<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-02-20 08:44:12"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C04HBa0064G18-rHkBY/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C04HBa0064G18-rHkBY/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C04HBa0064G18-rHkBY/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M373-F" ref_strand="+" ref_description="SGN-M373-F TG635-F [rflp_markers_forward]">
      <seq>gggagacagcttgcatgcctgcaggggactttgcggaacaggtcaggacagcatctcctacagtgagaaagatcttgtcctcgccaatttgattcacaaaatcagatgcatgcagcttgtcaatcactactcttccaggattcgacagaactaactgttcacacacaaattttagttcagatactatgttagggtcctaattagattatcaggtttataaaaattacctgaacttctctcttatgtaggcttctgtgcaactcttcaaaggcatggataccactagtgtcaatgtcagtcacagctggaaaaaagaaaaacgagatgagtgtcatttgcctctatggttatcatatttggtttgggatttttaaagacaaaggtaagcattttctccacttacgcgacatgtcaactatcaagaactgaattttaggttggttaactgattctagttgctcgtcttcgtcagttagccatctcaatatcctggaaaacaagttcattctcatgaatcagacactcttttcgccacta</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C04HBa0064G18-rHkBY/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C04HBa0064G18.1" temp_strand="+" temp_description="C04HBa0064G18.1  CU927997.8 htgs_phase:3 submitted_to_sgn_as:C04HBa0064G18 sequenced_by:sanger upload_account_name:uk">
        <position start="4420" stop="5538"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="4726" g_stop="5238" g_length="513"/>
          <reference_exon_boundary r_type="cDNA" r_start="25" r_stop="537" r_length="513" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C04HBa0064G18.1" gen_strand="+" ref_id="SGN-M373-F" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>513</cumulative_length_of_scored_exons>
        <coverage percentage="0.955" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C04HBa0064G18.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M373-F" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="4726" e_stop="5238"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GGGACTTTGCGGAACAGGTCAGGACAGCATCTCCTACAGTGAGAAAGATCTTGTCCTCGCCAATTTGATTCACAAAATCAGATGCATGCAGCTTGTCAATCACTACTCTTCCAGGATTCGACAGAACTAACTGTTCACACACAAATTTTAGTTCAGATACTATGTTAGGGTCCTAATTAGATTATCAGGTTTATAAAAATTACCTGAACTTCTCTCTTATGTAGGCTTCTGTGCAACTCTTCAAAGGCATGGATACCACTAGTGTCAATGTCAGTCACAGCTGGAAAAAAGAAAAACGAGATGAGTGTCATTTGCCTCTATGGTTATCATATTTGGTTTGGGATTTTTAAAGACAAAGGTAAGCATTTTCTCCACTTACGCGACATGTCAACTATCAAGAACTGAATTTTAGGTTGGTTAACTGATTCTAGTTGCTCGTCTTCGTCAGTTAGCCATCTCAATATCCTGGAAAACAAGTTCATTCTCATGAATCAGACACTCTTTTCGCCACTA</genome_strand>
        <mrna_strand>GGGACTTTGCGGAACAGGTCAGGACAGCATCTCCTACAGTGAGAAAGATCTTGTCCTCGCCAATTTGATTCACAAAATCAGATGCATGCAGCTTGTCAATCACTACTCTTCCAGGATTCGACAGAACTAACTGTTCACACACAAATTTTAGTTCAGATACTATGTTAGGGTCCTAATTAGATTATCAGGTTTATAAAAATTACCTGAACTTCTCTCTTATGTAGGCTTCTGTGCAACTCTTCAAAGGCATGGATACCACTAGTGTCAATGTCAGTCACAGCTGGAAAAAAGAAAAACGAGATGAGTGTCATTTGCCTCTATGGTTATCATATTTGGTTTGGGATTTTTAAAGACAAAGGTAAGCATTTTCTCCACTTACGCGACATGTCAACTATCAAGAACTGAATTTTAGGTTGGTTAACTGATTCTAGTTGCTCGTCTTCGTCAGTTAGCCATCTCAATATCCTGGAAAACAAGTTCATTCTCATGAATCAGACACTCTTTTCGCCACTA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C04HBa0064G18-rHkBY/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M583-F" ref_strand="+" ref_description="SGN-M583-F TG264-F [rflp_markers_forward]">
