)     0  0    0   0   0   0     0 (0.00)    0   80 (4.83)
40    155   2193   1640 ( 44.59)     0  0    0   0   0   0     0 (0.00)    0   80 (4.88)
39     14   2207   1485 ( 40.38)     0  0    0   0   0   0     0 (0.00)    0   80 (5.39)
38     11   2218   1471 ( 39.99)     0  0    0   0   0   0     0 (0.00)    0   80 (5.44)
37     41   2259   1460 ( 39.70)     0  0    0   0   0   0     0 (0.00)    0   80 (5.48)
36      6   2265   1419 ( 38.58)     0  0    0   0   0   0     0 (0.00)    0   80 (5.64)
35     49   2314   1413 ( 38.42)     0  0    0   0   0   0     0 (0.00)    0   80 (5.66)
34     25   2339   1364 ( 37.09)     0  0    0   0   0   0     0 (0.00)    0   80 (5.87)
33     30   2369   1339 ( 36.41)     0  0    0   0   0   0     0 (0.00)    0   80 (5.97)
32     31   2400   1309 ( 35.59)     0  0    0   0   0   0     0 (0.00)    0   80 (6.11)
31     18   2418   1278 ( 34.75)     0  0    0   0   0   0     0 (0.00)    0   80 (6.26)
30     15   2433   1260 ( 34.26)     0  0    0   0   0   0     0 (0.00)    0   80 (6.35)
29     76   2509   1245 ( 33.85)     0  0    0   0   0   0     0 (0.00)    0   80 (6.43)
28     20   2529   1169 ( 31.78)     0  0    0   0   0   0     0 (0.00)    0   80 (6.84)
27     32   2561   1149 ( 31.24)     1  0    0   0   0   0     0 (0.00)    0   80 (6.96)
26      9   2570   1117 ( 30.37)     0  0    0   0   0   0     0 (0.00)    0   80 (7.16)
25     61   2631   1108 ( 30.13)     2  0    0   0   0   0     0 (0.00)    0   80 (7.22)
24     30   2661   1047 ( 28.47)     0  0    0   0   0   0     0 (0.00)    0   80 (7.64)
23     17   2678   1017 ( 27.65)     0  0    0   0   0   0     0 (0.00)    0   80 (7.87)
22     38   2716   1000 ( 27.19)     0  0    0   0   0   0     0 (0.00)    0   80 (8.00)
21     27   2743    962 ( 26.16)     0  0    0   0   1   0     1 (3.70)    1   80 (8.32)
20     28   2771    935 ( 25.42)     1  0    0   0   0   0     0 (0.00)    1   79 (8.45)
19     49   2820    907 ( 24.66)     0  0    0   0   1   0     1 (2.04)    2   79 (8.71)
18     20   2840    858 ( 23.33)     2  0    0   0   0   0     0 (0.00)    2   78 (9.09)
17     42   2882    838 ( 22.78)     0  0    0   0   1   0     1 (2.38)    3   78 (9.31)
16     26   2908    796 ( 21.64)     2  0    0   1   0   0     1 (3.85)    4   77 (9.67)
15     52   2960    770 ( 20.94)     1  0    0   1   0   0     1 (1.92)    5   76 (9.87)
14     39   2999    718 ( 19.52)     0  0    0   1   0   0     1 (2.56)    6   75 (10.45)
13     62   3061    679 ( 18.46)     1  0    0   1   0   0     1 (1.61)    7   74 (10.90)
12     40   3101    617 ( 16.78)     4  0    0   0   0   0     0 (0.00)    7   73 (11.83)
11     82   3183    577 ( 15.69)     2  0    0   5   1   0     6 (7.32)   13   73 (12.65)
10     95   3278    495 ( 13.46)     3  0    0   8   3   0    11 (11.58)   24   67 (13.54)
 9    151   3429    400 ( 10.88)    15  0    0  11   3   0    14 (9.27)   38   56 (14.00)
 8    109   3538    249 (  6.77)     8  0    0   4   4   0     8 (7.34)   46   42 (16.87)
 7     90   3628    140 (  3.81)     3  0    0  13   8   1    22 (24.44)   68   34 (24.29)
 6     47   3675     50 (  1.36)     0  0    0   5   7   0    12 (25.53)   80   12 (24.00)
 4      3   3678      3 (  0.08)     0  0    0   0   0   0     0 (0.00)   80    0 (0.00)
-1    251   3929      0 (  0.00)   883  0    0  11   7   0    18 (7.17)   98    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
66   1944   1944   3495 (100.00)     0  0    0   0   0   0     0 (0.00)    0   45 (1.29)
61    328   2272   1551 ( 44.38)     0  0    0   0   0   0     0 (0.00)    0   45 (2.90)
60     31   2303   1223 ( 34.99)     0  0    0   0   0   0     0 (0.00)    0   45 (3.68)
57      2   2305   1192 ( 34.11)     0  0    0   0   0   0     0 (0.00)    0   45 (3.78)
56    102   2407   1190 ( 34.05)     0  0    0   0   0   0     0 (0.00)    0   45 (3.78)
55      7   2414   1088 ( 31.13)     0  0    0   0   0   0     0 (0.00)    0   45 (4.14)
54     25   2439   1081 ( 30.93)     0  0    0   0   0   0     0 (0.00)    0   45 (4.16)
53     73   2512   1056 ( 30.21)     0  0    0   0   0   0     0 (0.00)    0   45 (4.26)
52     66   2578    983 ( 28.13)     0  0    0   0   0   0     0 (0.00)    0   45 (4.58)
51     15   2593    917 ( 26.24)     0  0    0   0   0   0     0 (0.00)    0   45 (4.91)
50     25   2618    902 ( 25.81)     0  0    0   0   0   0     0 (0.00)    0   45 (4.99)
49      1   2619    877 ( 25.09)     0  0    0   0   0   0     0 (0.00)    0   45 (5.13)
48      8   2627    876 ( 25.06)     0  0    0   0   0   0     0 (0.00)    0   45 (5.14)
47     13   2640    868 ( 24.84)     0  0    0   0   0   0     0 (0.00)    0   45 (5.18)
46      6   2646    855 ( 24.46)     0  0    0   0   0   0     0 (0.00)    0   45 (5.26)
45     12   2658    849 ( 24.29)     0  0    0   0   0   0     0 (0.00)    0   45 (5.30)
44     28   2686    837 ( 23.95)     0  0    0   0   0   0     0 (0.00)    0   45 (5.38)
43      6   2692    809 ( 23.15)     0  0    0   0   0   0     0 (0.00)    0   45 (5.56)
42     74   2766    803 ( 22.98)     0  0    0   0   0   0     0 (0.00)    0   45 (5.60)
41      7   2773    729 ( 20.86)     0  0    0   0   0   0     0 (0.00)    0   45 (6.17)
40     80   2853    722 ( 20.66)     0  0    0   0   0   0     0 (0.00)    0   45 (6.23)
38      2   2855    642 ( 18.37)     0  0    0   0   0   0     0 (0.00)    0   45 (7.01)
37      8   2863    640 ( 18.31)     0  0    0   0   0   0     0 (0.00)    0   45 (7.03)
36      2   2865    632 ( 18.08)     0  0    0   0   0   0     0 (0.00)    0   45 (7.12)
35     10   2875    630 ( 18.03)     0  0    0   0   0   0     0 (0.00)    0   45 (7.14)
34      8   2883    620 ( 17.74)     0  0    0   0   0   0     0 (0.00)    0   45 (7.26)
33      6   2889    612 ( 17.51)     0  0    0   0   0   0     0 (0.00)    0   45 (7.35)
32     12   2901    606 ( 17.34)     0  0    0   0   0   0     0 (0.00)    0   45 (7.43)
31      4   2905    594 ( 17.00)     0  0    0   0   0   0     0 (0.00)    0   45 (7.58)
30      3   2908    590 ( 16.88)     0  0    0   0   0   0     0 (0.00)    0   45 (7.63)
29     36   2944    587 ( 16.80)     0  0    0   0   0   0     0 (0.00)    0   45 (7.67)
28     10   2954    551 ( 15.77)     0  0    0   0   0   0     0 (0.00)    0   45 (8.17)
27     18   2972    541 ( 15.48)     0  0    0   0   0   0     0 (0.00)    0   45 (8.32)
26      5   2977    523 ( 14.96)     0  0    0   0   0   0     0 (0.00)    0   45 (8.60)
25     86   3063    518 ( 14.82)     0  0    0   0   0   0     0 (0.00)    0   45 (8.69)
24     23   3086    432 ( 12.36)     0  0    0   0   0   0     0 (0.00)    0   45 (10.42)
23     20   3106    409 ( 11.70)     0  0    0   0   0   0     0 (0.00)    0   45 (11.00)
22     31   3137    389 ( 11.13)     0  0    0   0   0   0     0 (0.00)    0   45 (11.57)
21     15   3152    358 ( 10.24)     0  0    0   0   0   0     0 (0.00)    0   45 (12.57)
20     10   3162    343 (  9.81)     0  0    0   0   0   0     0 (0.00)    0   45 (13.12)
19     17   3179    333 (  9.53)     0  0    0   0   0   0     0 (0.00)    0   45 (13.51)
18      6   3185    316 (  9.04)     0  0    0   0   0   0     0 (0.00)    0   45 (14.24)
17      8   3193    310 (  8.87)     0  0    0   0   1   0     1 (12.50)    1   45 (14.52)
16     11   3204    302 (  8.64)     0  0    0   1   0   0     1 (9.09)    2   44 (14.57)
15     17   3221    291 (  8.33)     0  0    0   1   0   0     1 (5.88)    3   43 (14.78)
14     10   3231    274 (  7.84)     0  0    0   1   0   0     1 (10.00)    4   42 (15.33)
13     16   3247    264 (  7.55)     0  0    0   1   0   0     1 (6.25)    5   41 (15.53)
12     17   3264    248 (  7.10)     0  0    0   0   0   0     0 (0.00)    5   40 (16.13)
11     24   3288    231 (  6.61)     0  0    0   3   0   0     3 (12.50)    8   40 (17.32)
10     24   3312    207 (  5.92)     0  0    0   2   1   0     3 (12.50)   11   37 (17.87)
 9     58   3370    183 (  5.24)     0  0    0   3   0   0     3 (5.17)   14   34 (18.58)
 8     47   3417    125 (  3.58)     0  0    0   1   3   0     4 (8.51)   18   31 (24.80)
 7     52   3469     78 (  2.23)     0  0    0  12   5   1    18 (34.62)   36   27 (34.62)
 6     23   3492     26 (  0.74)     0  0    0   3   6   0     9 (39.13)   45    9 (34.62)
 4      3   3495      3 (  0.09)     0  0    0   0   0   0     0 (0.00)   45    0 (0.00)
-1    434   3929      0 (  0.00)   928  0    0  33  20   0    53 (12.21)   98    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0     178      178        2
  4       3      181        3
  7       1      182        4
  8       9      191        8
  9      11      202       11
 10       8      210       13
 11       3      213       14
 12       9      222       13
 13       4      226       13
 14       2      228       13
 15       4      232       14
 16       8      240       13
 17       2      242       14
 18       3      245       15
 19       6      251       16
 20       6      257       15
 21       6      263       13
 22      11      274       17
 23      11      285       17
 24      10      295       18
 25      20      315       14
 26       2      317       13
 27       6      323       11
 28       4      327       11
 29      17      344       11
 31       2      346       11
 32       9      355       12
 33       5      360       14
 34       5      365       12
 35       5      370        9
 37       3      373        9
 38       2      375       11
 40      59      434       16
 41       6      440       16
 42      55      495       26
 43       5      500       23
 44      26      526       24
 45       6      532       23
 46       3      535       20
 47       9      544       18
 48       5      549       16
 50      16      565       14
 51       5      570       15
 52      27      597       23
 53      23      620       29
 54       8      628       31
 55       3      631       32
 56      54      685       24
 57       2      687       24
 60      14      701       23
 61     110      811       29
 66     603     1414        1

SS region: 1414 (100.00%), flagged: 2 (0.14%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads): None.

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0)     1-  796 [12.9] (0,0)     ab090109f1         1-814 | 30 200  (260 734) | DA:(**30 200**) CHIMERIC || local(+/-) (10.1,0.0), distant (2.3,0.0)
(0, 0)  1012- 1122 [-0.4] (0,0)     dh100109r1         217-330 || local(+/-) (1.8,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -1.5 (<20 part: -1.5 (#=18), >20:0.0 (#=0); in HQ: -1.4, out HQ -0.1), match: 1.1  trail: 0.0  lead: 0.0  total: -0.4 

Gaps in unique-read coverage:  None.

Contig 14.  35 reads; 1843 bp (untrimmed), 1757 (trimmed).
   -170   883 cc010109r1     21 (  0)  24.46 3.55 0.39  362 (503)  185 (535) 
      1  1040 ad030109f1    898 (  0)  0.39 1.16 0.10    0 (130)    9 ( 28) 
C     2  1075 bd120109f1    203 (  0)  1.67 0.00 0.42  747 (747)   87 ( 81) 
    106  1127 bg020109f1    829 (  0)  0.64 0.64 0.00   25 ( 25)   56 ( 56) 
    217  1274 cg040109f1    911 (  0)  0.58 1.06 0.00   25 ( 25)    0 ( 19) 
    239  1297 db030109f1    865 (  0)  1.49 0.79 0.10   26 ( 26)   26 ( 34) 
    392  1449 cb070109r1    910 (  0)  0.50 0.10 0.10   45 ( 45)   10 ( 17) 
C   421  1483 cb070109f1    909 (  0)  0.59 0.59 0.10   18 ( 18)   24 ( 24) 
    430  1513 bg090109r1     55 (  0)  21.93 0.44 1.32  689 (307)  167 (720) 
    560  1645 cb080109r1     49 (  0)  25.28 0.75 0.00  601 (662)  220 (379) 
    594  1648 cb090109f1    934 (  0)  0.68 0.29 0.00   26 ( 26)    2 ( 29) 
    701  1716 bd120109r1    218 (  0)  0.41 0.00 0.00   48 ( 48)  725 (721) 
    750  1799 cc100109r1    185 (  0)  22.04 1.55 0.78   71 (633)   76 (391) 
C   790  1902 ab090109r1    187 (  0)  14.83 0.48 0.00  602 (646)   93 (135) 
C   823  1930 ad030109r1     77 (  0)  13.84 1.89 0.00  191 (191)  758 (758) 
C   838  1899 cb090109r1    207 (  0)  21.26 1.93 0.24   77 (277)  157 (461) 
C   839  1898 ah090109r1     45 (  0)  18.37 1.36 0.00  849 (916)   64 (116) 
C   848  1916 aa060109r1    618 (  0)  1.50 1.36 0.00   67 (126)  269 (273) 
C   860  1905 cd110109r1    125 (  0)  22.64 1.43 0.36   34 ( 33)  451 (770) 
C   859  1907 bb020109r1    510 (  0)  3.62 0.31 0.47    0 ( 35)  414 (428) 
C   863  1907 cg110109r1    103 (  0)  14.58 0.00 0.00  527 (522)  326 (415) 
C   935  1895 c03hba0141l10_t701  420 (  0)  2.09 6.96 0.42  191 (385)   52 ( 52) 
C   890  1951 bc120109r1     32 (  0)  19.35 1.08 0.00  138 (180)  831 (866) 
    922  1918 bc120109f1    825 (  0)  0.67 0.00 0.00   23 ( 23)   75 ( 79) 
C   967  1894 c03hba0141l10_t703  678 (  0)  3.88 1.03 0.34    0 (  0)   51 ( 51) 
C   975  1891 c03hba0141l10_t702  632 (  0)  3.26 1.75 0.70   10 (  6)   48 ( 48) 
   1151  2214 dc030109f1    610 (  0)  0.45 0.00 0.15   24 ( 23)  371 (371) 
   1200  2252 ad090109f1    560 (  0)  0.49 0.00 0.00   35 ( 35)  409 (409) 
   1303  2348 ab070109f1    478 (  0)  0.19 0.00 0.00   26 ( 26)  505 (505) 
C  1321  2374 ca060109f1    440 (  0)  1.72 0.19 0.57    1 ( 29)  531 (531) 
   1360  2404 cg110109f1    413 (  0)  0.66 0.00 0.00   30 ( 25)  561 (561) 
   1449  2533 dg080109f1    303 (  0)  2.70 0.54 0.00   25 ( 40)  690 (690) 
   1540  2573 ah090109f1    252 (  0)  0.00 0.00 0.36   24 ( 24)  730 (730) 
   1720  2798 ad080109f1     89 (  0)  1.04 0.00 0.00   28 ( 28)  955 (955) 
   1723  2808 ce080109f1     46 (  0)  13.10 0.00 0.00   28 ( 28)  974 (1008) 

Overall discrep rates (%):             5.51 1.01 0.20

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90    1165  63.2    1165  63.2    0.00
 88       6   0.3    1171  63.5    0.00
 87       3   0.2    1174  63.7    0.00
 86       4   0.2    1178  63.9    0.00
 85       6   0.3    1184  64.2    0.00
 84       6   0.3    1190  64.6    0.00
 83       2   0.1    1192  64.7    0.00
 82       5   0.3    1197  64.9    0.00
 81      19   1.0    1216  66.0    0.00
 80      10   0.5    1226  66.5    0.00
 79       4   0.2    1230  66.7    0.00
 78      11   0.6    1241  67.3    0.00
 77       4   0.2    1245  67.6    0.00
 76      14   0.8    1259  68.3    0.00
 75       8   0.4    1267  68.7    0.00
 74      17   0.9    1284  69.7    0.00
 73       4   0.2    1288  69.9    0.00
 72       1   0.1    1289  69.9    0.00
 70       1   0.1    1290  70.0    0.00
 69       2   0.1    1292  70.1    0.00
 68       4   0.2    1296  70.3    0.00
 66     320  17.4    1616  87.7    0.00
 61      74   4.0    1690  91.7    0.00
 56      14   0.8    1704  92.5    0.00
 55       6   0.3    1710  92.8    0.00
 53       3   0.2    1713  92.9    0.00
 51       9   0.5    1722  93.4    0.00
 50       2   0.1    1724  93.5    0.00
 48       1   0.1    1725  93.6    0.00
 47       2   0.1    1727  93.7    0.00
 46       6   0.3    1733  94.0    0.00
 45       2   0.1    1735  94.1    0.00
 44       1   0.1    1736  94.2    0.00
 42       4   0.2    1740  94.4    0.00
 40       4   0.2    1744  94.6    0.00
 37       1   0.1    1745  94.7    0.00
 33       3   0.2    1748  94.8    0.00
 32       3   0.2    1751  95.0    0.00
 30       2   0.1    1753  95.1    0.01
 27       1   0.1    1754  95.2    0.01
 24       2   0.1    1756  95.3    0.02
 19       1   0.1    1757  95.3    0.03
 -1      86   4.7    1843 100.0   86.03   (quality -1 = terminal quality 0)

Avg. full length: 1843.0, trimmed (qual > -1): 1757.0
Avg. quality: 78.1 per base

Initial, terminal qual 0 segments:  1-86, (None)

Regions of LLR- adjusted quality < 2.0:
1-87, 

2 regions, avg size 43.5, avg spacing 921.5

First_start: 131, last_end: 1843
 Unused pair: cb070109r1 cg110109r1  -7.3   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=3), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.1), match: 0.9  trail: 0.0  lead: -16.2  total: -15.4   37  6.00 0.00 0.00  cb070109r1      999  1048 (10)  C cg110109r1   (527)   518   469  
 Unused pair: cb070109f1 cg110109r1  -6.7   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: -16.2  lead: 0.0  total: -14.6   67  0.00 0.00 0.00  cb070109f1       25    94 (974)    cg110109r1      449   518 (527) *
 Unused pair: cc100109r1 cg110109r1  -6.4   2
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=22), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.5  trail: 0.0  lead: -13.6  total: -13.1   37 20.56 0.00 0.00  cc100109r1      646   752 (305)  C cg110109r1   (527)   518   412  
 Unused pair: bb020109r1 cg110109r1  -6.3   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=3), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 2.0  trail: -16.2  lead: 0.0  total: -14.2   87  3.00 0.00 0.00  bb020109r1      419   518 (530)    cg110109r1      419   518 (527) *
 Unused pair: c03hba0141l10_t701 cg110109r1  -6.0   1
LLR breakdown: discreps: -1.2 (<20 part: -1.2 (#=33), >20:0.0 (#=0); in HQ: 0.0, out HQ -1.2), match: 2.3  trail: -11.2  lead: 0.0  total: -10.1   77 15.10 1.04 1.04  c03hba0141l10_t701      314   505 (503)    cg110109r1      327   518 (527)  
 Unused pair: bc120109f1 bd120109r1  -7.3   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.0  trail: -12.2  lead: 0.0  total: -11.2   38  0.00 0.00 0.00  bc120109f1       24    70 (927)    bd120109r1      245   291 (725) *
 Unused pair: c03hba0141l10_t702 cg110109r1  -6.5   2
LLR breakdown: discreps: -1.2 (<20 part: -1.2 (#=8), >20:0.0 (#=0); in HQ: 0.0, out HQ -1.2), match: 2.2  trail: -11.3  lead: 0.0  total: -10.3   74  5.56 0.93 0.93  c03hba0141l10_t702      396   503 (423)    cg110109r1      411   518 (527)  
 Unused pair: ca060109f1 cg110109r1  -6.1   1
LLR breakdown: discreps: -0.9 (<20 part: -0.9 (#=33), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.9), match: 2.3  trail: -16.2  lead: 0.0  total: -14.8   80 16.75 0.52 0.00  ca060109f1      794   984 (68)    cg110109r1      327   518 (527)  

Slack, # used pairs (max_score), unused
 0   112  (21.8)     4 (-6.3)      278
 1    89  (19.9)     2 (-6.0)       25
 2    40  (21.7)     2 (-6.4)        1
 3    17  (18.3)     0 ( 0.0)        0
 4    12  (16.5)     0 ( 0.0)        0
 5     8  (18.2)     0 ( 0.0)        0
 6     6  ( 9.0)     0 ( 0.0)        0
 7     3  (13.6)     0 ( 0.0)        0
18     1  ( 0.7)     0 ( 0.0)        0
19     1  ( 0.7)     0 ( 0.0)        0
21     1  ( 0.7)     0 ( 0.0)        0
24     1  ( 0.7)     0 ( 0.0)        0
28     1  ( 0.7)     0 ( 0.0)        0
29     3  ( 0.7)     0 ( 0.0)        0
30     1  ( 0.7)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
 1844 - right        0+      ce080109f1   (1723)    No            120+

Bottom strand: 
 left -   438      438+      bd120109f1   (1075)    No           1075+
 1844 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56   5117   5117  19799 (100.00)    17  0    0   0   0   0     0 (0.00)    0  1228 (6.20)
51   1332   6449  14682 ( 74.16)     2  0    0   0   0   0     0 (0.00)    0  1228 (8.36)
50    471   6920  13350 ( 67.43)     2  0    0   0   0   0     0 (0.00)    0  1228 (9.20)
48    121   7041  12879 ( 65.05)     1  0    0   0   0   0     0 (0.00)    0  1228 (9.53)
47     85   7126  12758 ( 64.44)     1  0    0   0   0   0     0 (0.00)    0  1228 (9.63)
46    237   7363  12673 ( 64.01)     8  0    0   0   0   0     0 (0.00)    0  1228 (9.69)
45    209   7572  12436 ( 62.81)     0  0    0   0   0   0     0 (0.00)    0  1228 (9.87)
44    356   7928  12227 ( 61.76)    10  0    0   0   0   0     0 (0.00)    0  1228 (10.04)
43    229   8157  11871 ( 59.96)    13  0    0   0   0   0     0 (0.00)    0  1228 (10.34)
42    571   8728  11642 ( 58.80)    19  0    0   0   0   0     0 (0.00)    0  1228 (10.55)
41     44   8772  11071 ( 55.92)     1  0    0   0   0   0     0 (0.00)    0  1228 (11.09)
40    682   9454  11027 ( 55.69)     4  0    0   0   0   0     0 (0.00)    0  1228 (11.14)
39     69   9523  10345 ( 52.25)     4  0    0   0   0   0     0 (0.00)    0  1228 (11.87)
38     23   9546  10276 ( 51.90)     0  0    0   0   0   0     0 (0.00)    0  1228 (11.95)
37    200   9746  10253 ( 51.79)     3  0    0   0   0   0     0 (0.00)    0  1228 (11.98)
36     31   9777  10053 ( 50.78)     0  0    0   0   0   0     0 (0.00)    0  1228 (12.22)
35    165   9942  10022 ( 50.62)     0  0    0   0   0   0     0 (0.00)    0  1228 (12.25)
34    155  10097   9857 ( 49.79)     0  0    0   0   0   0     0 (0.00)    0  1228 (12.46)
33     97  10194   9702 ( 49.00)     2  0    0   0   0   0     0 (0.00)    0  1228 (12.66)
32    204  10398   9605 ( 48.51)     1  0    0   0   0   0     0 (0.00)    0  1228 (12.79)
31     64  10462   9401 ( 47.48)     3  0    0   0   0   0     0 (0.00)    0  1228 (13.06)
30     19  10481   9337 ( 47.16)     0  0    0   0   0   0     0 (0.00)    0  1228 (13.15)
29    317  10798   9318 ( 47.06)    11  0    0   0   0   1     1 (0.32)    1  1228 (13.18)
28     70  10868   9001 ( 45.46)     1  0    0   0   0   0     0 (0.00)    1  1227 (13.63)
27    137  11005   8931 ( 45.11)     4  0    0   1   0   0     1 (0.73)    2  1227 (13.74)
26     35  11040   8794 ( 44.42)     1  0    0   0   0   0     0 (0.00)    2  1226 (13.94)
25    223  11263   8759 ( 44.24)     9  0    0   2   0   0     2 (0.90)    4  1226 (14.00)
24    139  11402   8536 ( 43.11)     5  0    0   1   1   0     2 (1.44)    6  1224 (14.34)
23     85  11487   8397 ( 42.41)     4  0    0   0   0   1     1 (1.18)    7  1222 (14.55)
22    120  11607   8312 ( 41.98)    11  0    0   2   0   0     2 (1.67)    9  1221 (14.69)
21    124  11731   8192 ( 41.38)    14  0    0   4   1   0     5 (4.03)   14  1219 (14.88)
20    148  11879   8068 ( 40.75)    12  0    0   1   1   0     2 (1.35)   16  1214 (15.05)
19    261  12140   7920 ( 40.00)    31  0    0   4   1   1     6 (2.30)   22  1212 (15.30)
18    168  12308   7659 ( 38.68)    30  0    0   3   1   0     4 (2.38)   26  1206 (15.75)
17    190  12498   7491 ( 37.84)    17  0    0   5   0   0     5 (2.63)   31  1202 (16.05)
16    225  12723   7301 ( 36.88)    32  0    0   6   2   0     8 (3.56)   39  1197 (16.40)
15    330  13053   7076 ( 35.74)    52  0    0  13   2   0    15 (4.55)   54  1189 (16.80)
14    337  13390   6746 ( 34.07)    60  0    0  23   4   1    28 (8.31)   82  1174 (17.40)
13    489  13879   6409 ( 32.37)    65  0    0  46   4   0    50 (10.22)  132  1146 (17.88)
12    476  14355   5920 ( 29.90)    61  0    0  41   4   2    47 (9.87)  179  1096 (18.51)
11    852  15207   5444 ( 27.50)   177  0    0 149   6   2   157 (18.43)  336  1049 (19.27)
10    959  16166   4592 ( 23.19)   101  0    0 149  17   5   171 (17.83)  507  892 (19.43)
 9   1278  17444   3633 ( 18.35)    74  0    0 190  13  13   216 (16.90)  723  721 (19.85)
 8   1050  18494   2355 ( 11.89)    79  0    0 155  35   6   196 (18.67)  919  505 (21.44)
 7    829  19323   1305 (  6.59)    38  0    0 131  33   4   168 (20.27)  1087  309 (23.68)
 6    440  19763    476 (  2.40)    19  0    0  89  37   1   127 (28.86)  1214  141 (29.62)
 4     32  19795     36 (  0.18)     2  0    0   7   3   0    10 (31.25)  1224   14 (38.89)
 0      4  19799      4 (  0.02)     0  0    2   0   2   0     4 (100.00)  1228    4 (100.00)
-1    530  20329      0 (  0.00)  8772  0    0  88  30   4   122 (23.02)  1350    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90  10835  10835  17213 (100.00)    13  0    0   0   0   0     0 (0.00)    0  578 (3.36)
88     13  10848   6378 ( 37.05)     0  0    0   0   0   0     0 (0.00)    0  578 (9.06)
87     11  10859   6365 ( 36.98)     0  0    0   0   0   0     0 (0.00)    0  578 (9.08)
86     10  10869   6354 ( 36.91)     0  0    0   0   0   0     0 (0.00)    0  578 (9.10)
85     31  10900   6344 ( 36.86)     0  0    0   0   0   0     0 (0.00)    0  578 (9.11)
84     12  10912   6313 ( 36.68)     0  0    0   0   0   0     0 (0.00)    0  578 (9.16)
83      4  10916   6301 ( 36.61)     0  0    0   0   0   0     0 (0.00)    0  578 (9.17)
82      6  10922   6297 ( 36.58)     0  0    0   0   0   0     0 (0.00)    0  578 (9.18)
81     98  11020   6291 ( 36.55)     0  0    0   0   0   0     0 (0.00)    0  578 (9.19)
80     16  11036   6193 ( 35.98)     0  0    0   0   0   0     0 (0.00)    0  578 (9.33)
79      5  11041   6177 ( 35.89)     0  0    0   0   0   0     0 (0.00)    0  578 (9.36)
78     12  11053   6172 ( 35.86)     0  0    0   0   0   0     0 (0.00)    0  578 (9.36)
77      4  11057   6160 ( 35.79)     0  0    0   0   0   0     0 (0.00)    0  578 (9.38)
76     24  11081   6156 ( 35.76)     0  0    0   0   0   0     0 (0.00)    0  578 (9.39)
75     10  11091   6132 ( 35.62)     0  0    0   0   0   0     0 (0.00)    0  578 (9.43)
74     17  11108   6122 ( 35.57)     0  0    0   0   0   0     0 (0.00)    0  578 (9.44)
73      9  11117   6105 ( 35.47)     0  0    0   0   0   0     0 (0.00)    0  578 (9.47)
72      2  11119   6096 ( 35.42)     0  0    0   0   0   0     0 (0.00)    0  578 (9.48)
71      2  11121   6094 ( 35.40)     0  0    0   0   0   0     0 (0.00)    0  578 (9.48)
70      1  11122   6092 ( 35.39)     0  0    0   0   0   0     0 (0.00)    0  578 (9.49)
69     10  11132   6091 ( 35.39)     0  0    0   0   0   0     0 (0.00)    0  578 (9.49)
68     10  11142   6081 ( 35.33)     0  0    0   0   0   0     0 (0.00)    0  578 (9.51)
67     29  11171   6071 ( 35.27)     2  0    0   0   0   0     0 (0.00)    0  578 (9.52)
66   1634  12805   6042 ( 35.10)     0  0    0   0   0   0     0 (0.00)    0  578 (9.57)
65     38  12843   4408 ( 25.61)     0  0    0   0   0   0     0 (0.00)    0  578 (13.11)
64      2  12845   4370 ( 25.39)     0  0    0   0   0   0     0 (0.00)    0  578 (13.23)
63      1  12846   4368 ( 25.38)     0  0    0   0   0   0     0 (0.00)    0  578 (13.23)
62      3  12849   4367 ( 25.37)     0  0    0   0   0   0     0 (0.00)    0  578 (13.24)
61    333  13182   4364 ( 25.35)     0  0    0   0   0   0     0 (0.00)    0  578 (13.24)
60     10  13192   4031 ( 23.42)     0  0    0   0   0   0     0 (0.00)    0  578 (14.34)
59      3  13195   4021 ( 23.36)     0  0    0   0   0   0     0 (0.00)    0  578 (14.37)
58     14  13209   4018 ( 23.34)     0  0    0   0   0   0     0 (0.00)    0  578 (14.39)
57     14  13223   4004 ( 23.26)     2  0    0   0   0   0     0 (0.00)    0  578 (14.44)
56     40  13263   3990 ( 23.18)     7  0    0   0   0   0     0 (0.00)    0  578 (14.49)
55     23  13286   3950 ( 22.95)     0  0    0   0   0   0     0 (0.00)    0  578 (14.63)
54     22  13308   3927 ( 22.81)     0  0    0   0   0   0     0 (0.00)    0  578 (14.72)
53     25  13333   3905 ( 22.69)     0  0    0   0   0   0     0 (0.00)    0  578 (14.80)
52     16  13349   3880 ( 22.54)     0  0    0   0   0   0     0 (0.00)    0  578 (14.90)
51     13  13362   3864 ( 22.45)     0  0    0   0   0   0     0 (0.00)    0  578 (14.96)
50     23  13385   3851 ( 22.37)     2  0    0   0   0   0     0 (0.00)    0  578 (15.01)
49     34  13419   3828 ( 22.24)     0  0    0   0   0   0     0 (0.00)    0  578 (15.10)
48     26  13445   3794 ( 22.04)     0  0    0   0   0   0     0 (0.00)    0  578 (15.23)
47     22  13467   3768 ( 21.89)     0  0    0   0   0   0     0 (0.00)    0  578 (15.34)
46     31  13498   3746 ( 21.76)     3  0    0   0   0   0     0 (0.00)    0  578 (15.43)
45     28  13526   3715 ( 21.58)     0  0    0   0   0   0     0 (0.00)    0  578 (15.56)
44     51  13577   3687 ( 21.42)     4  0    0   0   0   0     0 (0.00)    0  578 (15.68)
43     25  13602   3636 ( 21.12)     3  0    0   0   0   0     0 (0.00)    0  578 (15.90)
42     55  13657   3611 ( 20.98)     7  0    0   0   0   0     0 (0.00)    0  578 (16.01)
41     48  13705   3556 ( 20.66)     1  0    0   0   0   0     0 (0.00)    0  578 (16.25)
40    790  14495   3508 ( 20.38)     9  0    0   0   0   0     0 (0.00)    0  578 (16.48)
39     19  14514   2718 ( 15.79)     0  0    0   0   0   0     0 (0.00)    0  578 (21.27)
38      8  14522   2699 ( 15.68)     0  0    0   0   0   0     0 (0.00)    0  578 (21.42)
37     13  14535   2691 ( 15.63)     2  0    0   0   0   0     0 (0.00)    0  578 (21.48)
36     12  14547   2678 ( 15.56)     1  0    0   0   0   0     0 (0.00)    0  578 (21.58)
35     14  14561   2666 ( 15.49)     0  0    0   0   0   0     0 (0.00)    0  578 (21.68)
34     23  14584   2652 ( 15.41)     0  0    0   0   0   0     0 (0.00)    0  578 (21.79)
33     18  14602   2629 ( 15.27)     0  0    0   0   0   0     0 (0.00)    0  578 (21.99)
32     20  14622   2611 ( 15.17)     0  0    0   0   0   0     0 (0.00)    0  578 (22.14)
31      8  14630   2591 ( 15.05)     2  0    0   0   0   0     0 (0.00)    0  578 (22.31)
30      9  14639   2583 ( 15.01)     0  0    0   0   0   0     0 (0.00)    0  578 (22.38)
29     21  14660   2574 ( 14.95)     8  0    0   0   0   1     1 (4.76)    1  578 (22.46)
28      3  14663   2553 ( 14.83)     0  0    0   0   0   0     0 (0.00)    1  577 (22.60)
27     15  14678   2550 ( 14.81)     0  0    0   1   0   0     1 (6.67)    2  577 (22.63)
26      8  14686   2535 ( 14.73)     1  0    0   0   0   0     0 (0.00)    2  576 (22.72)
25     35  14721   2527 ( 14.68)     2  0    0   0   0   0     0 (0.00)    2  576 (22.79)
24     17  14738   2492 ( 14.48)     1  0    0   1   0   0     1 (5.88)    3  576 (23.11)
23     17  14755   2475 ( 14.38)     1  0    0   1   0   1     2 (11.76)    5  575 (23.23)
22     14  14769   2458 ( 14.28)     2  0    0   1   0   0     1 (7.14)    6  573 (23.31)
21     19  14788   2444 ( 14.20)     3  0    0   2   1   0     3 (15.79)    9  572 (23.40)
20     13  14801   2425 ( 14.09)     0  0    0   1   0   0     1 (7.69)   10  569 (23.46)
19     35  14836   2412 ( 14.01)     8  0    0   1   0   0     1 (2.86)   11  568 (23.55)
18     31  14867   2377 ( 13.81)     2  0    0   3   1   0     4 (12.90)   15  567 (23.85)
17     41  14908   2346 ( 13.63)     1  0    0   4   0   0     4 (9.76)   19  563 (24.00)
16     53  14961   2305 ( 13.39)     9  0    0   1   0   0     1 (1.89)   20  559 (24.25)
15     69  15030   2252 ( 13.08)    13  0    0   6   1   0     7 (10.14)   27  558 (24.78)
14     95  15125   2183 ( 12.68)     9  0    0  15   2   1    18 (18.95)   45  551 (25.24)
13    128  15253   2088 ( 12.13)    13  0    0  16   1   0    17 (13.28)   62  533 (25.53)
12    134  15387   1960 ( 11.39)     5  0    0  16   3   1    20 (14.93)   82  516 (26.33)
11    279  15666   1826 ( 10.61)    23  0    0  54   2   2    58 (20.79)  140  496 (27.16)
10    330  15996   1547 (  8.99)     9  0    0  66  12   4    82 (24.85)  222  438 (28.31)
 9    372  16368   1217 (  7.07)     3  0    0  63   6  11    80 (21.51)  302  356 (29.25)
 8    320  16688    845 (  4.91)     2  0    0  74  24   3   101 (31.56)  403  276 (32.66)
 7    311  16999    525 (  3.05)     0  0    0  70  24   3    97 (31.19)  500  175 (33.33)
 6    182  17181    214 (  1.24)     1  0    0  41  23   1    65 (35.71)  565   78 (36.45)
 4     28  17209     32 (  0.19)     0  0    0   7   2   0     9 (32.14)  574   13 (40.62)
 0      4  17213      4 (  0.02)     0  0    2   0   2   0     4 (100.00)  578    4 (100.00)
-1   3116  20329      0 (  0.00)  9599  0    0 666  93  13   772 (24.78)  1350    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      86       86        1
 19       1       87        1
 24       2       89        2
 27       1       90        3
 30       2       92        2
 32       3       95        2
 33       3       98        2
 37       1       99        3
 40       4      103        3
 42       4      107        5
 44       1      108        5
 45       2      110        5
 46       6      116        4
 47       2      118        5
 48       1      119        5
 50       2      121        4
 51       9      130        4
 53       3      133        6
 55       6      139        8
 56      14      153        8
 61      74      227       16
 66     320      547       10
 68       4      551       11
 69       2      553       12
 70       1      554       12
 72       1      555       13
 73       4      559       13
 74      17      576       16
 75       8      584       15
 76      14      598       18
 77       4      602       17
 78      11      613       17
 79       4      617       16
 80      10      627       18
 81      19      646       16
 82       5      651       15
 83       2      653       13
 84       6      659       10
 85       6      665       10
 86       4      669       10
 87       3      672        9
 88       6      678        9
 90    1165     1843        1

SS region: 438 (23.77%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads):
  454     -4.9  [-2.5,  0.0]  (2, 0)
 1460     -3.2  [-3.2,  0.0]  (0, 1)

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(364, 382)  1119- 1346 [ 0.0] (0,0)     bg090109r1         690-915 || local(+/-) (0.7,0.7), distant (0.0,0.0)
(0, 0)   749-  991 [-15.8] (16,4)     bd120109r1         49-291 || local(+/-) (5.2,0.7), distant (0.0,0.0)
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 5.4  trail: -21.1  lead: 0.0  total: -15.8 
(0, 0)   821- 1723 [-1.8] (0,0)     cc100109r1         72-981 || local(+/-) (12.8,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -4.1 (<20 part: -4.1 (#=220), >20:0.0 (#=0); in HQ: 0.0, out HQ -4.1), match: 2.2  trail: 0.0  lead: 0.0  total: -1.9 
(0, 0)   915- 1742 [-1.8] (0,0)   C cb090109r1         999-158 || local(+/-) (13.6,2.0), distant (0.0,0.0)
LLR breakdown: discreps: -8.0 (<20 part: -8.0 (#=194), >20:0.0 (#=0); in HQ: 0.0, out HQ -8.0), match: 6.2  trail: 0.0  lead: 0.0  total: -1.8 
(0, 0)  1688- 1834 [-0.8] (0,0)   C ah090109r1         213-65 || local(+/-) (0.0,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -2.1 (<20 part: -2.1 (#=29), >20:0.0 (#=0); in HQ: 0.0, out HQ -2.1), match: 1.2  trail: 0.0  lead: 0.0  total: -0.9 
(0, 1)   894- 1454 [-7.7] (143,0)   C cd110109r1         1018-452 || local(+/-) (9.7,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -17.1 (<20 part: -17.1 (#=137), >20:0.0 (#=0); in HQ: 0.0, out HQ -17.1), match: 9.6  trail: -0.2  lead: -0.1  total: -7.8 
Bypassed: (13, 5)  1390- 1581 [-14.3] (0,0)   C cg110109r1         518-327 || local(+/-) (2.4,2.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=28), >20:0.0 (#=0); in HQ: -0.5, out HQ 0.0), match: 2.4  trail: 0.0  lead: -16.2  total: -14.3 

Gaps in unique-read coverage:  None.