      <seq>gggagacagcttgcatgcctgcaggggactttgcggaacaggtcaggacagcatctcctacagtgagaaagatcttgtcctcgccaatttgattcacaaaatcagatgcatgcagcttgtcaatcactactcttccaggattcgacagaactaactgttcacacacaaattttagttcagatactatgttagggtcctaattagattatcaggtttataaaaattacctgaacttctctcttatgtaggcttctgtgcaactcttcaaaggcatggataccactagtgtcaatgtcagtcacagctggaaaaaagaaaaacgagatgagtgtcatttgcctctatggttatcatatttggtttgggatttttaaagacaaaggtaagcattttctccacttacgcgacatgtcaactatcaagaactgaattttaggttggttaactgattctagttgctcgtcttcgtcagttagccatctcaatatcctggaaaacaagttcattctcatgaatcagacactctttt</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C04HBa0064G18-rHkBY/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C04HBa0064G18.1" temp_strand="+" temp_description="C04HBa0064G18.1  CU927997.8 htgs_phase:3 submitted_to_sgn_as:C04HBa0064G18 sequenced_by:sanger upload_account_name:uk">
        <position start="4420" stop="5530"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="4726" g_stop="5230" g_length="505"/>
          <reference_exon_boundary r_type="cDNA" r_start="25" r_stop="529" r_length="505" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C04HBa0064G18.1" gen_strand="+" ref_id="SGN-M583-F" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>505</cumulative_length_of_scored_exons>
        <coverage percentage="0.955" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C04HBa0064G18.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M583-F" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="4726" e_stop="5230"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GGGACTTTGCGGAACAGGTCAGGACAGCATCTCCTACAGTGAGAAAGATCTTGTCCTCGCCAATTTGATTCACAAAATCAGATGCATGCAGCTTGTCAATCACTACTCTTCCAGGATTCGACAGAACTAACTGTTCACACACAAATTTTAGTTCAGATACTATGTTAGGGTCCTAATTAGATTATCAGGTTTATAAAAATTACCTGAACTTCTCTCTTATGTAGGCTTCTGTGCAACTCTTCAAAGGCATGGATACCACTAGTGTCAATGTCAGTCACAGCTGGAAAAAAGAAAAACGAGATGAGTGTCATTTGCCTCTATGGTTATCATATTTGGTTTGGGATTTTTAAAGACAAAGGTAAGCATTTTCTCCACTTACGCGACATGTCAACTATCAAGAACTGAATTTTAGGTTGGTTAACTGATTCTAGTTGCTCGTCTTCGTCAGTTAGCCATCTCAATATCCTGGAAAACAAGTTCATTCTCATGAATCAGACACTCTTTT</genome_strand>
        <mrna_strand>GGGACTTTGCGGAACAGGTCAGGACAGCATCTCCTACAGTGAGAAAGATCTTGTCCTCGCCAATTTGATTCACAAAATCAGATGCATGCAGCTTGTCAATCACTACTCTTCCAGGATTCGACAGAACTAACTGTTCACACACAAATTTTAGTTCAGATACTATGTTAGGGTCCTAATTAGATTATCAGGTTTATAAAAATTACCTGAACTTCTCTCTTATGTAGGCTTCTGTGCAACTCTTCAAAGGCATGGATACCACTAGTGTCAATGTCAGTCACAGCTGGAAAAAAGAAAAACGAGATGAGTGTCATTTGCCTCTATGGTTATCATATTTGGTTTGGGATTTTTAAAGACAAAGGTAAGCATTTTCTCCACTTACGCGACATGTCAACTATCAAGAACTGAATTTTAGGTTGGTTAACTGATTCTAGTTGCTCGTCTTCGTCAGTTAGCCATCTCAATATCCTGGAAAACAAGTTCATTCTCATGAATCAGACACTCTTTT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C04HBa0064G18-rHkBY/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M373-R" ref_strand="+" ref_description="SGN-M373-R TG635-R [rflp_markers_reverse]">
      <seq>ggactttgcggaacaggtcaggacagcatctcctacagtgagaaagatcttgtcctcgccaatttgattcacaaaatcagatgcatgcagcttgtcaatcactactcttccaggattcgacagaactaactgttcacacacaaattttagttcagatactatgttagggtcctaattagattatcaggtttataaaaattacctgaacttctctcttatgtaggcttctgtgcaactcttcaaaggcatggataccactagtgtcaatgtcagtcacagctggaaaaaagaaaaacgagatgagtgtcatttgcctctatggttatcatatttggtttgggatttttaaagacaaaggtaagcattttctccacttacgcgacatgtcaactatcaagaactgaattttaggttggttaactgattctagttgctcgtcttcgtcagttagccatctcaatatcctggaaaacaagttcattctcatgaatcagacactcttttcgc</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C04HBa0064G18-rHkBY/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C04HBa0064G18.1" temp_strand="+" temp_description="C04HBa0064G18.1  CU927997.8 htgs_phase:3 submitted_to_sgn_as:C04HBa0064G18 sequenced_by:sanger upload_account_name:uk">