Contig 15.  141 reads; 14642 bp (untrimmed), 13704 (trimmed).
C  -180   991 bf040109f1     60 (  0)  0.00 1.43 0.00 1073 (1073)   29 ( 25) 
C   -84   983 ad120109f1     53 (  0)  2.99 1.49 0.00  977 (988)   24 ( 24) 
    -64   955 ad020109f1     36 (  0)  7.94 3.17 0.00  957 (957)    0 ( 38) 
     -4  1006 bd110109f1     53 (  0)  8.11 6.31 0.00  898 (903)    2 ( 38) 
C     1  1158 dc070109f1    880 (  0)  4.94 0.00 0.00    0 (892)   25 ( 24) 
     42  1097 cc070109r1    142 (  0)  2.19 2.19 0.00  851 (851)   22 ( 22) 
C   164  1194 ad020109r1    240 (  0)  0.39 0.00 0.00  729 (729)   47 ( 47) 
    175  1241 de060109r1    264 (  0)  2.96 2.37 0.00  718 (718)   11 ( 30) 
    297  1363 df080109r1    354 (  0)  0.48 1.94 0.00  596 (596)   58 ( 58) 
    368  1421 cf070109r1    428 (  0)  1.76 1.37 0.20  525 (525)   18 ( 96) 
    456  1544 cc080109r1    466 (  0)  1.14 0.76 0.00  437 (437)  126 (130) 
    528  1567 bc070109r1    487 (  0)  1.66 2.65 0.00  365 (365)   71 (126) 
    684  1714 bc100109r1    672 (  0)  1.56 1.17 0.00  209 (209)   53 (118) 
C   793  1878 cc080109f1    867 (  0)  0.96 0.11 0.00  100 ( 99)   52 ( 87) 
    803  1841 bd100109r1    852 (  0)  1.29 0.00 0.11   90 ( 89)   20 ( 12) 
    884  1710 c03hba0141l10_sp601  362 (  0)  12.24 2.69 1.22    9 (  9)    1 ( 18) 
    886  1722 c03hba0141l10_sp602  596 (  0)  6.27 1.33 0.24    8 (  8)    0 (  0) 
    883  1731 c03hba0141l10_sp603  767 (  0)  1.55 0.12 0.00   10 ( 17)    1 (  0) 
    904  1951 ab010109f1    613 (  0)  4.89 1.67 0.12   56 (102)  154 (300) 
    908  1898 ab110109r1    833 (  0)  0.64 1.39 0.00   47 ( 47)    9 ( 31) 
    922  1941 bh060109r1    845 (  0)  2.08 0.10 0.42   50 ( 50)   10 ( 44) 
   1002  2027 da030109f1    915 (  0)  0.50 0.50 0.30   25 ( 25)    3 (  0) 
   1113  2176 dc080109f1    939 (  0)  0.87 0.87 0.00   24 ( 24)    4 ( 38) 
C  1135  2144 ag110109r1    129 (  0)  0.72 0.00 0.00  826 (826)   46 ( 46) 
   1181  2188 aa100109r1    857 (  0)  1.57 0.21 0.21   51 ( 51)    1 (  1) 
   1195  2228 cf020109r1    894 (  0)  1.42 0.30 0.00   45 ( 45)    3 (  0) 
   1196  2302 de010109r1    221 (  0)  3.49 0.00 0.00   47 ( 47)  802 (802) 
   1213  2233 af090109r1    851 (  0)  1.54 1.03 0.00   49 ( 49)    1 ( 34) 
   1238  2252 dc120109r1    822 (  0)  2.07 1.03 0.21   48 ( 48)    0 ( 53) 
   1268  2329 ce030109f1    949 (  0)  0.49 0.49 0.00   27 ( 27)   14 (  9) 
C  1281  2368 cb040109r1     70 (  0)  0.00 0.00 0.00  967 (952)   47 ( 47) 
   1316  2363 cg030109f1    932 (  0)  0.69 0.69 0.00   25 ( 25)    5 (  5) 
   1346  2384 ae060109f1    857 (  0)  1.30 1.70 0.00   25 ( 25)   15 ( 61) 
   1362  2393 ac010109f1    823 (  0)  0.22 1.83 0.00   26 ( 26)   78 (125) 
C  1510  2564 df080109f1    941 (  0)  0.98 0.39 0.00    7 (  7)   24 ( 24) 
C  1514  2571 de060109f1    921 (  0)  1.16 0.68 0.10    0 ( 61)   23 ( 23) 
C  1575  2635 cc070109f1    924 (  0)  0.88 0.49 0.19    9 (  9)   26 ( 22) 
C  1606  2622 bd110109r1    875 (  0)  0.83 0.52 0.00    2 ( 15)   50 ( 50) 
C  1622  2616 ab110109f1    859 (  0)  0.83 0.93 0.00    3 (  3)   29 ( 29) 
   1727  2789 cd050109r1    915 (  0)  0.79 0.88 0.10   46 ( 46)    0 ( 43) 
   1743  2796 dd030109r1    916 (  0)  0.99 0.60 0.00   46 ( 46)    1 ( 57) 
C  1811  2875 ca070109f1    461 (  0)  4.99 1.72 0.62  400 (489)   24 ( 24) 
   1950  2968 ag110109f1    122 (  0)  0.00 1.46 0.00   12 ( 12)  870 (870) 
   1998  3009 af110109r1    881 (  0)  0.62 0.62 0.00   47 ( 47)    2 (  2) 
   2039  3063 dc110109r1    893 (  0)  0.92 0.10 0.31   50 ( 50)    1 ( 32) 
C  2069  3134 ab010109r1    510 (  0)  6.09 2.30 0.00  252 (327)   75 (139) 
   2210  3251 cf100109r1    922 (  0)  1.11 0.20 0.00   46 ( 46)    5 ( 37) 
   2224  3312 cb040109f1     63 (  0)  0.00 1.41 0.00   27 ( 10)  991 (991) 
C  2241  3305 ce030109r1    905 (  0)  0.91 0.30 0.20   35 ( 63)   46 ( 46) 
   2304  3331 dd120109f1    752 (  0)  0.76 0.00 0.00   93 ( 93)  143 (143) 
C  2341  3382 bc070109f1    916 (  0)  0.59 1.09 0.10    4 ( 13)   28 ( 28) 
C  2357  3399 bd100109f1    880 (  0)  1.29 1.39 0.10   17 ( 90)   21 ( 21) 
C  2416  3460 cf020109f1    920 (  0)  0.90 0.80 0.00   14 ( 24)   28 ( 24) 
   2443  3461 ag090109f1    916 (  0)  1.11 0.30 0.20   27 ( 26)    0 (  0) 
   2479  3524 ae070109f1    917 (  0)  1.19 0.50 0.30   27 ( 18)    9 ( 12) 
   2481  3542 cg090109r1    748 (  0)  2.99 1.00 0.33   51 ( 51)  108 (193) 
   2482  3556 de050109f1    953 (  0)  0.20 0.50 0.00   24 ( 15)   51 ( 40) 
   2488  3518 ca050109r1    900 (  0)  0.31 0.82 0.21   47 ( 47)   13 (  1) 
C  2503  3523 ac010109r1    856 (  0)  1.04 1.45 0.10    8 ( 85)   48 ( 48) 
C  2509  3537 bc100109f1    910 (  0)  0.90 0.80 0.20    2 (  2)   28 ( 27) 
C  2516  3523 aa100109f1    903 (  0)  0.61 0.72 0.20    6 (  6)   24 ( 24) 
   2534  3575 ae120109r1    661 (  0)  2.29 1.53 0.00   46 ( 46)  210 (329) 
   2571  3605 bc090109f1    895 (  0)  1.46 0.10 0.00   27 ( 27)   48 ( 96) 
C  2760  3799 bh060109f1    832 (  0)  1.53 0.66 0.11   99 (118)   26 ( 18) 
C  2771  3800 dc120109f1    870 (  0)  1.74 0.82 0.20   25 ( 54)   26 ( 18) 
C  2791  3819 da030109r1    915 (  0)  1.33 0.31 0.00    7 ( 24)   47 ( 47) 
C  2860  3907 ca050109f1    918 (269)  0.41 0.71 0.10   41 ( 37)   24 ( 24) 
C  2891  3974 da090109f1    497 (128)  7.57 3.28 0.00  151 (252)  140 (187) 
   2886  3958 ce040109f1    930 (  0)  0.88 1.26 0.00   25 ( 24)   20 (  4) 
C  2891  3952 cf070109f1    903 (  0)  1.14 0.10 0.21   10 (  4)   84 ( 84) 
   2942  4045 df010109r1    596 (  0)  6.18 1.26 0.00   52 ( 52)  259 (361) 
   2946  3982 dg020109r1    888 (  0)  0.41 1.23 0.10   47 ( 47)   17 ( 17) 
C  2986  4053 dc080109r1    933 (268)  0.78 0.78 0.10    0 ( 36)   48 ( 48) 
C  3064  4120 dd030109f1    966 (237)  0.48 0.48 0.00    3 ( 22)   23 ( 23) 
C  3094  4124 ag090109r1    878 (173)  0.82 1.03 0.00    9 ( 62)   51 ( 51) 
   3100  4107 af010109r1    834 (190)  0.55 0.99 0.00   52 ( 52)   45 ( 63) 
   3144  4198 df090109f1    853 (107)  1.57 0.31 0.21   81 ( 81)   20 ( 44) 
C  3170  4235 ae060109r1    807 (  0)  0.77 1.42 0.00  103 (138)   50 ( 50) 
C  3195  4228 af090109f1    862 ( 47)  0.42 1.25 0.10   45 ( 65)   26 ( 26) 
C  3270  4285 af110109f1    896 ( 38)  1.21 0.30 0.10    0 ( 27)   25 ( 25) 
C  3319  4360 dc110109f1    929 (  0)  0.59 0.39 0.10    5 (  1)   24 ( 24) 
   3326  4427 dc040109f1    962 (  0)  0.37 1.02 0.00   23 ( 20)    5 (  4) 
C  3363  4493 de020109f1    199 (  0)  17.84 0.90 0.36  389 (580)  187 (279) 
   3389  4446 bc080109f1    838 (  0)  1.23 1.23 0.00   27 ( 27)   57 ( 31) 
C  3439  4496 cf100109f1    893 (  0)  1.09 0.69 0.10   20 ( 40)   26 ( 26) 
C  3452  4487 de010109f1    874 (  0)  0.50 1.11 0.00   17 ( 59)   25 ( 25) 
   3463  4525 cb030109f1    881 (  0)  0.20 1.50 0.00   26 ( 26)   35 ( 35) 
C  3531  4599 cd050109f1    936 (  0)  0.96 0.48 0.10    4 ( 37)   23 ( 23) 
   3610  4617 bb120109f1    274 (267)  0.33 0.00 0.33   42 ( 42)  663 (663) 
C  3973  5038 ce040109r1    896 (  0)  0.79 0.20 0.29    3 ( 11)   46 ( 46) 
C  3991  5042 bc090109r1    812 (  0)  0.83 1.46 0.00   25 ( 25)   65 ( 65) 
C  4019  5077 cg090109f1    856 (  0)  0.78 1.46 0.10    5 ( 69)   26 ( 26) 
C  4047  5105 ae070109r1    814 (  0)  1.61 1.11 0.10   16 ( 44)   50 ( 50) 
C  4217  5237 ae120109f1    821 (  0)  0.93 0.72 0.21   19 ( 45)   35 ( 35) 
C  4244  5306 df090109r1    839 (  0)  1.11 0.91 0.00   21 ( 53)   52 ( 52) 
C  4643  5694 bc080109r1    799 (  0)  1.83 0.51 0.20   18 ( 86)   51 ( 51) 
   5034  6065 ae020109f1    857 (  0)  0.92 0.72 0.00   24 ( 24)   30 ( 30) 
C  5395  6396 af010109f1    865 (  0)  1.23 0.51 0.00    0 ( 32)   25 ( 25) 
C  5408  6467 cb030109r1    906 (  0)  1.09 0.30 0.10    3 (  8)   45 ( 45) 
   5817  6852 ce110109r1    829 (177)  0.83 1.04 0.00   49 ( 49)   25 ( 35) 
C  5838  6876 ae020109r1    823 (231)  0.61 1.92 0.00    3 ( 69)   46 ( 46) 
C  5956  7075 dc040109r1    962 (321)  0.38 0.47 0.09    7 (  7)   47 ( 41) 
C  6290  7495 df010109f1    312 ( 88)  7.49 3.56 0.00  403 (554)  269 (299) 
C  6420  7458 dg020109f1    928 (319)  1.08 0.00 0.10    0 ( 16)   24 ( 24) 
   6871  7965 bc050109f1    799 ( 32)  0.21 2.47 0.00   25 ( 25)  138 (554) 
   7443  8505 ad060109f1    912 (  0)  0.40 0.71 0.10   24 ( 75)   49 ( 86) 
   7476  8531 ag060109f1    810 (  0)  1.29 1.40 0.00   42 ( 42)   86 (114) 
C  7512  8565 ce110109f1    814 (  0)  0.33 1.75 0.00   34 ( 84)  107 (107) 
C  7826  8909 ad060109r1    880 (  0)  0.72 0.72 0.20   56 ( 56)   52 ( 50) 
   7936  8985 ab050109r1    884 (  0)  0.93 0.21 0.00   46 ( 46)   41 ( 41) 
   8252  9349 bf090109f1    763 (  0)  1.25 0.34 0.34   86 ( 86)  129 (106) 
   8637  9685 be060109f1    773 (  0)  1.13 2.37 0.00   32 ( 32)   45 (124) 
C  8793  9853 bc050109r1    584 (  0)  4.60 2.81 0.22  123 (277)   47 ( 47) 
   8861  9917 ch090109f1    819 (  0)  1.69 1.20 0.00   26 ( 26)   27 ( 87) 
   8968 10031 be090109f1    804 (  0)  1.13 1.33 0.10   32 ( 25)   58 (109) 
   8969 10016 bf110109f1    632 (  0)  3.97 0.70 0.47   27 ( 25)  165 (178) 
   9284 10336 db100109f1    849 (  0)  1.13 0.51 0.00   27 ( 27)   50 (112) 
   9355 10438 be110109r1    597 (  0)  3.01 1.18 0.00   67 ( 67)  254 (290) 
C  9380 10473 bf090109r1    733 (  0)  2.03 1.01 0.11   96 ( 96)  111 (111) 
  10053 11172 df060109f1    918 (  0)  0.88 1.08 0.00   31 ( 47)   69 ( 73) 
C 10160 11218 ab050109f1    864 (  0)  0.61 1.92 0.10   40 (144)   29 ( 29) 
C 10265 11311 ch090109r1    928 (  0)  1.01 0.10 0.00    6 (  6)   51 ( 51) 
C 10380 11433 be090109r1    842 (  0)  1.07 0.86 0.00   73 ( 72)   49 ( 49) 
C 10418 11471 bf110109r1    665 (  0)  5.74 1.52 0.33   44 (204)   87 (129) 
  10564 11600 cc120109f1    902 (  0)  1.22 0.41 0.10   30 ( 30)   21 ( 68) 
C 10774 11822 be060109r1    858 (  0)  0.86 0.65 0.00   70 ( 94)   49 ( 49) 
  10854 11885 ch120109r1    240 (  0)  20.23 1.43 0.26  252 (715)    9 (  9) 
  10931 12018 cg060109r1    857 (  0)  0.85 0.85 0.00   48 ( 48)  103 (125) 
  10937 11954 ca120109f1     56 (  0)  26.42 0.24 0.47   30 ( 30)  144 (937) 
C 10958 11997 db100109r1    907 (  0)  0.42 0.42 0.00   33 ( 33)   45 ( 45) 
C 11024 12059 be110109f1    770 (  0)  1.84 1.94 0.00   65 ( 65)   45 ( 45) 
C 11375 12429 ag060109r1    772 (  0)  0.80 1.25 0.00  120 (129)   55 ( 55) 
C 11400 12446 aa050109r1    739 (  0)  1.27 1.39 0.00  137 (172)   44 ( 44) 
  11772 12825 ce010109f1    800 (  0)  2.05 0.97 0.00   35 ( 35)   90 (120) 
  11866 12924 ac040109f1    887 (  0)  2.14 0.68 0.10   26 ( 26)    3 ( 57) 
C 12067 13078 cc120109r1    877 (  0)  1.66 0.10 0.00    4 (  9)   47 ( 47) 
C 12189 13292 df060109r1    940 (  0)  0.58 1.25 0.00   12 ( 52)   49 ( 49) 
C 12725 13755 ch120109f1    790 (  0)  1.44 0.67 0.00   17 ( 17)  114 (131) 
C 13082 14153 cg060109f1    718 (  0)  5.43 1.19 0.00   56 ( 67)   95 (529) 
C 13612 14642 ce010109r1    806 (  0)  1.11 0.81 0.30   39 (124)    0 ( 63) 
C 13701 14707 ca120109r1    664 (  0)  2.22 0.59 0.12   42 ( 30)  111 (128) 

Overall discrep rates (%):             1.89 0.92 0.10

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90    8978  61.3    8978  61.3    0.00
 89      52   0.4    9030  61.7    0.00
 88      55   0.4    9085  62.0    0.00
 87      53   0.4    9138  62.4    0.00
 86      72   0.5    9210  62.9    0.00
 85      93   0.6    9303  63.5    0.00
 84      53   0.4    9356  63.9    0.00
 83      43   0.3    9399  64.2    0.00
 82      37   0.3    9436  64.4    0.00
 81     234   1.6    9670  66.0    0.00
 80      36   0.2    9706  66.3    0.00
 79      44   0.3    9750  66.6    0.00
 78      41   0.3    9791  66.9    0.00
 77      49   0.3    9840  67.2    0.00
 76      77   0.5    9917  67.7    0.00
 75      73   0.5    9990  68.2    0.00
 74      39   0.3   10029  68.5    0.00
 73      48   0.3   10077  68.8    0.00
 72      29   0.2   10106  69.0    0.00
 71      54   0.4   10160  69.4    0.00
 70      24   0.2   10184  69.6    0.00
 69      23   0.2   10207  69.7    0.00
 68      18   0.1   10225  69.8    0.00
 67      12   0.1   10237  69.9    0.00
 66    2079  14.2   12316  84.1    0.00
 65      16   0.1   12332  84.2    0.00
 64       9   0.1   12341  84.3    0.00
 63       8   0.1   12349  84.3    0.00
 62      12   0.1   12361  84.4    0.00
 61     232   1.6   12593  86.0    0.00
 60     202   1.4   12795  87.4    0.00
 59       7   0.0   12802  87.4    0.00
 58      28   0.2   12830  87.6    0.00
 57      25   0.2   12855  87.8    0.00
 56     242   1.7   13097  89.4    0.00
 55      24   0.2   13121  89.6    0.00
 54      89   0.6   13210  90.2    0.00
 53      52   0.4   13262  90.6    0.00
 52     132   0.9   13394  91.5    0.00
 51      61   0.4   13455  91.9    0.00
 50      91   0.6   13546  92.5    0.00
 48      10   0.1   13556  92.6    0.00
 47      26   0.2   13582  92.8    0.01
 46       9   0.1   13591  92.8    0.01
 45      10   0.1   13601  92.9    0.01
 44      18   0.1   13619  93.0    0.01
 43      10   0.1   13629  93.1    0.01
 42      30   0.2   13659  93.3    0.01
 41       4   0.0   13663  93.3    0.01
 40      15   0.1   13678  93.4    0.01
 38       3   0.0   13681  93.4    0.01
 37       9   0.1   13690  93.5    0.01
 36       1   0.0   13691  93.5    0.01
 35       3   0.0   13694  93.5    0.01
 34       3   0.0   13697  93.5    0.02
 30       2   0.0   13699  93.6    0.02
 27       4   0.0   13703  93.6    0.03
 24       1   0.0   13704  93.6    0.03
 -1     938   6.4   14642 100.0  938.03   (quality -1 = terminal quality 0)

Avg. full length: 14642.0, trimmed (qual > -1): 13704.0
Avg. quality: 76.6 per base

Initial, terminal qual 0 segments:  1-892, 14597-14642

Regions of LLR- adjusted quality < 2.0:
1-892, 14597-14642, 

2 regions, avg size 469.0, avg spacing 7321.0

First_start: 892, last_end: 14579
 Unused pair: cb040109r1 df080109f1  -15.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: -16.8  lead: 0.0  total: -15.2   70  0.00 0.00 0.00  cb040109r1       48   121 (967)    df080109f1      244   317 (742) *
 Unused pair: cb040109r1 de060109f1  -15.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: -16.8  lead: 0.0  total: -15.2   70  0.00 0.00 0.00  cb040109r1       48   121 (967)    de060109f1      251   324 (740) *
 Unused pair: cb040109r1 dd030109r1  -15.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: -16.8  lead: 0.0  total: -15.2   70  0.00 0.00 0.00  cb040109r1       48   121 (967)  C dd030109r1   (481)   579   506 *
 Unused pair: cb040109r1 dc110109r1  -15.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: -16.8  lead: 0.0  total: -15.2   70  0.00 0.00 0.00  cb040109r1       48   121 (967)  C dc110109r1   (740)   283   210 *
 Unused pair: cb040109r1 ce030109f1  -6.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=2), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.4  trail: -7.9  lead: 0.0  total: -6.5   55  2.99 0.00 0.00  cb040109r1       54   120 (968)  C ce030109f1   (14)  1053   987  
 Unused pair: cb040109r1 cd050109r1  -15.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: -16.8  lead: 0.0  total: -15.2   70  0.00 0.00 0.00  cb040109r1       48   121 (967)  C cd050109r1   (476)   595   522 *
 Unused pair: cb040109r1 cc070109f1  -15.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: -16.8  lead: 0.0  total: -15.2   70  0.00 0.00 0.00  cb040109r1       48   121 (967)    cc070109f1      315   388 (676) *
 Unused pair: bd110109r1 cb040109r1  -15.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: -16.8  lead: 0.0  total: -15.2   70  0.00 0.00 0.00  bd110109r1      302   375 (647)    cb040109r1       48   121 (967) *
 Unused pair: ab110109f1 cb040109r1  -15.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: -16.8  lead: 0.0  total: -15.2   70  0.00 0.00 0.00  ab110109f1      296   369 (635)    cb040109r1       48   121 (967) *
 Unused pair: af110109r1 cb040109r1  -15.1   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: 0.0  lead: -16.8  total: -15.2   70  0.00 0.00 0.00  af110109r1      251   324 (694)  C cb040109r1   (967)   121    48 *

Slack, # used pairs (max_score), unused
 0   462  (21.9)    10 (-6.1)     1578
 1   531  (22.2)     0 ( 0.0)      169
 2   275  (21.8)     0 ( 0.0)        5
 3   136  (20.8)     0 ( 0.0)        0
 4    94  (20.9)     0 ( 0.0)        0
 5    79  (21.3)     0 ( 0.0)        0
 6    62  (20.6)     0 ( 0.0)        0
 7    28  (20.8)     0 ( 0.0)        0
 8    30  (20.4)     0 ( 0.0)        0
 9    18  (18.1)     0 ( 0.0)        0
10    10  (20.5)     0 ( 0.0)        0
11     9  (13.7)     0 ( 0.0)        0
12     2  (18.9)     0 ( 0.0)        0
13     4  (14.1)     0 ( 0.0)        0
14     1  ( 5.1)     0 ( 0.0)        0
15     1  ( 1.9)     0 ( 0.0)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -   892      892+
 4491 -  5057      567       bb120109f1   (3610)    No           1448
 6828 -  6895       68       ce110109r1   (5817)    No           1079
12922 - right     1721+      ac040109f1   (11866)    No           2776+

Bottom strand: 
 left -     0        0+      ad120109f1   ( 983)    Yes           983+
 7435 -  7545      111       ce110109f1   (8565)    No           1131 
 8858 -  8915       58       bc050109r1   (9853)    Yes           996 
14643 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56  36773  36773 121485 (100.00)    88 13    0   0   0   0     0 (0.00)    0  3411 (2.81)
51   8219  44992  84712 ( 69.73)    24  4    0   0   0   0     0 (0.00)    0  3411 (4.03)
50   3652  48644  76493 ( 62.96)    20  0    0   0   0   0     0 (0.00)    0  3411 (4.46)
48    799  49443  72841 ( 59.96)    13  0    0   0   0   0     0 (0.00)    0  3411 (4.68)
47    609  50052  72042 ( 59.30)     5  1    0   0   0   0     0 (0.00)    0  3411 (4.73)
46   1632  51684  71433 ( 58.80)    21  0    0   0   0   0     0 (0.00)    0  3411 (4.78)
45   1436  53120  69801 ( 57.46)     1  0    0   0   0   0     0 (0.00)    0  3411 (4.89)
44   2589  55709  68365 ( 56.27)    22  0    0   0   0   0     0 (0.00)    0  3411 (4.99)
43   1948  57657  65776 ( 54.14)     7  0    0   0   0   0     0 (0.00)    0  3411 (5.19)
42   4956  62613  63828 ( 52.54)    30  2    0   0   0   0     0 (0.00)    0  3411 (5.34)
41    442  63055  58872 ( 48.46)     0  0    0   0   0   0     0 (0.00)    0  3411 (5.79)
40   5553  68608  58430 ( 48.10)    84  0    0   0   0   0     0 (0.00)    0  3411 (5.84)
39    253  68861  52877 ( 43.53)     5  0    0   0   0   0     0 (0.00)    0  3411 (6.45)
38    334  69195  52624 ( 43.32)     4  0    0   0   0   0     0 (0.00)    0  3411 (6.48)
37   1844  71039  52290 ( 43.04)    15  2    0   0   0   0     0 (0.00)    0  3411 (6.52)
36    203  71242  50446 ( 41.52)     4  0    0   0   0   0     0 (0.00)    0  3411 (6.76)
35   1312  72554  50243 ( 41.36)    19  0    0   0   0   0     0 (0.00)    0  3411 (6.79)
34   1025  73579  48931 ( 40.28)     3  0    0   0   0   0     0 (0.00)    0  3411 (6.97)
33    863  74442  47906 ( 39.43)    14  0    0   0   1   0     1 (0.12)    1  3411 (7.12)
32   1026  75468  47043 ( 38.72)    30  0    0   0   0   0     0 (0.00)    1  3410 (7.25)
31    588  76056  46017 ( 37.88)     9  1    0   0   0   0     0 (0.00)    1  3410 (7.41)
30    461  76517  45429 ( 37.39)     6  1    0   0   0   0     0 (0.00)    1  3410 (7.51)
29   2337  78854  44968 ( 37.02)    75  0    0   1   0   0     1 (0.04)    2  3410 (7.58)
28    622  79476  42631 ( 35.09)    15  1    0   1   0   0     1 (0.16)    3  3409 (8.00)
27   1029  80505  42009 ( 34.58)    32  0    0   1   0   1     2 (0.19)    5  3408 (8.11)
26    336  80841  40980 ( 33.73)    38  0    0   0   0   0     0 (0.00)    5  3406 (8.31)
25   1842  82683  40644 ( 33.46)    64  0    0   0   1   0     1 (0.05)    6  3406 (8.38)
24   1086  83769  38802 ( 31.94)    35  0    0   1   0   0     1 (0.09)    7  3405 (8.78)
23    652  84421  37716 ( 31.05)    48  0    0   1   1   0     2 (0.31)    9  3404 (9.03)
22    850  85271  37064 ( 30.51)    45  0    0   5   2   0     7 (0.82)   16  3402 (9.18)
21    964  86235  36214 ( 29.81)    72  1    0   3   2   0     5 (0.52)   21  3395 (9.37)
20    862  87097  35250 ( 29.02)    74  0    0   3   1   0     4 (0.46)   25  3390 (9.62)
19   1528  88625  34388 ( 28.31)    88  0    0   5   2   3    10 (0.65)   35  3386 (9.85)
18   1112  89737  32860 ( 27.05)    70  0    0   6   2   0     8 (0.72)   43  3376 (10.27)
17    957  90694  31748 ( 26.13)    41  0    0   7   4   1    12 (1.25)   55  3368 (10.61)
16   1009  91703  30791 ( 25.35)    64  0    0   6   2   1     9 (0.89)   64  3356 (10.90)
15   1685  93388  29782 ( 24.51)    88  1    0  26   9   3    38 (2.26)  102  3347 (11.24)
14   1283  94671  28097 ( 23.13)    66  0    0  20   5   5    30 (2.34)  132  3309 (11.78)
13   1836  96507  26814 ( 22.07)   118  0    0  37  13   2    52 (2.83)  184  3279 (12.23)
12   1982  98489  24978 ( 20.56)    67  0    0  39  17   3    59 (2.98)  243  3227 (12.92)
11   2527 101016  22996 ( 18.93)   121  0    0 116  31   9   156 (6.17)  399  3168 (13.78)
10   3612 104628  20469 ( 16.85)   145  0    0 190  65  12   267 (7.39)  666  3012 (14.71)
 9   5093 109721  16857 ( 13.88)   287  0    0 390 119  25   534 (10.48)  1200  2745 (16.28)
 8   4857 114578  11764 (  9.68)   287  0    0 378 265  16   659 (13.57)  1859  2211 (18.79)
 7   4283 118861   6907 (  5.69)   240  0    0 470 314  22   806 (18.82)  2665  1552 (22.47)
 6   1971 120832   2624 (  2.16)   217  0    0 243 200   9   452 (22.93)  3117  746 (28.43)
 4    507 121339    653 (  0.54)    10  0    0 155  14   2   171 (33.73)  3288  294 (45.02)
 0    146 121485    146 (  0.12)  2249 23   112   0  10   1   123 (84.25)  3411  123 (84.25)
-1   1002 122487      0 (  0.00)  20794  3    1  25   7   0    33 (3.29)  3444    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90  81698  81698 115580 (100.00)     0  0    0   0   0   0     0 (0.00)    0  2095 (1.81)
89    229  81927  33882 ( 29.31)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.18)
88    278  82205  33653 ( 29.12)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.23)
87    244  82449  33375 ( 28.88)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.28)
86    350  82799  33131 ( 28.66)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.32)
85    386  83185  32781 ( 28.36)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.39)
84    241  83426  32395 ( 28.03)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.47)
83    144  83570  32154 ( 27.82)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.52)
82    157  83727  32010 ( 27.70)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.54)
81   1234  84961  31853 ( 27.56)     2  0    0   0   0   0     0 (0.00)    0  2095 (6.58)
80     88  85049  30619 ( 26.49)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.84)
79    117  85166  30531 ( 26.42)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.86)
78     84  85250  30414 ( 26.31)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.89)
77    108  85358  30330 ( 26.24)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.91)
76    267  85625  30222 ( 26.15)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.93)
75    180  85805  29955 ( 25.92)     0  0    0   0   0   0     0 (0.00)    0  2095 (6.99)
74     62  85867  29775 ( 25.76)     0  0    0   0   0   0     0 (0.00)    0  2095 (7.04)
73    125  85992  29713 ( 25.71)     0  0    0   0   0   0     0 (0.00)    0  2095 (7.05)
72     65  86057  29588 ( 25.60)     0  0    0   0   0   0     0 (0.00)    0  2095 (7.08)
71    133  86190  29523 ( 25.54)     1  0    0   0   0   0     0 (0.00)    0  2095 (7.10)
70     75  86265  29390 ( 25.43)     0  0    0   0   0   0     0 (0.00)    0  2095 (7.13)
69     74  86339  29315 ( 25.36)     2  0    0   0   0   0     0 (0.00)    0  2095 (7.15)
68     43  86382  29241 ( 25.30)     0  0    0   0   0   0     0 (0.00)    0  2095 (7.16)
67     79  86461  29198 ( 25.26)     0  0    0   0   0   0     0 (0.00)    0  2095 (7.18)
66   8347  94808  29119 ( 25.19)     0  0    0   0   0   0     0 (0.00)    0  2095 (7.19)
65    187  94995  20772 ( 17.97)     0  0    0   0   0   0     0 (0.00)    0  2095 (10.09)
64     29  95024  20585 ( 17.81)     0  0    0   0   0   0     0 (0.00)    0  2095 (10.18)
63     25  95049  20556 ( 17.79)     0  0    0   0   0   0     0 (0.00)    0  2095 (10.19)
62     60  95109  20531 ( 17.76)     0  0    0   0   0   0     0 (0.00)    0  2095 (10.20)
61    789  95898  20471 ( 17.71)     0  0    0   0   0   0     0 (0.00)    0  2095 (10.23)
60    610  96508  19682 ( 17.03)     0  0    0   0   0   0     0 (0.00)    0  2095 (10.64)
59     39  96547  19072 ( 16.50)     1  0    0   0   0   0     0 (0.00)    0  2095 (10.98)
58    125  96672  19033 ( 16.47)     2  0    0   0   0   0     0 (0.00)    0  2095 (11.01)
57    153  96825  18908 ( 16.36)     0  0    0   0   0   0     0 (0.00)    0  2095 (11.08)
56    503  97328  18755 ( 16.23)     0  0    0   0   0   0     0 (0.00)    0  2095 (11.17)
55    108  97436  18252 ( 15.79)     0  0    0   0   0   0     0 (0.00)    0  2095 (11.48)
54    312  97748  18144 ( 15.70)     0  0    0   0   0   0     0 (0.00)    0  2095 (11.55)
53    153  97901  17832 ( 15.43)     0  0    0   0   0   0     0 (0.00)    0  2095 (11.75)
52    390  98291  17679 ( 15.30)     0  0    0   0   0   0     0 (0.00)    0  2095 (11.85)
51    140  98431  17289 ( 14.96)     0  0    0   0   0   0     0 (0.00)    0  2095 (12.12)
50    344  98775  17149 ( 14.84)     0  0    0   0   0   0     0 (0.00)    0  2095 (12.22)
49    114  98889  16805 ( 14.54)     0  0    0   0   0   0     0 (0.00)    0  2095 (12.47)
48    100  98989  16691 ( 14.44)     1  0    0   0   0   0     0 (0.00)    0  2095 (12.55)
47    127  99116  16591 ( 14.35)     0  0    0   0   0   0     0 (0.00)    0  2095 (12.63)
46    132  99248  16464 ( 14.24)     0  0    0   0   0   0     0 (0.00)    0  2095 (12.72)
45    112  99360  16332 ( 14.13)     0  0    0   0   0   0     0 (0.00)    0  2095 (12.83)
44    196  99556  16220 ( 14.03)     1  0    0   0   0   0     0 (0.00)    0  2095 (12.92)
43    120  99676  16024 ( 13.86)     0  0    0   0   0   0     0 (0.00)    0  2095 (13.07)
42    194  99870  15904 ( 13.76)     4  0    0   0   0   0     0 (0.00)    0  2095 (13.17)
41    148 100018  15710 ( 13.59)     0  0    0   0   0   0     0 (0.00)    0  2095 (13.34)
40   3406 103424  15562 ( 13.46)     9  0    0   0   1   0     1 (0.03)    1  2095 (13.46)
39     70 103494  12156 ( 10.52)     1  0    0   0   0   0     0 (0.00)    1  2094 (17.23)
38     78 103572  12086 ( 10.46)     2  0    0   0   0   0     0 (0.00)    1  2094 (17.33)
37    106 103678  12008 ( 10.39)     1  0    0   0   0   0     0 (0.00)    1  2094 (17.44)
36     48 103726  11902 ( 10.30)     1  0    0   0   0   0     0 (0.00)    1  2094 (17.59)
35     96 103822  11854 ( 10.26)     4  0    0   0   0   0     0 (0.00)    1  2094 (17.66)
34     96 103918  11758 ( 10.17)     0  0    0   0   0   0     0 (0.00)    1  2094 (17.81)
33    124 104042  11662 ( 10.09)     2  0    0   0   1   0     1 (0.81)    2  2094 (17.96)
32    117 104159  11538 (  9.98)     0  0    0   0   0   0     0 (0.00)    2  2093 (18.14)
31     62 104221  11421 (  9.88)     0  0    0   0   0   0     0 (0.00)    2  2093 (18.33)
30     36 104257  11359 (  9.83)     0  0    0   0   0   0     0 (0.00)    2  2093 (18.43)
29     67 104324  11323 (  9.80)     3  0    0   1   0   0     1 (1.49)    3  2093 (18.48)
28     30 104354  11256 (  9.74)     2  0    0   0   0   0     0 (0.00)    3  2092 (18.59)
27     95 104449  11226 (  9.71)     3  0    0   0   0   1     1 (1.05)    4  2092 (18.64)
26     47 104496  11131 (  9.63)     0  0    0   0   0   0     0 (0.00)    4  2091 (18.79)
25    443 104939  11084 (  9.59)     5  0    0   0   1   0     1 (0.23)    5  2091 (18.87)
24    125 105064  10641 (  9.21)     2  0    0   1   2   0     3 (2.40)    8  2090 (19.64)
23    100 105164  10516 (  9.10)     1  0    0   0   1   1     2 (2.00)   10  2087 (19.85)
22     88 105252  10416 (  9.01)     2  0    0   3   2   0     5 (5.68)   15  2085 (20.02)
21     97 105349  10328 (  8.94)     5  0    0   5   3   0     8 (8.25)   23  2080 (20.14)
20     87 105436  10231 (  8.85)     3  0    0   3   1   0     4 (4.60)   27  2072 (20.25)
19    198 105634  10144 (  8.78)     7  0    0   4   3   3    10 (5.05)   37  2068 (20.39)
18    100 105734   9946 (  8.61)     2  0    0   6   2   0     8 (8.00)   45  2058 (20.69)
17    132 105866   9846 (  8.52)     4  0    0   5   2   1     8 (6.06)   53  2050 (20.82)
16    199 106065   9714 (  8.40)     4  0    0   1   2   1     4 (2.01)   57  2042 (21.02)
15    295 106360   9515 (  8.23)     6  0    0  26  10   4    40 (13.56)   97  2038 (21.42)
14    225 106585   9220 (  7.98)     5  0    0  17   5   5    27 (12.00)  124  1998 (21.67)
13    437 107022   8995 (  7.78)     9  0    0  18  11   2    31 (7.09)  155  1971 (21.91)
12    409 107431   8558 (  7.40)     5  0    0  23  14   3    40 (9.78)  195  1940 (22.67)
11    659 108090   8149 (  7.05)     9  0    0  63  17   8    88 (13.35)  283  1900 (23.32)
10   1160 109250   7490 (  6.48)    15  0    0 130  44  10   184 (15.86)  467  1812 (24.19)
 9   1759 111009   6330 (  5.48)    22  0    0 223  68  19   310 (17.62)  777  1628 (25.72)
 8   1694 112703   4571 (  3.95)    32  0    0 222 183  10   415 (24.50)  1192  1318 (28.83)
 7   1803 114506   2877 (  2.49)    17  0    0 315 219  20   554 (30.73)  1746  903 (31.39)
 6    882 115388   1074 (  0.93)    28  0    0 142 126   9   277 (31.41)  2023  349 (32.50)
 4    144 115532    192 (  0.17)     3  0    0  16   9   0    25 (17.36)  2048   72 (37.50)
 0     48 115580     48 (  0.04)     1  0   38   0   9   0    47 (97.92)  2095   47 (97.92)
-1   6907 122487      0 (  0.00)  25645 53   75 905 351  18   1349 (19.53)  3444    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0     938      938        2
 24       1      939        3
 27       4      943        3
 30       2      945        4
 34       3      948        4
 35       3      951        6
 36       1      952        5
 37       9      961        8
 38       3      964       10
 40      15      979       12
 41       4      983       15
 42      30     1013       21
 43      10     1023       27
 44      18     1041       28
 45      10     1051       31
 46       9     1060       30
 47      26     1086       38
 48      10     1096       38
 50      91     1187       61
 51      61     1248       72
 52     132     1380      107
 53      52     1432      108
 54      89     1521      118
 55      24     1545      122
 56     242     1787      113
 57      25     1812      117
 58      28     1840      116
 59       7     1847      115
 60     202     2049      149
 61     232     2281      178
 62      12     2293      182
 63       8     2301      184
 64       9     2310      186
 65      16     2326      184
 66    2079     4405       52
 67      12     4417       54
 68      18     4435       61
 69      23     4458       67
 70      24     4482       71
 71      54     4536       81
 72      29     4565       85
 73      48     4613      100
 74      39     4652      107
 75      73     4725      122
 76      77     4802      135
 77      49     4851      128
 78      41     4892      126
 79      44     4936      129
 80      36     4972      124
 81     234     5206      141
 82      37     5243      138
 83      43     5286      137
 84      53     5339      141
 85      93     5432      145
 86      72     5504      148
 87      53     5557      149
 88      55     5612      151
 89      52     5664      147
 90    8978    14642        1

SS region: 3417 (23.34%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads):
 1317     -4.2  [-2.4,  0.0]  (2, 0)
 2541     -3.2  [-3.2,  0.0]  (0, 1)
 2549     -3.2  [-3.2,  0.0]  (0, 1)
 2573     -3.7  [-3.7,  0.0]  (0, 1)
 3476     -4.0  [-4.0,  0.0]  (0, 1)
 4186     -5.1  [-5.1,  0.0]  (0, 1)
 4301     -3.3  [-3.3,  0.0]  (0, 1)
 4978     -4.2  [-4.2,  0.0]  (0, 1)
 5056     -3.2  [-3.2,  0.0]  (0, 1)
 6831     -4.0  [-4.0,  0.0]  (0, 1)
 7435     -3.2  [-3.2,  0.0]  (0, 1)
 8858     -4.2  [-4.2,  0.0]  (0, 1)
11261     -4.0  [-4.0,  0.0]  (0, 1)
11385     -3.8  [-3.8,  0.0]  (0, 1)
11774     -3.0  [-3.0,  0.0]  (0, 1)
13244     -3.3  [-3.3,  0.0]  (0, 1)

Read/contig discrepancies (* = higher-quality):
   892  S   C dc070109f1      (56)/(56)  839 AXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXA / AXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXA

1 HQ discrepancies in 1 reads.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
Bypassed: (15, 15)  2248- 2321 [-15.1] (0,0)   C cb040109r1         121-48 || local(+/-) (1.4,1.4), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: 0.0  lead: -16.8  total: -15.2 
(9, 17)  2251- 2321 [-3.4] (0,0)     cb040109f1         28-99 || local(+/-) (1.4,1.4), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=1), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.6  trail: 0.0  lead: -5.0  total: -3.4 
(0, 0)  3225- 4178 [19.6] (0,0)     df090109f1         82-1036 | (2 84)  82 1036 | DU:(2 81) [2 84  with   dc010109f1  0 80]  CHIMERIC || local(+/-) (20.1,6.0), distant (2.1,0.0)
(0, 0)  3752- 4306 [-0.6] (0,0)   C de020109f1         745-188 || local(+/-) (6.1,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -6.0 (<20 part: -6.0 (#=106), >20:0.0 (#=0); in HQ: -1.1, out HQ -4.9), match: 5.3  trail: 0.0  lead: 0.0  total: -0.7 
(0, 0) 12742-13641 [18.4] (0,0)   C ch120109f1         1020-115 | (20 114)  115 1020 | DU:(20 114) [20 114  with   dh090109f1  8 99]  [20 108  with   dg030109f1  10 92]  [20 108  with   dd050109f1  10 96]  [42 114  with   db040109f1  27 98]  [28 105  with   cf110109f1  31 106]  [20 113  with   cf080109f1  9 95]  CHIMERIC || local(+/-) (10.9,0.0), distant (0.0,0.0)
(0, 0) 13138-14058 [16.1] (0,0)   C cg060109f1         1027-96 | (17 89)  (96 503)  513 1016 | DU:(17 89) [17 89  with   cf110109f1  31 104]  || local(+/-) (10.7,0.0), distant (0.0,0.0)

Gaps in unique-read coverage:   I 6423- 7517, I 13625- 13735

Contig 16.  292 reads; 15575 bp (untrimmed), 15488 (trimmed).
    -46  1024 cd040109r1    871 (  0)  0.49 1.48 0.00   47 (229)   11 ( 60) 
    138  1176 dh040109r1    864 (  0)  0.72 0.61 0.00   45 ( 45)   18 ( 18) 
    173  1230 be050109f1    854 ( 33)  2.05 0.78 0.19   32 ( 32)    0 ( 72) 
    655  1741 dc050109f1      4 (  0)  11.11 0.00 0.00   28 (1087) 1050 (1086) 
    659  1712 cd010109f1    769 (467)  1.69 1.13 0.11  111 (111)   57 (173) 
    983  2013 ba110109r1     30 ( 30)  0.00 0.00 0.00   52 ( 52)  947 (947) 
   1231  2239 ag020109f1    870 (  0)  0.20 0.31 0.41   27 ( 27)    0 (  0) 
   1340  2374 cf120109r1    676 (  0)  2.13 1.30 0.00   50 ( 50)  140 (190) 
   1379  2432 db050109r1    856 (  0)  1.30 0.10 0.10   47 ( 47)    4 (  4) 
C  1558  2626 ba060109r1    711 (  0)  1.05 0.35 0.23  151 (159)   62 ( 62) 
   1594  2607 cb120109r1    824 (  0)  0.94 0.31 0.00   46 ( 46)    7 ( 40) 
   1639  2684 cb100109f1    868 (  0)  1.27 0.20 0.29   25 ( 28)    0 ( 37) 
   1654  2698 dh090109r1    834 (  0)  1.50 0.30 0.10   46 ( 46)    2 ( 76) 
   1681  2722 ba060109f1    744 (  0)  0.23 0.12 0.00   29 ( 29)  159 (159) 
   1704  2745 da080109f1    874 (  0)  0.89 0.00 0.30   24 ( 24)    3 ( 21) 
   1792  2807 db120109f1    856 (  0)  0.71 0.61 0.10   24 ( 24)    3 ( 24) 
   1851  2911 ce090109f1    876 (  0)  0.91 0.20 0.00   26 ( 26)   41 ( 47) 
   1908  2948 bd090109f1    841 (  0)  1.22 0.61 0.10   25 ( 25)   36 ( 53) 
   1982  3035 cd020109r1    830 (  0)  1.53 0.82 0.00   49 ( 49)   24 ( 51) 
   2029  3119 cg080109f1    944 (  0)  0.57 0.29 0.00   24 ( 24)   22 ( 27) 
   2037  3096 cc030109r1    899 (  0)  0.80 0.30 0.00   52 ( 52)    6 (  6) 
   2061  3104 dh030109f1    890 (  0)  1.10 0.30 0.00   36 ( 36)    8 (  8) 
   2101  3121 bf020109r1    835 (  0)  0.82 1.23 0.10   48 ( 48)    0 (  9) 
   2165  3186 ca110109f1    894 (  0)  0.60 0.40 0.30   23 ( 23)    0 (  0) 
   2229  3271 bg100109r1    853 (  0)  1.33 0.71 0.00   51 ( 51)   11 ( 89) 
   2278  3328 cb020109r1    853 (  0)  0.31 1.04 0.10   48 ( 48)   42 ( 42) 
C  2295  3355 cc030109f1    902 (  0)  1.07 0.78 0.00    0 (  0)   34 ( 81) 
   2409  3443 be100109r1    860 (  0)  0.64 0.32 0.11   49 ( 49)   53 ( 53) 
   2530  3600 bd070109r1    860 (  0)  0.84 0.84 0.00   51 ( 51)   65 (116) 
   2610  3607 bb110109f1    874 (  0)  0.93 0.52 0.10   28 ( 28)    3 ( 68) 
   2662  3725 af100109f1    797 (  0)  1.83 0.54 0.43   47 ( 47)   88 ( 97) 
   2677  3681 ag120109r1    851 (  0)  0.54 0.75 0.00   51 ( 51)   23 ( 23) 
   2854  3860 ae110109f1    887 (  0)  1.44 0.51 0.00   33 ( 33)    0 ( 15) 
C  2852  3930 cf050109f1    239 (  0)  1.20 0.00 0.00  803 (803)   27 ( 27) 
   2876  3925 ch080109r1    919 (  0)  0.81 0.51 0.00   46 ( 46)   14 ( 24) 
   2882  3922 ca090109f1    877 ( 35)  1.79 1.19 0.20   33 ( 33)    0 ( 22) 
C  2904  3961 cd020109f1    540 (  0)  20.28 0.80 0.10   37 ( 48)   25 ( 25) 
C  2911  3965 dh090109f1    852 ( 43)  1.18 0.64 0.00   22 ( 22)  100 (100) 
C  2901  3968 cf110109f1      6 (  0)  0.00 0.00 0.00   22 (974) 1039 ( 22) 
C  2874  3922 cc110109f1      4 (  0)  0.00 0.00 0.00   12 (972) 1030 ( 16) 
C  2969  4008 ca030109f1      7 (  0)  0.00 0.00 0.00  999 (949)   34 (  9) 
C  2902  3932 dh110109f1      6 (  0)  0.00 0.00 0.00  934 (943)   90 (  8) 
C  2947  3975 cb100109r1    426 ( 45)  6.58 1.85 0.17  392 (493)   44 ( 44) 
C  2954  3981 da120109f1      2 (  0)  0.00 0.00 0.00    0 (939) 1021 ( 17) 
   2998  4035 da040109r1    918 (104)  0.71 0.81 0.00   48 ( 48)    0 (  0) 
C  3007  4022 ag020109r1    889 ( 78)  0.52 0.93 0.10    0 ( 11)   50 ( 50) 
C  3025  4037 db120109r1    897 (  0)  0.83 0.62 0.00    2 (  2)   47 ( 47) 
   3074  4105 be040109r1    880 (101)  1.63 0.92 0.00   49 ( 49)    3 ( 73) 
C  3095  4093 ag120109f1    888 (  0)  0.73 0.73 0.21    8 (  8)   26 ( 26) 
   3124  4141 bc010109f1    904 (  0)  1.03 0.31 0.10   26 ( 26)   23 ( 46) 
C  3151  4196 bd090109r1    869 (148)  0.53 1.16 0.11   52 ( 79)   47 ( 47) 
   3147  4288 dc100109f1    247 ( 36)  17.56 0.84 0.17  120 (178)  424 (609) 
   3146  4440 ac080109f1    180 (  0)  9.12 0.34 0.68   25 ( 25)  974 (981) 
   3169  4210 db090109r1    921 (  0)  1.02 0.20 0.10   47 ( 47)   18 ( 57) 
C  3230  4280 ag100109r1     82 (  0)  0.00 0.00 0.00  920 (914)   49 ( 49) 
C  3242  4269 cb120109f1    913 (  0)  0.71 1.11 0.00   13 ( 38)   28 ( 27) 
   3244  4291 bb040109r1    895 (  0)  1.21 1.31 0.00   47 ( 47)   12 ( 32) 
   3285  4337 ab080109r1    862 (  0)  0.43 1.29 0.00   50 ( 50)   73 ( 73) 
C  3314  4362 ca110109r1    334 (159)  5.57 1.93 0.43  536 (664)   46 ( 46) 
C  3412  4450 dh040109f1    873 ( 62)  1.16 0.63 0.21   11 ( 74)   76 ( 76) 
   3412  4476 cf040109r1    960 (  0)  0.99 0.20 0.00   47 ( 47)   12 ( 20) 
C  3431  4451 cf120109f1    879 (  0)  2.53 0.30 0.20    0 ( 76)   31 ( 31) 
   3440  4491 bc030109r1    877 (  0)  2.31 0.90 0.10   52 ( 52)    5 ( 90) 
   3487  4519 ch100109r1    888 ( 31)  0.95 0.74 0.00   48 ( 48)   33 ( 33) 
   3522  4676 ba050109r1    212 (230)  16.42 1.68 0.00  281 (323)  277 (403) 
C  3556  4621 bd070109f1    943 (  0)  0.70 0.60 0.00   41 ( 92)   27 ( 27) 
   3553  4623 dd060109r1    951 ( 61)  1.19 0.30 0.00   47 ( 47)   15 ( 40) 
C  3599  4638 da040109f1    968 ( 64)  0.29 0.39 0.29    3 ( 34)   18 ( 18) 
   3606  4692 cf050109r1    238 (  0)  1.20 0.00 0.00   49 ( 49)  789 (790) 
C  3647  4686 ae100109f1    658 (144)  0.30 0.15 0.00  340 (340)   25 ( 19) 
   3668  4684 da010109r1    845 (  0)  2.02 0.43 0.32   51 ( 51)   27 ( 27) 
C  3697  4737 bg100109f1    887 ( 89)  1.79 1.39 0.00    3 ( 93)   31 ( 31) 
   3735  4723 dh010109r1    795 ( 72)  3.40 0.85 0.32   43 ( 43)    5 ( 56) 
C  3753  4745 bb110109r1    827 (  0)  1.39 1.60 0.00   12 ( 76)   44 ( 53) 
C  3780  4835 af100109r1    839 (134)  1.54 0.44 0.00   89 (104)   58 ( 58) 
C  3832  4860 be100109f1    922 (  0)  1.40 0.50 0.10    4 ( 39)   26 ( 26) 
   3892  4951 db070109r1    925 (107)  1.11 0.40 0.10   48 ( 48)   23 ( 39) 
   3939  4980 ae100109r1    663 (128)  0.30 0.00 0.00   48 ( 48)  319 (312) 
C  3966  5045 db050109f1    913 ( 60)  0.63 0.21 0.00  106 (100)   25 ( 25) 
C  4006  5024 bf020109f1    933 ( 91)  1.10 0.30 0.10    0 ( 30)   22 ( 22) 
C  4063  5099 dh030109r1    888 (  0)  1.42 1.11 0.10    0 ( 21)   48 ( 48) 
C  4056  5146 cg080109r1    991 ( 61)  0.49 0.19 0.10   17 (  0)   47 ( 47) 
C  4055  5102 cb020109f1    961 (  0)  0.98 0.29 0.20    0 (  4)   26 ( 26) 
C  4119  5189 be050109r1    842 ( 60)  0.75 1.29 0.11   93 ( 93)   50 ( 50) 
   4132  5162 ag100109f1     65 (  0)  1.20 1.20 2.41   17 ( 13)  931 (931) 
   4210  5263 bc060109r1    890 (144)  1.71 0.60 0.30   47 ( 47)   14 ( 91) 
   4225  5281 df070109r1    915 (156)  0.79 1.29 0.10   48 ( 48)    0 ( 20) 
C  4260  5314 ce090109r1    925 (212)  1.29 0.70 0.00    0 ( 15)   49 ( 49) 
   4384  5447 df040109r1    946 ( 90)  0.90 0.30 0.10   51 ( 51)   11 ( 14) 
C  4399  5468 cd040109f1    967 (  0)  0.96 0.77 0.10    3 ( 75)   22 ( 22) 
   4447  5458 dh020109r1    907 (  0)  1.35 0.10 0.00   46 ( 46)    2 ( 17) 
   4462  5511 dg040109r1    945 ( 57)  1.00 0.20 0.10   50 ( 50)    0 ( 21) 
C  4527  5532 ae110109r1    892 (  0)  1.25 0.42 0.00    2 ( 55)   47 ( 47) 
C  4562  5611 be040109f1    885 (  0)  0.62 0.94 0.10   65 ( 33)   25 ( 25) 
C  4597  5639 da080109r1    921 (  0)  1.01 0.40 0.10    6 (  3)   49 ( 49) 
C  4698  5750 db090109f1    854 (  0)  1.43 1.73 0.00   40 ( 97)   32 ( 32) 
C  4696  5729 ca090109r1    289 (170)  3.85 0.00 1.65  624 (636)   46 ( 46) 
   4702  5763 bc040109r1    875 (  0)  1.23 1.23 0.00   47 ( 47)   40 (130) 
C  4800  5835 ab080109f1    888 (398)  0.80 1.79 0.10    4 (  1)   26 ( 26) 
   4785  5855 de040109r1    902 ( 31)  1.12 0.71 0.00   49 ( 49)   41 ( 76) 
C  4811  5831 bc010109r1    873 ( 47)  1.25 0.94 0.00    8 ( 37)   51 ( 51) 
C  4866  5919 bc030109f1    896 ( 57)  1.39 1.09 0.10   23 ( 90)   26 ( 26) 
C  4980  6108 ac080109r1    466 (130)  6.40 2.62 0.15  393 (502)   48 ( 48) 
   5031  6092 af070109r1    837 (226)  0.34 0.89 0.00   46 ( 46)  122 (122) 
C  5060  6140 dd060109f1    954 (375)  0.68 0.59 0.10   37 ( 46)   22 ( 27) 
C  5092  6148 db070109f1    964 (376)  0.68 0.58 0.10    0 ( 16)   25 ( 25) 
   5126  6183 df030109r1    881 (340)  1.13 1.13 0.00   45 ( 45)   39 ( 43) 
C  5132  6196 cf040109f1    965 (427)  0.29 0.78 0.10   12 ( 12)   22 ( 22) 
C  5216  6225 dh010109f1    832 (371)  1.00 0.45 0.22    7 ( 23)  106 (115) 
C  5334  6345 da010109f1    912 (566)  1.24 0.21 0.00   16 ( 16)   25 ( 25) 
C  5400  6511 bh080109f1     91 ( 89)  5.17 0.00 0.86  897 (897)   99 ( 93) 
   5478  6490 ch020109r1    889 ( 42)  1.34 0.41 0.21   46 ( 46)    0 (  0) 
C  5524  6553 ac110109r1     92 ( 37)  5.13 0.00 0.85  866 (852)   47 ( 47) 
C  5530  6580 bb040109f1    916 (776)  1.18 0.79 0.30   13 ( 46)   23 ( 23) 
C  5615  7019 dc100109r1     76 ( 76)  19.44 2.78 0.00 1020 (1254)  133 (133) 
C  5702  6760 df040109f1    985 (675)  0.77 0.19 0.10    0 ( 31)   23 ( 23) 
C  5786  6832 df070109f1    945 (696)  0.98 0.68 0.10    0 ( 14)   24 ( 24) 
C  6074  7132 dg040109f1    948 (321)  0.60 0.20 0.20   42 ( 42)   23 ( 23) 
   6083  7100 ba010109r1    834 (293)  2.19 1.46 0.00   48 ( 48)   10 (108) 
   6235  7289 bh080109r1    102 ( 71)  3.10 0.78 1.55   60 ( 60)  866 (866) 
C  6303  7320 dh020109f1    919 ( 99)  1.11 0.50 0.20    0 ( 19)   25 ( 25) 
   6333  7375 dd020109f1    972 ( 75)  0.69 0.20 0.10   24 ( 24)    1 (  1) 
   6345  7380 ac110109f1     96 ( 88)  0.87 0.87 1.74   47 ( 31)  874 (874) 
C  6405  7469 ch080109f1    886 (  0)  0.94 0.84 0.00   27 ( 54)   83 ( 83) 
   6493  7567 bd060109r1    895 (  0)  1.58 1.19 0.00   64 ( 64)    0 ( 90) 
C  6527  7602 bc040109f1    897 (  0)  1.02 0.71 0.10   70 (117)   25 ( 25) 
C  6623  7674 ch100109f1    883 (  0)  0.10 1.15 0.00   68 ( 68)   29 ( 29) 
   6752  7785 dd010109f1    782 (  0)  1.20 1.75 0.11   81 ( 81)   37 (124) 
C  6766  7786 ch020109f1    924 (  0)  0.81 0.10 0.00   11 ( 11)   27 ( 32) 
   6856  7890 be010109f1    827 (  0)  0.55 0.88 0.00   26 ( 26)   98 (115) 
C  6886  7842 de040109f1    349 (  0)  2.29 0.00 2.29  451 (469)   25 ( 25) 
   6907  8003 ch040109r1    162 ( 69)  20.08 1.02 0.00  124 (124)  485 (795) 
   6905  7950 cg030109r1    877 (  0)  1.01 0.91 0.00   47 ( 47)    6 (  6) 
C  7019  8057 af070109f1    855 (134)  1.98 0.89 0.00    3 (100)   27 ( 27) 
C  7064  8102 cd090109r1    879 (  0)  0.71 0.51 0.20    4 (  4)   48 ( 48) 
C  7104  8128 ba010109f1    857 ( 92)  1.31 0.91 0.00    0 ( 30)   32 ( 32) 
   7250  8309 bg120109f1    785 ( 36)  1.56 1.15 0.10   82 ( 82)   19 ( 66) 
   7300  8405 bg050109f1    542 (  0)  4.73 1.28 0.38   67 (124)  257 (257) 
C  7320  8377 bc060109f1    857 (  0)  1.56 0.58 0.10    5 ( 13)   27 ( 27) 
   7407  8411 dg010109r1    807 (  0)  0.73 0.94 0.00   49 ( 49)    2 (  6) 
   7496  8522 dc010109r1    837 (  0)  0.51 0.92 0.00   47 ( 47)    5 (  4) 
   7580  8646 dd070109f1    864 (  0)  0.69 1.19 0.00   25 ( 25)   30 ( 92) 
C  7593  8655 df030109f1    842 (  0)  1.77 1.08 0.00    4 ( 38)   43 ( 88) 
   7608  8678 ce070109r1    862 (  0)  1.48 0.59 0.10   49 ( 48)   10 ( 30) 
   7733  8772 ah020109r1     44 (  0)  1.82 0.00 0.00   51 ( 51)  934 (934) 
   7786  8825 bg070109r1    758 (  0)  1.98 1.10 0.11   49 ( 49)   80 (140) 
   7878  8934 ba040109f1    871 (  0)  0.41 0.72 0.00   24 ( 24)   64 ( 55) 
   7885  9002 ah070109r1    237 (  0)  9.11 0.00 0.76   71 ( 71)  652 (652) 
   7951  8979 dd110109r1    866 (  0)  0.20 1.23 0.10   47 ( 47)    3 ( 14) 
   7959  8987 bh030109r1    801 (  0)  1.16 1.69 0.00   53 ( 53)   31 ( 96) 
C  8006  9026 be010109r1    816 (  0)  0.76 0.86 0.11   45 ( 54)   50 ( 50) 
   8125  9148 ch110109r1    806 (  0)  1.04 1.67 0.00   48 ( 48)   17 ( 52) 
C  8360  9456 bd060109f1    839 (  0)  1.61 1.10 0.10   51 (132)   50 ( 50) 
   8371  9375 cg120109r1    868 (  0)  0.73 0.00 0.21   50 ( 50)    1 (  6) 
   8456  9499 bb030109r1    819 ( 42)  1.15 1.26 0.10   52 ( 52)   37 ( 35) 
   8555  9587 df110109f1    878 ( 67)  1.01 0.61 0.10   42 ( 47)    4 (  4) 
C  8587  9631 dd020109r1    884 (  0)  1.31 0.20 0.20    3 ( 29)   48 ( 48) 
   8609  9628 da110109r1    809 ( 68)  1.67 1.04 0.10   48 ( 48)   15 ( 66) 
   8630  9711 bd030109r1    589 ( 53)  6.29 0.81 0.47   65 ( 65)  158 (223) 
   8673  9725 ae090109f1    863 ( 34)  1.04 0.41 0.00   25 ( 25)   63 ( 68) 
   8832  9868 da100109f1    782 ( 64)  0.23 1.37 0.00  112 (112)   47 ( 64) 
   8837  9893 ba100109f1    702 (  0)  0.77 0.26 0.00   30 ( 30)  248 (252) 
   8844  9863 aa010109r1    807 ( 38)  1.42 0.66 0.00   49 ( 49)   56 ( 56) 
   9050 10072 ah100109r1    847 ( 89)  0.94 1.47 0.00   49 ( 49)   19 ( 51) 
   9074 10171 bf080109r1    652 ( 32)  5.44 1.16 0.12   71 (109)  163 (285) 
C  9096 10212 bg070109f1    835 (134)  0.65 1.41 0.00  108 (148)   87 ( 87) 
C  9176 10255 ce070109f1    912 (150)  0.92 0.61 0.00   15 ( 59)   82 ( 82) 
   9202 10251 cg070109r1    883 (142)  2.10 0.80 0.10   48 ( 48)    3 ( 53) 
   9210 10252 dh060109r1    923 (184)  0.91 0.40 0.20   49 ( 49)    1 (  9) 
C  9226 10249 bg120109r1    772 (134)  3.01 1.40 0.11   24 ( 85)   69 ( 69) 
   9230 10280 bd050109f1    914 (178)  1.08 1.27 0.10   20 ( 20)   11 ( 67) 
   9241 10291 cb060109r1    919 (193)  1.20 0.70 0.10   47 ( 47)    2 (  2) 
   9251 10323 be030109r1    855 (161)  0.45 0.45 0.00   49 ( 49)  126 (126) 
   9288 10353 ba030109r1    784 (150)  2.61 1.30 0.11   58 ( 58)   88 ( 92) 
   9294 10345 cc020109f1    913 (209)  0.72 0.82 0.00   74 ( 81)    6 (  6) 
C  9352 10375 bh030109f1    916 (212)  1.00 1.00 0.10    0 ( 40)   24 ( 24) 
   9351 10387 da070109f1    928 (206)  0.60 1.19 0.10   30 ( 56)    0 (  0) 
   9349 10411 dh080109r1    819 (180)  2.33 1.38 0.11   46 ( 46)   72 (140) 
   9351 10380 aa090109f1    883 (224)  2.60 0.80 0.00   30 ( 30)    1 ( 95) 
C  9425 10461 ba040109r1    893 (230)  1.83 0.71 0.00    9 ( 78)   44 ( 44) 
C  9425 10485 dd070109r1    949 (212)  1.09 0.40 0.00    7 ( 19)   48 ( 48) 
C  9498 10545 bg050109r1    709 (209)  4.07 2.20 0.00   78 (194)   62 (102) 
   9542 10590 ac030109r1    893 (230)  2.43 0.40 0.00   46 ( 46)   14 (118) 
   9598 10645 ca080109r1    912 (  0)  1.21 0.71 0.20   49 ( 49)    9 ( 18) 
   9668 10720 cd030109r1    954 (  0)  0.70 0.30 0.20   46 ( 46)    2 (  2) 
C  9679 10736 dh070109f1     53 ( 44)  1.75 0.00 0.00  922 (922)   79 ( 83) 
   9720 10773 bc020109r1    847 ( 57)  0.99 0.88 0.00   70 ( 70)   72 (107) 
C  9855 10901 bd030109f1    888 (104)  1.22 1.02 0.10   40 ( 98)   26 ( 26) 
C  9922 10945 ah070109f1    894 (151)  1.02 1.22 0.00    9 (  9)   35 ( 35) 
   9929 10985 ch070109r1    905 (101)  0.75 0.00 0.11   46 ( 46)   74 ( 74) 
C  9940 10959 da110109f1    870 (  0)  1.28 0.64 0.00    0 ( 49)   81 ( 81) 
C  9959 10996 dd010109r1    862 (148)  1.08 0.76 0.00   61 (112)   50 ( 50) 
  10160 11204 bg040109r1    854 ( 57)  0.54 1.50 0.00   46 ( 46)   65 ( 95) 
C 10233 11281 ae090109r1    890 ( 82)  1.20 1.60 0.00    6 ( 74)   43 ( 41) 
C 10304 11341 bb030109f1    909 (319)  1.59 0.59 0.20    6 ( 89)   23 ( 23) 
  10321 11350 ac100109r1    873 (115)  0.94 1.15 0.00   52 ( 52)   24 ( 24) 
C 10332 11364 df110109r1    907 (  0)  0.20 1.33 0.00    3 ( 42)   50 ( 50) 
C 10333 11367 dd110109f1    923 (  0)  1.19 0.50 0.30    0 ( 55)   25 ( 25) 
C 10368 11420 cd030109f1    945 (  0)  0.49 1.17 0.00    7 (  7)   23 ( 23) 
C 10375 11389 cg120109f1    913 (  0)  0.81 1.01 0.00    0 ( 25)   23 ( 23) 
  10459 11450 aa110109r1    860 ( 53)  1.58 0.84 0.00   44 ( 44)    1 ( 56) 
  10485 11529 ag070109r1    860 (398)  0.98 0.65 0.00   43 ( 43)   79 (110) 
C 10506 11537 dc010109f1    912 (  0)  0.73 0.21 0.00    0 ( 18)   78 ( 78) 
C 10513 11571 bd050109r1    890 (  0)  1.65 0.31 0.10   41 ( 66)   48 ( 48) 
C 10524 11581 cb060109f1    966 ( 61)  1.36 0.29 0.00    2 ( 25)   24 ( 24) 
C 10544 11584 dh060109f1    905 (  0)  0.93 0.41 0.10    0 (  0)   76 ( 76) 
  10551 11603 dh070109r1    103 (  0)  1.82 0.00 0.00   50 ( 50)  893 (893) 
C 10575 11624 cc020109r1    956 (  0)  1.10 0.00 0.10    0 (  0)   46 ( 46) 
C 10649 11671 aa010109f1    853 (  0)  2.22 1.31 0.10    0 (121)   32 ( 32) 
C 10835 11882 ac030109f1    891 (  0)  1.20 1.40 0.00   18 (115)   30 ( 30) 
  10879 11922 dh050109r1    903 ( 43)  1.14 0.31 0.00   50 ( 50)   30 ( 41) 
  10885 11896 bf010109r1    867 ( 36)  0.44 0.11 0.11   54 ( 54)   54 ( 54) 
C 10939 11961 bc020109f1    906 ( 95)  1.22 0.31 0.20   12 ( 27)   29 ( 34) 
C 11004 12428 ba050109f1     42 ( 42)  7.02 9.65 0.00 1203 (1267)  108 (133) 
C 11085 12119 da070109r1    940 (212)  0.71 0.10 0.00    6 ( 28)   47 ( 47) 
C 11153 12201 be030109f1    923 (239)  1.66 0.19 0.49    0 ( 68)   23 ( 21) 
  11176 12275 cf010109r1    420 (170)  9.71 1.21 0.15  105 (134)  336 (451) 
  11184 12216 cg020109r1    909 (235)  0.91 0.81 0.00   47 ( 47)    0 (  0) 
C 11207 12264 cc090109f1    970 (313)  0.29 0.87 0.00    0 ( 16)   24 ( 24) 
  11205 12268 ce060109r1    933 (375)  0.80 0.40 0.10   45 ( 45)   23 ( 27) 
C 11292 12448 db040109f1      7 (  0)  0.00 0.00 0.00  119 (1077) 1030 ( 49) 
C 11201 12356 dd050109f1      8 ( 40)  0.00 0.00 0.00  674 (1067)  472 ( 55) 
  11273 12300 ae010109r1    824 (333)  0.77 1.33 0.00   47 ( 47)   76 (110) 
C 11327 12320 aa110109f1    842 (409)  0.66 0.99 0.00    4 ( 21)   80 ( 80) 
C 11305 12406 cg100109f1      6 (  0)  0.00 0.00 0.00  476 (1021)  618 ( 51) 
C 11358 12434 cg050109f1      7 (  0)  0.00 0.00 0.00 1028 (995)   42 ( 51) 
C 11352 12458 ba030109f1    859 (520)  2.50 1.00 0.20   18 (124)   88 ( 88) 
C 11374 12406 bg040109f1    909 (541)  2.01 0.30 0.00    8 ( 58)   29 ( 29) 
C 11375 12398 ch110109f1    904 (526)  1.03 0.51 0.21   16 ( 50)   34 ( 38) 
C 11413 12419 dg010109f1    915 (559)  1.43 0.20 0.00    0 ( 12)   25 ( 25) 
C 11530 12579 ca080109f1    965 (618)  0.78 0.10 0.29    0 ( 20)   27 ( 27) 
  11544 12584 db020109r1    897 (675)  1.82 0.40 0.20   51 ( 51)    0 ( 12) 
  11759 12796 bf050109r1    828 (776)  3.05 1.12 0.10   47 ( 46)    9 (167) 
  11759 12867 cf060109r1    970 (561)  0.68 0.39 0.00   48 ( 48)   37 (  6) 
  11760 12815 af060109r1    876 (562)  1.43 1.02 0.10   47 ( 47)   32 ( 30) 
  11763 12831 df050109r1    925 (566)  0.91 0.40 0.10   44 ( 44)   35 ( 47) 
  11844 12900 dg070109r1    875 (486)  1.17 0.32 0.00   47 ( 47)   73 ( 41) 
  11918 12953 ag040109r1    867 (416)  2.07 0.62 0.00   48 ( 48)   24 ( 87) 
C 11975 13050 cg070109f1    887 (281)  0.82 1.33 0.00   70 (103)   29 ( 29) 
  12008 13072 cd080109r1    944 (323)  0.81 0.30 0.00   46 ( 46)   28 ( 50) 
C 12014 13031 ac100109f1    935 (323)  0.40 0.70 0.10    0 (  0)   25 ( 25) 
  12052 13040 ba120109r1    811 (258)  1.70 0.34 0.11   65 ( 65)   40 ( 62) 
C 12099 13104 ae010109f1    876 (190)  0.92 1.54 0.00    7 ( 57)   23 ( 23) 
C 12097 13110 bf010109f1    839 (159)  0.55 1.00 0.00   87 ( 91)   26 ( 26) 
C 12187 13248 aa090109r1    784 ( 81)  2.71 1.08 0.22   23 (101)  115 (119) 
C 12204 13244 ag070109f1    877 ( 81)  0.93 1.34 0.10   43 ( 60)   27 ( 27) 
C 12250 13302 dh080109f1    963 ( 99)  0.88 0.49 0.10    1 (  1)   25 ( 25) 
C 12248 13267 be120109f1    417 ( 48)  0.24 0.00 0.00  573 (573)   26 ( 26) 
  12284 13282 aa120109r1    790 (134)  1.03 1.14 0.23   65 ( 65)   56 (126) 
  12295 13376 ac060109r1    822 ( 87)  0.57 0.69 0.00   46 ( 46)  165 (182) 
C 12300 13553 cf010109f1    326 ( 99)  5.21 1.42 0.00  726 (726)  106 (115) 
C 12327 13359 da100109r1    856 ( 75)  1.38 0.96 0.00   41 ( 99)   50 ( 50) 
C 12344 13418 ba100109r1    826 ( 75)  1.42 0.98 0.00   49 ( 75)  112 (112) 
  12424 13490 de070109f1    935 ( 76)  2.05 0.29 0.10   23 ( 23)   20 ( 40) 
  12457 13586 dd080109r1    249 ( 44)  17.57 1.39 0.46  142 (176)  339 (339) 
  12465 13516 de080109r1    924 ( 76)  1.22 0.31 0.00   48 ( 48)   21 ( 39) 
  12487 13539 ce100109r1    943 ( 75)  0.80 0.50 0.10   48 ( 48)    0 (  0) 
C 12498 13538 cg020109f1    977 ( 73)  0.39 0.49 0.00    0 (  0)   25 ( 25) 
  12698 13739 de030109r1    392 (113)  5.30 0.39 1.18   48 ( 48)  485 (596) 
C 12756 13797 dh050109f1    944 ( 36)  1.18 0.39 0.20    2 ( 22)   25 ( 25) 
C 12772 13840 ce060109f1    975 ( 73)  0.77 0.86 0.00    0 ( 36)   25 ( 25) 
  12773 13780 be120109r1    418 ( 45)  0.24 0.00 0.00   48 ( 48)  538 (757) 
C 13069 14119 ch070109f1    943 (  0)  0.98 0.78 0.10    0 ( 42)   27 ( 27) 
C 13123 14184 de030109f1    934 (  0)  1.94 0.39 0.00    8 ( 65)   25 ( 25) 
  13130 14201 de120109f1    407 (  0)  13.54 0.65 0.52   26 ( 86)  278 (318) 
  13132 14162 de110109f1    913 (  0)  0.60 0.40 0.70   21 ( 21)    9 (  9) 
  13149 14226 cc060109f1    880 (  0)  0.70 1.80 0.10   69 ( 69)   10 ( 78) 
C 13179 14230 ag040109f1    857 (  0)  0.53 1.37 0.00   80 ( 94)   26 ( 26) 
  13329 14376 ad100109r1    865 (  0)  0.52 1.34 0.00   53 ( 53)   27 ( 63) 
C 13335 14378 db020109f1    942 (  0)  0.69 0.20 0.20    0 (  5)   25 ( 25) 
C 13435 14456 de110109r1    356 ( 38)  2.93 2.93 0.20  466 (529)   44 ( 44) 
  13430 14463 dh120109f1    819 ( 43)  0.67 0.45 0.11  102 (113)   37 ( 37) 
  13448 14486 dg120109f1      5 (  0)  0.00 0.00 0.00   35 ( 21)  998 (942) 
  13403 14460 dg030109f1      5 (  0)  0.00 0.00 0.00 1041 (  7)   10 (973) 
  13391 14428 db010109f1      5 (  0)  0.00 0.00 0.00   14 (  6) 1018 (957) 
  13419 14495 cf080109f1      5 (  0)  0.00 0.00 0.00  991 (  6)   79 (994) 
  13553 14574 ca010109f1    875 (  0)  1.62 0.51 0.10   28 ( 28)    8 ( 59) 
C 13589 14692 cf060109f1    964 (  0)  0.56 1.03 0.00   10 ( 39)   29 ( 12) 
C 13600 14675 de070109r1    878 (  0)  0.71 0.92 0.10   49 ( 66)   47 ( 47) 
C 13615 14690 df050109f1    879 ( 53)  1.12 0.41 0.10   70 ( 70)   27 ( 11) 
C 13626 14694 af060109f1    825 (  0)  0.74 1.38 0.00   97 (148)   28 ( 13) 
C 13652 14691 bf050109f1    821 ( 32)  1.86 1.24 0.00   44 ( 44)   28 ( 16) 
C 13749 14814 cd080109f1    904 ( 68)  0.20 1.18 0.00   29 ( 25)   19 ( 19) 
C 13745 14734 ba120109f1    745 ( 59)  2.73 0.98 0.11   33 ( 88)   42 ( 42) 
C 13927 14893 aa120109f1    787 (  0)  0.64 1.60 0.00    5 ( 41)   25 ( 25) 
C 13927 15191 dd080109f1     82 (  0)  16.81 1.26 1.26  910 (1053)  117 (129) 
C 14137 15192 de080109f1    910 (  0)  0.97 0.68 0.00    6 ( 53)   23 ( 23) 
C 14162 15217 ac060109f1    842 (  0)  1.20 1.70 0.10   29 ( 91)   27 ( 27) 
C 14230 15285 ce100109f1    920 ( 36)  0.79 0.30 0.00   25 ( 14)   23 ( 23) 
C 14338 15395 cc060109r1    884 ( 93)  2.47 0.20 0.00    3 ( 90)   43 ( 43) 
C 14466 15524 dg070109f1    888 (  0)  1.49 0.60 0.00    3 ( 39)   49 ( 90) 
C 14543 15575 ad100109f1    922 (  0)  0.78 0.39 0.00    9 ( 18)    0 (140) 

Overall discrep rates (%):             1.59 0.77 0.10

Contig quality (quality, n_residues, %,  cum, cum %,  cum expected errs):
 90   12425  79.8   12425  79.8    0.00
 89       4   0.0   12429  79.8    0.00
 88       9   0.1   12438  79.9    0.00
 87       8   0.1   12446  79.9    0.00
 86      14   0.1   12460  80.0    0.00
 85      11   0.1   12471  80.1    0.00
 84       9   0.1   12480  80.1    0.00
 83       8   0.1   12488  80.2    0.00
 82       6   0.0   12494  80.2    0.00
 81      34   0.2   12528  80.4    0.00
 80       9   0.1   12537  80.5    0.00
 79      14   0.1   12551  80.6    0.00
 78       9   0.1   12560  80.6    0.00
 77      11   0.1   12571  80.7    0.00
 76       8   0.1   12579  80.8    0.00
 75      20   0.1   12599  80.9    0.00
 74      15   0.1   12614  81.0    0.00
 73      19   0.1   12633  81.1    0.00
 72       2   0.0   12635  81.1    0.00
 71       2   0.0   12637  81.1    0.00
 70       1   0.0   12638  81.1    0.00
 69       5   0.0   12643  81.2    0.00
 66    1818  11.7   14461  92.8    0.00
 64       1   0.0   14462  92.9    0.00
 61     239   1.5   14701  94.4    0.00
 60      46   0.3   14747  94.7    0.00
 58      12   0.1   14759  94.8    0.00
 57       5   0.0   14764  94.8    0.00
 56     177   1.1   14941  95.9    0.00
 55      45   0.3   14986  96.2    0.00
 54      42   0.3   15028  96.5    0.00
 53      45   0.3   15073  96.8    0.00
 52      49   0.3   15122  97.1    0.00
 51      35   0.2   15157  97.3    0.00
 50      78   0.5   15235  97.8    0.00
 49       2   0.0   15237  97.8    0.00
 48       9   0.1   15246  97.9    0.00
 47       7   0.0   15253  97.9    0.00
 46       8   0.1   15261  98.0    0.00
 45       7   0.0   15268  98.0    0.00
 44      12   0.1   15280  98.1    0.00
 43      33   0.2   15313  98.3    0.01
 42      65   0.4   15378  98.7    0.01
 41       1   0.0   15379  98.7    0.01
 40      44   0.3   15423  99.0    0.01
 39       1   0.0   15424  99.0    0.01
 38       8   0.1   15432  99.1    0.02
 37      13   0.1   15445  99.2    0.02
 36       1   0.0   15446  99.2    0.02
 35       2   0.0   15448  99.2    0.02
 34       2   0.0   15450  99.2    0.02
 33       8   0.1   15458  99.2    0.02
 32       2   0.0   15460  99.3    0.03
 29       2   0.0   15462  99.3    0.03
 27       3   0.0   15465  99.3    0.03
 25       3   0.0   15468  99.3    0.04
 24       3   0.0   15471  99.3    0.06
 23       2   0.0   15473  99.3    0.07
 22       2   0.0   15475  99.4    0.08
 20       1   0.0   15476  99.4    0.09
 19       1   0.0   15477  99.4    0.10
 17       3   0.0   15480  99.4    0.16
 16       1   0.0   15481  99.4    0.19
 15       1   0.0   15482  99.4    0.22
 14       2   0.0   15484  99.4    0.30
 13       1   0.0   15485  99.4    0.35
 12       1   0.0   15486  99.4    0.41
  8       2   0.0   15488  99.4    0.73
 -1      87   0.6   15575 100.0   87.73   (quality -1 = terminal quality 0)

Avg. full length: 15575.0, trimmed (qual > -1): 15488.0
Avg. quality: 84.1 per base

Initial, terminal qual 0 segments:  1-3, 15492-15575

Regions of LLR- adjusted quality < 2.0:
1-3, 30-33, 70-72, 15456-15460, 15492-15575, 

5 regions, avg size 19.8, avg spacing 3115.0

First_start: 183, last_end: 15435
 Unused pair: ae110109f1 cf050109r1  4.1   2
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=19), >20:0.0 (#=0); in HQ: -0.2, out HQ -0.6), match: 4.0  lead: 0.0  total: 3.2  145  7.66 0.00 1.44  ae110109f1      804  1012 (0)    cf050109r1       50   255 (832) *
 Unused pair: cf050109f1 cf050109r1  5.1   0
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=7), >20:0.0 (#=0); in HQ: -0.3, out HQ -0.2), match: 5.4  trail: 0.0  lead: 0.0  total: 4.9  235  2.71 0.00 0.00  cf050109f1       19   276 (803)  C cf050109r1   (780)   307    50 *
 Unused pair: ca090109f1 cf050109r1  4.6   5
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=22), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.8), match: 4.9  trail: -0.1  lead: 0.0  total: 4.0  173  7.47 0.41 1.24  ca090109f1      779  1019 (32)    cf050109r1       50   288 (799)  
 Unused pair: cd020109f1 cf050109r1  0.0   0
LLR breakdown: discreps: -1.4 (<20 part: -1.4 (#=51), >20:0.0 (#=0); in HQ: 0.0, out HQ -1.4), match: 3.5  trail: 0.0  lead: -20.0  total: -17.9   80 24.04 0.48 0.00  cd020109f1       59   266 (799)  C cf050109r1   (789)   298    90  
 Unused pair: cb100109r1 cf050109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: 0.0  lead: -20.0  total: -14.7  238  1.20 0.00 0.00  cb100109r1       73   321 (718)  C cf050109r1   (789)   298    50 *
 Unused pair: ag020109r1 cf050109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: 0.0  lead: -20.0  total: -14.7  238  1.20 0.00 0.00  ag020109r1      120   368 (656)  C cf050109r1   (789)   298    50 *
 Unused pair: be040109r1 cf050109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  be040109r1      582   830 (211)    cf050109r1       50   298 (789) *
 Unused pair: ag120109f1 cf050109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: 0.0  lead: -20.0  total: -14.7  238  1.20 0.00 0.00  ag120109f1      191   439 (565)  C cf050109r1   (789)   298    50 *
 Unused pair: bc010109f1 cf050109r1  -6.1   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  bc010109f1      531   779 (241)    cf050109r1       50   298 (789) *
 Unused pair: bd090109r1 cf050109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: 0.0  lead: -20.0  total: -14.7  238  1.20 0.00 0.00  bd090109r1      294   542 (514)  C cf050109r1   (789)   298    50 *
 Unused pair: cb120109f1 cf050109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: 0.0  lead: -20.0  total: -14.7  238  1.20 0.00 0.00  cb120109f1      367   615 (424)  C cf050109r1   (789)   298    50 *
 Unused pair: bb040109r1 cf050109r1  -6.1   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  bb040109r1      413   661 (400)    cf050109r1       50   298 (789) *
 Unused pair: ab080109r1 cf050109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  ab080109r1      371   619 (446)    cf050109r1       50   298 (789) *
 Unused pair: cf040109r1 cf050109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  cf040109r1      244   492 (575)    cf050109r1       50   298 (789) *
 Unused pair: bc030109r1 cf050109r1  -6.1   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  bc030109r1      217   465 (595)    cf050109r1       50   298 (789) *
 Unused pair: ba050109r1 cf050109r1  0.0   0
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=14), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.3), match: 1.2  trail: -0.9  lead: 0.0  total: 0.0   48 13.86 0.00 0.00  ba050109r1      282   382 (783)    cf050109r1      198   298 (789)  
 Unused pair: bd070109f1 cf050109r1  -6.1   1
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=6), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.3), match: 5.5  trail: 0.0  lead: -20.0  total: -14.8  227  1.59 0.00 0.80  bd070109f1      719   969 (103)  C cf050109r1   (789)   298    50 *
 Unused pair: cf050109r1 dh090109f1  4.6   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 4.6  lead: 0.0  total: 4.4  201  1.42 0.00 0.00  cf050109r1       50   260 (827)  C dh090109f1   (750)   311   101  
 Unused pair: cf050109r1 dh040109f1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  cf050109r1       50   298 (789)  C dh040109f1   (247)   796   548 *
 Unused pair: cf050109r1 dh010109r1  -11.5   0
LLR breakdown: discreps: -1.1 (<20 part: -1.1 (#=18), >20:0.0 (#=0); in HQ: 0.0, out HQ -1.1), match: 2.4  trail: -20.0  lead: 0.0  total: -18.7   79 14.29 0.00 0.00  cf050109r1      173   298 (789)    dh010109r1       44   169 (825) *
 Unused pair: cf050109r1 dd060109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  cf050109r1       50   298 (789)    dd060109r1      103   351 (723) *
 Unused pair: cf050109r1 db120109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  cf050109r1       50   298 (789)  C db120109r1   (636)   383   135 *
 Unused pair: cf050109r1 db090109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  cf050109r1       50   298 (789)    db090109r1      487   735 (308) *
 Unused pair: cf050109r1 da040109f1  -6.2   0
LLR breakdown: discreps: -0.5 (<20 part: -0.5 (#=6), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.5), match: 5.5  trail: -20.0  lead: 0.0  total: -15.0  225  1.20 0.80 0.40  cf050109r1       50   298 (789)  C da040109f1   (56)   985   736 *
 Unused pair: cf050109r1 da010109r1  -9.3   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=3), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 4.1  trail: -20.0  lead: -1.8  total: -17.8  175  1.62 0.00 0.00  cf050109r1      114   298 (789)    da010109r1       52   236 (782) *
 Unused pair: cf050109r1 ch100109r1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  cf050109r1       50   298 (789)    ch100109r1      169   417 (623) *
 Unused pair: cf050109r1 ch080109r1  5.2   0
LLR breakdown: discreps: -0.4 (<20 part: -0.4 (#=9), >20:0.0 (#=0); in HQ: -0.2, out HQ -0.2), match: 5.2  trail: -0.3  lead: 0.0  total: 4.5  209  2.49 1.24 0.00  cf050109r1       50   290 (797)    ch080109r1      780  1023 (32) *
 Unused pair: cf050109r1 cf120109f1  -6.1   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7  238  1.20 0.00 0.00  cf050109r1       50   298 (789)  C cf120109f1   (225)   797   549 *
 Unused pair: bg100109f1 cf050109r1  -7.3   5
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=27), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.2), match: 2.7  trail: 0.0  lead: -20.0  total: -17.5  107  6.94 0.00 5.56  bg100109f1      837  1052 (3)  C cf050109r1   (789)   298    95  
 Unused pair: ac110109r1 dh020109f1  -8.9   2
LLR breakdown: discreps: -1.4 (<20 part: -1.4 (#=14), >20:0.0 (#=0); in HQ: -0.6, out HQ -0.8), match: 2.3  trail: -11.2  lead: 0.0  total: -10.3   71 11.21 0.86 0.00  ac110109r1       48   163 (866)    dh020109f1      816   932 (89) *
 Unused pair: ac110109r1 dg040109f1  -8.7   0
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=7), >20:0.0 (#=0); in HQ: -0.8, out HQ 0.0), match: 2.5  trail: -11.2  lead: 0.0  total: -9.5   92  5.17 0.86 0.00  ac110109r1       48   163 (866)    dg040109f1      626   742 (317) *
 Unused pair: ac110109r1 df070109f1  -8.7   1
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=7), >20:0.0 (#=0); in HQ: -0.8, out HQ 0.0), match: 2.5  trail: -11.2  lead: 0.0  total: -9.5   92  5.17 0.86 0.00  ac110109r1       48   163 (866)    df070109f1      327   443 (610) *
 Unused pair: ac110109r1 df040109f1  -8.7   1
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=7), >20:0.0 (#=0); in HQ: -0.8, out HQ 0.0), match: 2.5  trail: -11.2  lead: 0.0  total: -9.5   92  5.17 0.86 0.00  ac110109r1       48   163 (866)    df040109f1      255   371 (689) *
 Unused pair: ac110109r1 dd020109f1  -7.1   1
LLR breakdown: discreps: -1.0 (<20 part: -1.0 (#=9), >20:0.0 (#=0); in HQ: -1.0, out HQ 0.0), match: 2.4  trail: -9.7  lead: 0.0  total: -8.3   86  6.90 0.86 0.00  ac110109r1       48   163 (866)  C dd020109f1   (871)   173    57 *
 Unused pair: ac110109r1 ch020109r1  -9.2   0
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=14), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.8), match: 2.0  trail: -11.2  total: -10.0   53 10.00 4.00 0.00  ac110109r1       64   163 (866)  C ch020109r1   (0)  1015   912  
 Unused pair: ac110109r1 bb040109f1  -8.7   1
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=7), >20:0.0 (#=0); in HQ: -0.8, out HQ 0.0), match: 2.5  trail: -11.2  lead: 0.0  total: -9.5   92  5.17 0.86 0.00  ac110109r1       48   163 (866)    bb040109f1       75   191 (865) *
 Unused pair: ac110109r1 ba010109r1  -8.7   0
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=7), >20:0.0 (#=0); in HQ: -0.8, out HQ 0.0), match: 2.5  trail: -11.2  lead: 0.0  total: -9.5   92  5.17 0.86 0.00  ac110109r1       48   163 (866)  C ba010109r1   (608)   424   308 *
 Unused pair: ag040109r1 be120109r1  1.1   3
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=20), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.0  trail: 0.0  lead: 0.0  total: 1.0   45 14.16 0.00 3.54  ag040109r1      906  1018 (24)    be120109r1       49   157 (851)  
 Unused pair: ac100109f1 be120109r1  4.1   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 4.1  trail: 0.0  lead: 0.0  total: 4.0  183  0.54 0.00 0.00  ac100109f1       26   211 (813)  C be120109r1   (774)   234    49 *
 Unused pair: ba120109r1 be120109r1  3.6   1
LLR breakdown: discreps: -0.9 (<20 part: -0.9 (#=18), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.9), match: 3.3  trail: 0.0  lead: 0.0  total: 2.4  124  8.79 0.00 1.10  ba120109r1      770   951 (40)    be120109r1       49   228 (780)  
 Unused pair: ae010109f1 be120109r1  5.7   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 5.8  trail: 0.0  lead: 0.0  total: 5.7  258  0.38 0.00 0.00  ae010109f1       24   284 (737)  C be120109r1   (699)   309    49 *
 Unused pair: aa090109r1 be120109r1  6.0   3
LLR breakdown: discreps: -0.7 (<20 part: -0.7 (#=8), >20:0.0 (#=0); in HQ: -0.1, out HQ -0.6), match: 6.8  trail: 0.0  lead: 0.0  total: 6.1  286  1.58 0.00 0.95  aa090109r1      116   431 (639)  C be120109r1   (647)   361    49 *
 Unused pair: ag070109f1 be120109r1  8.7   1
LLR breakdown: discreps: -0.4 (<20 part: -0.4 (#=4), >20:0.0 (#=0); in HQ: -0.4, out HQ 0.0), match: 8.8  trail: 0.0  lead: 0.0  total: 8.4  382  0.76 0.25 0.00  ag070109f1       28   423 (630)  C be120109r1   (563)   445    49 *
 Unused pair: be120109f1 be120109r1  9.3   1
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=4), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 9.3  trail: 0.0  lead: 0.0  total: 9.1  422  0.69 0.23 0.00  be120109f1       11   447 (573)  C be120109r1   (522)   486    49 *
 Unused pair: aa120109r1 be120109r1  8.6   0
LLR breakdown: discreps: -1.1 (<20 part: -1.1 (#=21), >20:0.0 (#=0); in HQ: -0.1, out HQ -1.0), match: 7.6  trail: 0.0  lead: 0.0  total: 6.5  328  2.17 0.48 2.42  aa120109r1      538   951 (56)    be120109r1       49   454 (554)  
 Unused pair: ac060109r1 be120109r1  8.4   1
LLR breakdown: discreps: -2.5 (<20 part: -2.5 (#=11), >20:0.0 (#=0); in HQ: -0.1, out HQ -2.4), match: 8.3  trail: 0.0  lead: 0.0  total: 5.8  351  1.26 0.00 1.51  ac060109r1      527   923 (165)    be120109r1       49   439 (569)  
 Unused pair: ba100109r1 be120109r1  -11.7   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 9.4  trail: 0.0  lead: -21.1  total: -11.8  417  0.24 0.00 0.00  ba100109r1      177   598 (486)  C be120109r1   (538)   470    49 *
 Unused pair: be120109r1 dh080109f1  -11.7   1
LLR breakdown: discreps: -0.4 (<20 part: -0.4 (#=3), >20:0.0 (#=0); in HQ: -0.4, out HQ 0.0), match: 9.3  trail: -21.1  lead: 0.0  total: -12.2  412  0.71 0.00 0.00  be120109r1       49   470 (538)  C dh080109f1   (576)   481    60 *
 Unused pair: be120109r1 dh050109f1  -11.8   1
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=8), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.3), match: 9.2  trail: -21.1  lead: 0.0  total: -12.2  394  1.42 0.24 0.24  be120109r1       49   470 (538)  C dh050109f1   (67)   977   556 *
 Unused pair: be120109r1 de120109f1  -0.3   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=15), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.1), match: 0.5  trail: -0.5  lead: 0.0  total: -0.1   37 16.47 0.00 1.18  be120109r1      384   468 (540)    de120109f1       27   110 (963) *
 Unused pair: be120109r1 de110109f1  -19.2   0
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=2), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 2.0  trail: -21.1  lead: 0.0  total: -19.1   79  0.00 1.11 1.11  be120109r1      381   470 (538)    de110109f1       22   111 (917) *
 Unused pair: be120109r1 de080109r1  -11.7   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 9.4  trail: -21.1  lead: 0.0  total: -11.8  418  0.24 0.00 0.00  be120109r1       49   470 (538)    de080109r1      357   778 (277) *
 Unused pair: be120109r1 de070109f1  -11.7   1
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 9.4  trail: -21.1  lead: 0.0  total: -11.8  418  0.24 0.00 0.00  be120109r1       49   470 (538)    de070109f1      397   818 (251) *
 Unused pair: be120109r1 de030109r1  8.6   1
LLR breakdown: discreps: -0.6 (<20 part: -0.6 (#=33), >20:0.0 (#=0); in HQ: -0.1, out HQ -0.5), match: 7.0  trail: 0.0  lead: 0.0  total: 6.4  312  5.92 0.47 1.42  be120109r1       49   470 (538)    de030109r1      124   541 (497) *
 Unused pair: be120109r1 de030109f1  2.1   1
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=16), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.2  trail: 0.0  lead: 0.0  total: 1.2   58 11.71 2.70 0.00  be120109r1      359   469 (539)  C de030109f1   (8)  1058   945  
 Unused pair: be120109r1 dd080109r1  7.3   3
LLR breakdown: discreps: -10.8 (<20 part: -10.8 (#=96), >20:0.0 (#=0); in HQ: -1.0, out HQ -9.8), match: 7.3  trail: 0.0  lead: 0.0  total: -3.5  123 21.48 1.19 0.24  be120109r1       49   467 (541)    dd080109r1      366   788 (348) *
 Unused pair: be120109r1 da100109r1  -0.9   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 9.3  trail: -10.4  lead: 0.0  total: -1.2  416  0.24 0.00 0.00  be120109r1       49   468 (540)  C da100109r1   (503)   539   120 *
 Unused pair: be120109r1 ch070109f1  0.4   0
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=16), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.2), match: 2.9  trail: -3.8  total: -1.1  116  4.60 4.60 0.00  be120109r1      297   470 (538)  C ch070109f1   (0)  1058   877  
 Unused pair: be120109r1 cg070109f1  2.6   1
LLR breakdown: discreps: -3.5 (<20 part: -0.9 (#=6), >20:-2.6 (#=1); in HQ: -3.3, out HQ -0.2), match: 4.4  trail: 0.0  lead: 0.0  total: 0.9  178  2.49 1.00 0.00  be120109r1       49   249 (759)  C cg070109f1   (857)   232    30 *
 Unused pair: be120109r1 cg020109f1  -11.7   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 9.4  trail: -21.1  lead: 0.0  total: -11.8  418  0.24 0.00 0.00  be120109r1       49   470 (538)  C cg020109f1   (328)   718   297 *
 Unused pair: be120109r1 cf010109f1  -16.4   3
LLR breakdown: discreps: -2.1 (<20 part: -2.1 (#=14), >20:0.0 (#=0); in HQ: -1.4, out HQ -0.7), match: 4.6  trail: -21.1  lead: 0.0  total: -18.6  168  4.61 1.84 0.00  be120109r1      254   470 (538)  C cf010109f1   (726)   534   314 *
 Unused pair: be120109r1 ce100109r1  -11.7   0
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 9.4  trail: -21.1  lead: 0.0  total: -11.8  418  0.24 0.00 0.00  be120109r1       49   470 (538)    ce100109r1      335   756 (301) *
 Unused pair: be120109r1 ce060109f1  -11.7   3
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=7), >20:0.0 (#=0); in HQ: 0.0, out HQ -0.2), match: 9.3  trail: -21.1  lead: 0.0  total: -12.0  397  0.95 0.71 0.00  be120109r1       49   470 (538)  C ce060109f1   (53)  1025   601 *
 Unused pair: be120109r1 bf010109f1  5.5   1
LLR breakdown: discreps: -0.3 (<20 part: -0.3 (#=4), >20:0.0 (#=0); in HQ: -0.3, out HQ 0.0), match: 5.8  trail: 0.0  lead: 0.0  total: 5.5  251  1.14 0.38 0.00  be120109r1       49   312 (696)  C bf010109f1   (732)   291    27 *

Slack, # used pairs (max_score), unused
 0  1194  (21.6)    36 ( 8.6)     8435
 1  1291  (22.4)    19 ( 9.3)      921
 2   755  (21.8)     2 ( 4.1)        9
 3   425  (21.4)     5 ( 7.3)        1
 4   258  (21.4)     0 ( 0.0)        0
 5   149  (20.3)     2 ( 4.6)        0
 6   120  (21.3)     0 ( 0.0)        0
 7   115  (21.4)     0 ( 0.0)        0
 8    79  (21.0)     0 ( 0.0)        0
 9    40  (20.5)     0 ( 0.0)        0
10    24  (19.9)     0 ( 0.0)        0
11    10  (18.9)     0 ( 0.0)        0
12    10  (20.5)     0 ( 0.0)        0
15     1  ( 0.0)     0 ( 0.0)        0
17     1  ( 1.2)     0 ( 0.0)        0
18     1  ( 0.0)     0 ( 0.0)        0
22     1  ( 0.0)     0 ( 0.0)        0
23     1  ( 0.0)     0 ( 0.0)        0
33     2  ( 0.0)     0 ( 0.0)        0
34     1  ( 0.0)     0 ( 0.0)        0
38     1  ( 0.0)     0 ( 0.0)        0
44     2  ( 1.6)     0 ( 0.0)        0
45     1  ( 0.0)     0 ( 0.0)        0
51     1  ( 0.0)     0 ( 0.0)        0
52     1  ( 0.0)     0 ( 0.0)        0
59     1  ( 0.0)     0 ( 0.0)        0
68     1  ( 1.5)     0 ( 0.0)        0
70     0  ( 0.0)     2 (-5.7)        0
72     1  ( 0.0)     0 ( 0.0)        0
73     1  ( 0.0)     0 ( 0.0)        0
83     1  ( 0.0)     0 ( 0.0)        0
95     1  ( 1.3)     0 ( 0.0)        0
99     0  ( 0.0)  4810 (15.2)        0

LLR histograms (used, unused pairs): 

   DS Gap         Size      Closest read (Start)   Covers   Read length required
                                                    now?        to cover
Top strand: 
 left -     0        0+
14567 - right     1009+      ca010109f1   (13553)    No           2022+

Bottom strand: 
 left -  1708     1708+      ba060109r1   (2626)    No           2626+
15576 - right        0+

Read/contig alignment summary, by read base; trace qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
56  78816  78816 250851 (100.00)   122  0    0   0   0   0     0 (0.00)    0  6079 (2.42)
51  18298  97114 172035 ( 68.58)    28  0    0   0   0   0     0 (0.00)    0  6079 (3.53)
50   7181 104295 153737 ( 61.29)     6  0    0   0   0   0     0 (0.00)    0  6079 (3.95)
48   1487 105782 146556 ( 58.42)    28  0    0   0   0   0     0 (0.00)    0  6079 (4.15)
47   1164 106946 145069 ( 57.83)    11  0    0   0   0   0     0 (0.00)    0  6079 (4.19)
46   3702 110648 143905 ( 57.37)    45  0    0   0   0   0     0 (0.00)    0  6079 (4.22)
45   3629 114277 140203 ( 55.89)     9  0    0   0   0   0     0 (0.00)    0  6079 (4.34)
44   4855 119132 136574 ( 54.44)    45  0    0   0   0   0     0 (0.00)    0  6079 (4.45)
43   5436 124568 131719 ( 52.51)    25  0    0   0   0   0     0 (0.00)    0  6079 (4.62)
42  10809 135377 126283 ( 50.34)    62  0    0   0   0   0     0 (0.00)    0  6079 (4.81)
41    980 136357 115474 ( 46.03)     2  0    0   0   0   0     0 (0.00)    0  6079 (5.26)
40  13092 149449 114494 ( 45.64)   148  0    0   0   0   0     0 (0.00)    0  6079 (5.31)
39    498 149947 101402 ( 40.42)    11  0    0   0   0   0     0 (0.00)    0  6079 (5.99)
38    541 150488 100904 ( 40.22)     4  0    0   0   0   0     0 (0.00)    0  6079 (6.02)
37   3811 154299 100363 ( 40.01)    46  0    0   0   0   0     0 (0.00)    0  6079 (6.06)
36    362 154661  96552 ( 38.49)     7  0    0   0   0   0     0 (0.00)    0  6079 (6.30)
35   2480 157141  96190 ( 38.35)    27  0    0   0   2   0     2 (0.08)    2  6079 (6.32)
34   2127 159268  93710 ( 37.36)    28  0    0   0   0   0     0 (0.00)    2  6077 (6.48)
33   1529 160797  91583 ( 36.51)    54  0    0   0   0   0     0 (0.00)    2  6077 (6.64)
32   2099 162896  90054 ( 35.90)    81  0    0   0   1   0     1 (0.05)    3  6077 (6.75)
31   1244 164140  87955 ( 35.06)    25  0    0   0   0   0     0 (0.00)    3  6076 (6.91)
30    675 164815  86711 ( 34.57)    33  0    0   0   0   0     0 (0.00)    3  6076 (7.01)
29   4504 169319  86036 ( 34.30)   161  0    0   0   2   0     2 (0.04)    5  6076 (7.06)
28   1211 170530  81532 ( 32.50)    39  0    0   1   1   0     2 (0.17)    7  6074 (7.45)
27   1799 172329  80321 ( 32.02)    87  0    0   0   1   1     2 (0.11)    9  6072 (7.56)
26    591 172920  78522 ( 31.30)    69  0    0   0   0   0     0 (0.00)    9  6070 (7.73)
25   4047 176967  77931 ( 31.07)   127  0    0   0   2   0     2 (0.05)   11  6070 (7.79)
24   1949 178916  73884 ( 29.45)   101  0    0   1   3   0     4 (0.21)   15  6068 (8.21)
23   1250 180166  71935 ( 28.68)   109  0    0   3   0   3     6 (0.48)   21  6064 (8.43)
22   1660 181826  70685 ( 28.18)    80  0    0   1   1   0     2 (0.12)   23  6058 (8.57)
21   1845 183671  69025 ( 27.52)   126  0    0   2   0   2     4 (0.22)   27  6056 (8.77)
20   1702 185373  67180 ( 26.78)   125  0    0   2   3   1     6 (0.35)   33  6052 (9.01)
19   2781 188154  65478 ( 26.10)   238  0    0   7   7   1    15 (0.54)   48  6046 (9.23)
18   2169 190323  62697 ( 24.99)   127  0    0   5   0   1     6 (0.28)   54  6031 (9.62)
17   1811 192134  60528 ( 24.13)   124  0    0  10   2   8    20 (1.10)   74  6025 (9.95)
16   1862 193996  58717 ( 23.41)   220  0    0  17   9   0    26 (1.40)  100  6005 (10.23)
15   3023 197019  56855 ( 22.66)   225  0    0  21  13   1    35 (1.16)  135  5979 (10.52)
14   2437 199456  53832 ( 21.46)   205  0    0  29   8   2    39 (1.60)  174  5944 (11.04)
13   3236 202692  51395 ( 20.49)   349  0    0  75  19   6   100 (3.09)  274  5905 (11.49)
12   3769 206461  48159 ( 19.20)   276  0    0 118  44  13   175 (4.64)  449  5805 (12.05)
11   4797 211258  44390 ( 17.70)   426  0    0 217  46  14   277 (5.77)  726  5630 (12.68)
10   6744 218002  39593 ( 15.78)   610  0    0 397 115  26   538 (7.98)  1264  5353 (13.52)
 9   9873 227875  32849 ( 13.10)   929  0    0 694 219  65   978 (9.91)  2242  4815 (14.66)
 8   9673 237548  22976 (  9.16)  1045  0    0 757 435  42   1234 (12.76)  3476  3837 (16.70)
 7   9074 246622  13303 (  5.30)   850  0    0 918 564  31   1513 (16.67)  4989  2603 (19.57)
 6   3581 250203   4229 (  1.69)   627  0    0 442 351  24   817 (22.81)  5806  1090 (25.77)
 4    465 250668    648 (  0.26)    30  0    0  78  11   2    91 (19.57)  5897  273 (42.13)
 0    183 250851    183 (  0.07)     2  0   163   0  19   0   182 (99.45)  6079  182 (99.45)
-1     91 250942      0 (  0.00)  49869  0    0   0   1   0     1 (1.10)  6080    0 (0.00)


Read/contig alignment summary, by read base; adjusted qualities
Qual algn  cum    rcum    (%)    unalgn X    N  sub del ins  total (%)   cum  rcum (%)
90 193421 193421 241298 (100.00)     0  0    0   0   0   0     0 (0.00)    0  4068 (1.69)
89     43 193464  47877 ( 19.84)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.50)
88    114 193578  47834 ( 19.82)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.50)
87    115 193693  47720 ( 19.78)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.52)
86    154 193847  47605 ( 19.73)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.55)
85    131 193978  47451 ( 19.66)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.57)
84     73 194051  47320 ( 19.61)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.60)
83     68 194119  47247 ( 19.58)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.61)
82     32 194151  47179 ( 19.55)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.62)
81    622 194773  47147 ( 19.54)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.63)
80     28 194801  46525 ( 19.28)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.74)
79     27 194828  46497 ( 19.27)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.75)
78     19 194847  46470 ( 19.26)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.75)
77     16 194863  46451 ( 19.25)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.76)
76     79 194942  46435 ( 19.24)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.76)
75     33 194975  46356 ( 19.21)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.78)
74     19 194994  46323 ( 19.20)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.78)
73    102 195096  46304 ( 19.19)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.79)
72     10 195106  46202 ( 19.15)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.80)
71     46 195152  46192 ( 19.14)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.81)
70     33 195185  46146 ( 19.12)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.82)
69     53 195238  46113 ( 19.11)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.82)
68     12 195250  46060 ( 19.09)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.83)
67    104 195354  46048 ( 19.08)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.83)
66  10590 205944  45944 ( 19.04)     0  0    0   0   0   0     0 (0.00)    0  4068 (8.85)
65    396 206340  35354 ( 14.65)     0  0    0   0   0   0     0 (0.00)    0  4068 (11.51)
64     27 206367  34958 ( 14.49)     0  0    0   0   0   0     0 (0.00)    0  4068 (11.64)
63      6 206373  34931 ( 14.48)     0  0    0   0   0   0     0 (0.00)    0  4068 (11.65)
62     92 206465  34925 ( 14.47)     0  0    0   0   0   0     0 (0.00)    0  4068 (11.65)
61   1128 207593  34833 ( 14.44)     0  0    0   0   0   0     0 (0.00)    0  4068 (11.68)
60    293 207886  33705 ( 13.97)     0  0    0   0   0   0     0 (0.00)    0  4068 (12.07)
59     88 207974  33412 ( 13.85)     0  0    0   0   0   0     0 (0.00)    0  4068 (12.18)
58    141 208115  33324 ( 13.81)     0  0    0   0   0   0     0 (0.00)    0  4068 (12.21)
57    180 208295  33183 ( 13.75)     0  0    0   0   0   0     0 (0.00)    0  4068 (12.26)
56    523 208818  33003 ( 13.68)    24  0    0   0   0   0     0 (0.00)    0  4068 (12.33)
55    162 208980  32480 ( 13.46)     0  0    0   0   0   0     0 (0.00)    0  4068 (12.52)
54    345 209325  32318 ( 13.39)     0  0    0   0   0   0     0 (0.00)    0  4068 (12.59)
53    231 209556  31973 ( 13.25)     0  0    0   0   0   0     0 (0.00)    0  4068 (12.72)
52    364 209920  31742 ( 13.15)     0  0    0   0   0   0     0 (0.00)    0  4068 (12.82)
51    178 210098  31378 ( 13.00)     3  0    0   0   0   0     0 (0.00)    0  4068 (12.96)
50    445 210543  31200 ( 12.93)     7  0    0   0   0   0     0 (0.00)    0  4068 (13.04)
49    175 210718  30755 ( 12.75)     0  0    0   0   0   0     0 (0.00)    0  4068 (13.23)
48    220 210938  30580 ( 12.67)     2  0    0   0   0   0     0 (0.00)    0  4068 (13.30)
47    150 211088  30360 ( 12.58)     6  0    0   0   0   0     0 (0.00)    0  4068 (13.40)
46    212 211300  30210 ( 12.52)     7  0    0   0   0   0     0 (0.00)    0  4068 (13.47)
45    216 211516  29998 ( 12.43)     5  0    0   0   0   0     0 (0.00)    0  4068 (13.56)
44    278 211794  29782 ( 12.34)    10  0    0   0   0   0     0 (0.00)    0  4068 (13.66)
43    260 212054  29504 ( 12.23)    11  0    0   0   0   0     0 (0.00)    0  4068 (13.79)
42    384 212438  29244 ( 12.12)    25  0    0   0   0   0     0 (0.00)    0  4068 (13.91)
41    267 212705  28860 ( 11.96)    10  0    0   0   0   0     0 (0.00)    0  4068 (14.10)
40   7416 220121  28593 ( 11.85)    25  0    0   0   0   0     0 (0.00)    0  4068 (14.23)
39     59 220180  21177 (  8.78)    13  0    0   0   0   0     0 (0.00)    0  4068 (19.21)
38     52 220232  21118 (  8.75)    10  0    0   0   0   0     0 (0.00)    0  4068 (19.26)
37     98 220330  21066 (  8.73)    18  0    0   0   0   0     0 (0.00)    0  4068 (19.31)
36     83 220413  20968 (  8.69)     5  0    0   0   0   0     0 (0.00)    0  4068 (19.40)
35    102 220515  20885 (  8.66)    14  0    0   0   3   0     3 (2.94)    3  4068 (19.48)
34    177 220692  20783 (  8.61)    13  0    0   0   0   0     0 (0.00)    3  4065 (19.56)
33    180 220872  20606 (  8.54)    14  0    0   0   0   0     0 (0.00)    3  4065 (19.73)
32    184 221056  20426 (  8.47)    19  0    0   0   1   0     1 (0.54)    4  4065 (19.90)
31     81 221137  20242 (  8.39)     8  0    0   0   1   0     1 (1.23)    5  4064 (20.08)
30     33 221170  20161 (  8.36)     8  0    0   0   0   0     0 (0.00)    5  4063 (20.15)
29     96 221266  20128 (  8.34)    22  0    0   0   2   0     2 (2.08)    7  4063 (20.19)
28     33 221299  20032 (  8.30)    14  0    0   1   1   0     2 (6.06)    9  4061 (20.27)
27    168 221467  19999 (  8.29)    10  0    0   0   1   1     2 (1.19)   11  4059 (20.30)
26     37 221504  19831 (  8.22)    14  0    0   0   0   0     0 (0.00)   11  4057 (20.46)
25    577 222081  19794 (  8.20)    33  0    0   0   3   0     3 (0.52)   14  4057 (20.50)
24    160 222241  19217 (  7.96)    16  0    0   2   4   2     8 (5.00)   22  4054 (21.10)
23    182 222423  19057 (  7.90)    22  0    0   2   4   3     9 (4.95)   31  4046 (21.23)
22    136 222559  18875 (  7.82)     9  0    0   4   8   0    12 (8.82)   43  4037 (21.39)
21    148 222707  18739 (  7.77)    20  0    0   1   3   2     6 (4.05)   49  4025 (21.48)
20    157 222864  18591 (  7.70)    15  0    0   1   3   1     5 (3.18)   54  4019 (21.62)
19    299 223163  18434 (  7.64)    20  0    0   3   7   1    11 (3.68)   65  4014 (21.77)
18    144 223307  18135 (  7.52)    17  0    0   1   0   1     2 (1.39)   67  4003 (22.07)
17    207 223514  17991 (  7.46)    16  0    0   6   1   8    15 (7.25)   82  4001 (22.24)
16    286 223800  17784 (  7.37)    31  0    0  11   9   0    20 (6.99)  102  3986 (22.41)
15    387 224187  17498 (  7.25)    37  0    0  12  12   1    25 (6.46)  127  3966 (22.67)
14    378 224565  17111 (  7.09)    27  0    0  15   7   2    24 (6.35)  151  3941 (23.03)
13    666 225231  16733 (  6.93)    53  0    0  50  12   5    67 (10.06)  218  3917 (23.41)
12    746 225977  16067 (  6.66)    37  0    0  74  31  13   118 (15.82)  336  3850 (23.96)
11   1167 227144  15321 (  6.35)    67  0    0 142  24  12   178 (15.25)  514  3732 (24.36)
10   1932 229076  14154 (  5.87)    89  0    0 246  80  25   351 (18.17)  865  3554 (25.11)
 9   3216 232292  12222 (  5.07)    97  0    0 421 134  56   611 (19.00)  1476  3203 (26.21)
 8   3280 235572   9006 (  3.73)   117  0    0 491 289  38   818 (24.94)  2294  2592 (28.78)
 7   3636 239208   5726 (  2.37)    80  0    0 610 395  25   1030 (28.33)  3324  1774 (30.98)
 6   1474 240682   2090 (  0.87)    57  0    0 263 201  17   481 (32.63)  3805  744 (35.60)
 4    437 241119    616 (  0.26)     2  0    0  74  10   1    85 (19.45)  3890  263 (42.69)
 0    179 241298    179 (  0.07)     0  0   159   0  19   0   178 (99.44)  4068  178 (99.44)
-1   9644 250942      0 (  0.00)  56844  0    4 1365 614  29   2012 (20.86)  6080    0 (0.00)


Depth 0 regions:

Block histogram:
Qual   bases    cum    blocks
  0      87       87        2
  8       2       89        3
 12       1       90        4
 13       1       91        5
 14       2       93        6
 15       1       94        5
 16       1       95        5
 17       3       98        5
 19       1       99        5
 20       1      100        5
 22       2      102        6
 23       2      104        6
 24       3      107        6
 25       3      110        6
 27       3      113        6
 29       2      115        7
 32       2      117        7
 33       8      125        8
 34       2      127        6
 35       2      129        7
 36       1      130        7
 37      13      143       11
 38       8      151       14
 39       1      152       14
 40      44      196       20
 41       1      197       21
 42      65      262       38
 43      33      295       40
 44      12      307       43
 45       7      314       42
 46       8      322       38
 47       7      329       39
 48       9      338       42
 49       2      340       43
 50      78      418       56
 51      35      453       57
 52      49      502       71
 53      45      547       77
 54      42      589       90
 55      45      634       94
 56     177      811       64
 57       5      816       65
 58      12      828       64
 60      46      874       62
 61     239     1113       93
 64       1     1114       94
 66    1818     2932       12
 69       5     2937       15
 70       1     2938       15
 71       2     2940       14
 72       2     2942       14
 73      19     2961       18
 74      15     2976       20
 75      20     2996       20
 76       8     3004       20
 77      11     3015       17
 78       9     3024       17
 79      14     3038       15
 80       9     3047       16
 81      34     3081       24
 82       6     3087       21
 83       8     3095       20
 84       9     3104       17
 85      11     3115       17
 86      14     3129       18
 87       8     3137       23
 88       9     3146       24
 89       4     3150       23
 90   12425    15575        1

SS region: 2717 (17.44%), flagged: 0 (0.00%)

Sites with total LLR scores < -3.0  [max pos LLR read, max neg LLR read]  (#discrep top reads, #discrep bottom reads):
 2565     -3.3  [-3.3,  0.0]  (0, 1)
 3932     -4.0  [-4.0,  0.0]  (0, 1)
 4317     -4.6  [-4.6,  0.0]  (0, 1)
 4778     -4.0  [-4.0,  0.0]  (0, 1)
 5140     -4.7  [-4.7,  0.0]  (0, 1)
 5227     -3.5  [-3.5,  0.0]  (0, 1)
 5266     -4.0  [-4.0,  0.0]  (0, 1)
 6788     -3.5  [-3.5,  0.0]  (1, 0)
 7307     -3.7  [-2.0,  0.0]  (2, 0)
 8055     -4.8  [-4.8,  0.0]  (0, 1)
 8544     -3.2  [-3.2,  0.0]  (1, 0)
 8977     -4.0  [-4.0,  0.0]  (0, 1)
 9584     -4.4  [-4.4,  0.0]  (0, 1)
10947     -4.2  [-4.2,  0.0]  (0, 1)
11524     -3.7  [-3.7,  0.0]  (0, 1)
14413     -4.0  [-4.0,  0.0]  (0, 1)

Read/contig discrepancies (* = higher-quality): None.
0 lower quality discrepant sites.

Reads with neg LLR score, or confirmed or high-qual unaligned seg > 20 bases, or other problem:

(Lngths init HQ, CF unalgn segs); aligned contig pos [LLR score]; (terminal HQ, CF unalgn); read id; aligned read pos
| confirmed read segments | unaligned read segments matching elsewhere
 (LU = local unaligned, DU = distant unaligned, DA = distant aligned, ** = overlaps trimmed region
 || Best local and distant LLR scores
(0, 0)     1- 1013 [21.1] (0,0)     cd040109r1         48-1075 | 51 1075 | DA:(**51 229**) || local(+/-) (17.9,0.0), distant (0.0,0.0)
(0, 0)   683-  691 [ 0.0] (0,0)     dc050109f1         29-37 | 30 90 | LU:(38 90) || local(+/-) (0.0,0.0), distant (0.0,0.0)
(1, 0)   770- 1655 [15.4] (0,0)     cd010109f1         112-1006 | (27 87)  112 1006 | LU:(35 87) DA:(**573 599**) || local(+/-) (9.3,0.7), distant (8.5,0.0)
(0, 0)  1035- 1066 [-5.7] (25,0)     ba110109r1         53-84 || local(+/-) (0.7,0.0), distant (0.7,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.7  trail: -6.5  lead: 0.0  total: -5.8 
(0, 0)  2933- 3865 [18.8] (47,0)   C dh090109f1         1039-101 | (1 101)  101 1061 | LU:(6 30)(**38 100**)(1059 1061) || local(+/-) (19.9,4.6), distant (0.7,0.4)
(0, 0)  2923- 2929 [ 0.0] (0,1017)   C cf110109f1         1046-1040 | 21 107 | LU:(23 46)(54 99) || local(+/-) (0.0,0.0), distant (0.0,0.0)
(0, 0)  2886- 2892 [ 0.0] (932,1014)   C cc110109f1         1037-1031 | 17 77 | LU: || local(+/-) (0.0,0.0), distant (0.0,0.0)
(0, 50)  3968- 3974 [-3.3] (0,25)   C ca030109f1         41-35 | 7 105 | LU:(7 34)(42 93)(102 105) || local(+/-) (0.0,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.2  trail: -1.3  lead: -2.2  total: -3.3 
(4, 0)  3836- 3842 [-4.6] (0,82)   C dh110109f1         97-91 | 5 101 | LU:(5 32)(39 90)(**98 101**) || local(+/-) (0.0,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.0  trail: -4.6  lead: 0.0  total: -4.6 
(0, 0)  2954- 2960 [ 0.0] (947,1004)   C da120109f1         1028-1022 | 18 106 | LU:(**18 106**) || local(+/-) (0.2,0.0), distant (0.0,0.0)
(13, 6)  4150- 4231 [-12.5] (0,0)   C ag100109r1         131-50 || local(+/-) (1.6,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 1.8  trail: 0.0  lead: -14.4  total: -12.6 
Bypassed: (0, 0)  3655- 3903 [-14.7] (16,0)     cf050109r1         50-298 || local(+/-) (5.3,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=3), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 5.5  trail: -20.0  lead: 0.0  total: -14.7 
(0, 0)  4834- 5814 [19.9] (0,0)     de040109r1         50-1037 | 50 1066 | DU:(1040 1066) [68 1066  with   dh050109r1  50 1041-- displ. 6077]  || local(+/-) (19.7,0.0), distant (0.6,0.0)
(0, 0)  5223- 6119 [18.1] (0,0)   C dh010109f1         1005-107 | (23 96)  107 1011 | DU:(23 96) [23 96  with   dh090109f1  10 80-- displ. 2248]  || local(+/-) (19.3,0.0), distant (4.9,0.0)
Bypassed: (14, 14)  6390- 6506 [-9.5] (0,0)   C ac110109r1         163-48 || local(+/-) (1.8,0.0), distant (1.8,0.0)
LLR breakdown: discreps: -0.8 (<20 part: -0.8 (#=7), >20:0.0 (#=0); in HQ: -0.8, out HQ 0.0), match: 2.5  trail: 0.0  lead: -11.2  total: -9.5 
(0, 0)  6116- 7109 [21.2] (0,0)   C dg040109f1         1017-24 | 24 1059 | DA:(1018 1059) || local(+/-) (19.0,2.7), distant (7.8,0.0)
(0, 0)  6295- 6423 [-6.7] (16,0)     bh080109r1         61-188 || local(+/-) (2.7,0.0), distant (2.4,0.0)
LLR breakdown: discreps: -1.2 (<20 part: -1.2 (#=7), >20:0.0 (#=0); in HQ: -1.2, out HQ 0.0), match: 2.7  trail: -8.3  lead: 0.0  total: -6.8 
(0, 0)  6833- 7748 [16.5] (0,0)     dd010109f1         82-1012 | (10 83)  82 1049 | DU:(10 14)(27 81) [10 83  with   dh120109f1  24 96-- displ. 6693]  [10 78  with   dg120109f1  24 90-- displ. 6711]  [10 81  with   dg030109f1  9 79-- displ. 6651]  [10 82  with   db010109f1  9 79-- displ. 6639]  [10 82  with   cf110109f1  24 97]  [10 83  with   dh120109f1  24 96-- displ. 6693]  [10 78  with   dg120109f1  24 90-- displ. 6711]  [10 81  with   dg030109f1  9 79-- displ. 6651]  [21 80  with   dd050109f1  20 82]  [10 82  with   db010109f1  9 79-- displ. 6639]  [10 82  with   cf110109f1  24 97]  CHIMERIC || local(+/-) (19.8,8.6), distant (0.0,0.0)
(0, 0)  7784- 7838 [-12.8] (16,0)     ah020109r1         52-106 || local(+/-) (1.2,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=1), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 1.2  trail: -13.9  lead: 0.0  total: -12.9 
(0, 0)  8944- 9821 [18.7] (0,0)     da100109f1         113-1002 | (36 113)  113 1041 | DU:(36 101)(109 112) [53 109  with   dh110109f1  41 97]  [36 113  with   dh090109f1  24 100]  [53 109  with   dh110109f1  41 97]  [36 113  with   dh090109f1  24 100]  CHIMERIC || local(+/-) (17.9,0.0), distant (2.0,0.0)
(0, 0)  9395-10339 [17.0] (0,0)     dh080109r1         47-1003 | 47 1059 | DU:(1018 1059) [60 1059  with   ab080109r1  54 1040-- displ. 6069]  || local(+/-) (19.6,0.0), distant (3.9,0.0)
(0, 0) 10601-10710 [-16.0] (16,0)     dh070109r1         51-160 || local(+/-) (2.4,0.0), distant (0.0,0.0)
LLR breakdown: discreps: -0.2 (<20 part: -0.2 (#=2), >20:0.0 (#=0); in HQ: -0.2, out HQ 0.0), match: 2.4  trail: -18.3  lead: 0.0  total: -16.1 
(0, 0) 11411-11418 [ 0.0] (0,981)   C db040109f1         1038-1031 | 9 99 | LU:(9 99) || local(+/-) (1.2,1.6), distant (0.0,0.0)
(0, 0) 11875-11884 [ 0.0] (0,417)   C dd050109f1         482-473 | 2 102 | LU:(9 46)(55 102) || local(+/-) (1.5,1.3), distant (0.4,0.0)
(0, 0) 11320-12224 [18.8] (0,0)     ae010109r1         48-964 | 48 998 | DU:(965 998) [48 998  with   df030109r1  119 1064-- displ. 6077]  || local(+/-) (19.6,0.0), distant (7.1,0.0)
(0, 0) 11781-11788 [ 0.0] (0,567)   C cg100109f1         626-619 | 12 100 | LU:(15 100) || local(+/-) (0.0,1.6), distant (0.0,0.0)
(0, 33) 12386-12392 [-1.2] (0,0)   C cg050109f1         49-43 | 7 95 | LU:(7 42)(50 95) || local(+/-) (0.0,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.0  trail: 0.0  lead: -1.2  total: -1.2 
(0, 0) 12393-13306 [18.1] (10,0)   C ba100109r1         1035-113 | (71 108)  113 1084 | DU:(**71 108**) [71 108  with   bc060109r1  9 46]  CHIMERIC || local(+/-) (19.8,8.7), distant (4.5,0.0)
(0, 0) 12599-13247 [-2.9] (0,0)     dd080109r1         143-797 || local(+/-) (8.7,7.3), distant (0.4,0.0)
LLR breakdown: discreps: -14.2 (<20 part: -14.2 (#=126), >20:0.0 (#=0); in HQ: -2.7, out HQ -11.5), match: 11.3  trail: 0.0  lead: 0.0  total: -2.9 
Bypassed: (0, 0) 12821-13242 [-11.8] (16,0)     be120109r1         49-470 || local(+/-) (9.3,7.3), distant (2.3,0.0)
LLR breakdown: discreps: -0.1 (<20 part: -0.1 (#=1), >20:0.0 (#=0); in HQ: -0.1, out HQ 0.0), match: 9.4  trail: -21.1  lead: 0.0  total: -11.8 
(44, 0) 13532-14426 [18.6] (0,0)     dh120109f1         103-1000 | (1 97)  103 1027 | LU:(1 29)(**42 96**) || local(+/-) (19.0,7.0), distant (0.1,0.0)
(0, 14) 13483-13488 [-2.6] (0,56)     dg120109f1         36-41 | 2 113 | LU:(2 29)(42 110) || local(+/-) (0.0,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.1  trail: -2.4  lead: -0.4  total: -2.7 
(0, 1034) 14444-14450 [ 0.0] (0,0)     dg030109f1         1042-1048 | 1 99 | LU:(1 14)(27 98) || local(+/-) (0.0,0.0), distant (0.0,0.0)
(0, 8) 13405-13410 [-0.7] (0,61)     db010109f1         15-20 | 1 81 | LU:(1 14)(27 81) || local(+/-) (0.0,0.0), distant (0.0,0.0)
LLR breakdown: discreps: 0.0 (<20 part: 0.0 (#=0), >20:0.0 (#=0); in HQ: 0.0, out HQ 0.0), match: 0.1  trail: -0.9  lead: 0.0  total: -0.8 
(0, 985) 14410-14416 [ 0.0] (0,0)     cf080109f1         992-998 | 1 96 | LU:(7 19)(26 96) || local(+/-) (0.0,0.0), distant (0.0,0.0)

Gaps in unique-read coverage:   I 1159- 1257, I 5719- 6458, I 9642- 9646, I 11853- 13152

Subclone/read contig links and consistency checks (* = inconsistency; Contig 0 = singletons)
Max subclone size: 5000

Size histogram for consistent forward-reverse pairs (*** = inconsistent pairs)
  ***     0

 Consistent opp sense links (* = not used in chain, ** = multiple non-zero):