        <position start="4427" stop="5533"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="4727" g_stop="5233" g_length="507"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="507" r_length="507" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C04HBa0064G18.1" gen_strand="+" ref_id="SGN-M373-R" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>507</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C04HBa0064G18.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M373-R" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="4727" e_stop="5233"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GGACTTTGCGGAACAGGTCAGGACAGCATCTCCTACAGTGAGAAAGATCTTGTCCTCGCCAATTTGATTCACAAAATCAGATGCATGCAGCTTGTCAATCACTACTCTTCCAGGATTCGACAGAACTAACTGTTCACACACAAATTTTAGTTCAGATACTATGTTAGGGTCCTAATTAGATTATCAGGTTTATAAAAATTACCTGAACTTCTCTCTTATGTAGGCTTCTGTGCAACTCTTCAAAGGCATGGATACCACTAGTGTCAATGTCAGTCACAGCTGGAAAAAAGAAAAACGAGATGAGTGTCATTTGCCTCTATGGTTATCATATTTGGTTTGGGATTTTTAAAGACAAAGGTAAGCATTTTCTCCACTTACGCGACATGTCAACTATCAAGAACTGAATTTTAGGTTGGTTAACTGATTCTAGTTGCTCGTCTTCGTCAGTTAGCCATCTCAATATCCTGGAAAACAAGTTCATTCTCATGAATCAGACACTCTTTTCGC</genome_strand>
        <mrna_strand>GGACTTTGCGGAACAGGTCAGGACAGCATCTCCTACAGTGAGAAAGATCTTGTCCTCGCCAATTTGATTCACAAAATCAGATGCATGCAGCTTGTCAATCACTACTCTTCCAGGATTCGACAGAACTAACTGTTCACACACAAATTTTAGTTCAGATACTATGTTAGGGTCCTAATTAGATTATCAGGTTTATAAAAATTACCTGAACTTCTCTCTTATGTAGGCTTCTGTGCAACTCTTCAAAGGCATGGATACCACTAGTGTCAATGTCAGTCACAGCTGGAAAAAAGAAAAACGAGATGAGTGTCATTTGCCTCTATGGTTATCATATTTGGTTTGGGATTTTTAAAGACAAAGGTAAGCATTTTCTCCACTTACGCGACATGTCAACTATCAAGAACTGAATTTTAGGTTGGTTAACTGATTCTAGTTGCTCGTCTTCGTCAGTTAGCCATCTCAATATCCTGGAAAACAAGTTCATTCTCATGAATCAGACACTCTTTTCGC</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C04HBa0064G18-rHkBY/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M583-R" ref_strand="+" ref_description="SGN-M583-R TG264-R [rflp_markers_reverse]">
      <seq>tttccaacattgtcatgtctattgttgtggtcctgacattgttgttcataacccctctttttgagtacactccgaatgcaatactctctgccatcattatctctgctgtcattggattggtagactatgaagcaacgattttgatttggaagatcgacaaatttgattttgttgcttgcatgggagcattttttggtgtggtttttgcctctgttgagattggtcttataattgctgtaagtatttctctcagcaatgcttaacaaattcatcagggaaagccgcgacagttcaatgattgtatctcgttgtttttattattatataggtctcaatatcatttgctaagattctcctccaagtcacaaggccacgaacagctcttcttggcaagatccctaggacaaatgtatataggaacattcaacaatatcccgaggcaacacaagttcccggtgtactaatagtgagagttgattctgctatc</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C04HBa0064G18-rHkBY/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C04HBa0064G18.1" temp_strand="-" temp_description="C04HBa0064G18.1  CU927997.8 htgs_phase:3 submitted_to_sgn_as:C04HBa0064G18 sequenced_by:sanger upload_account_name:uk">
        <position start="6141" stop="5055"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="5841" g_stop="5355" g_length="487"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="487" r_length="487" r_score="0.998"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C04HBa0064G18.1" gen_strand="-" ref_id="SGN-M583-R" ref_strand="+">
        <total_alignment_score>0.998</total_alignment_score>
        <cumulative_length_of_scored_exons>487</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C04HBa0064G18.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-M583-R" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="5841" e_stop="5355"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>TTTCCAACATTGTCATGTCTATTGTTGTGGTCCTGACATTGTTGTTCATAACCCCTCTTTTTGAGTACACTCCGAATGCAATACTCTCTGCCATCATTATCTCTGCTGTCATTGGATTGGTAGACTATGAAGCAACGATTTTGATTTGGAAGATCGACAAATTTGATTTTGTTGCTTGCATGGGAGCATTTTTTGGTGTGGTTTTTGCCTCTGTTGAGATTGGTCTTATAATTGCTGTAAGTATTTCTCTCAGCAATGCTTAACAAATTCATCAGGGAAAGCCGCGACAGTTCAATGATTGTATCTCGTTGTTTTTATTATTATATAGGTCTCAATATCATTTGCTAAGATTCTCCTCCAAGTCACAAGGCCACGAACAGCTCTTCTTGGCAAGATCCCTAGGACAAATGTATATCGGAACATTCAACAATATCCCGAGGCAACACAAGTTCCCGGTGTACTAATAGTGAGAGTTGATTCTGCTATC</genome_strand>
        <mrna_strand>TTTCCAACATTGTCATGTCTATTGTTGTGGTCCTGACATTGTTGTTCATAACCCCTCTTTTTGAGTACACTCCGAATGCAATACTCTCTGCCATCATTATCTCTGCTGTCATTGGATTGGTAGACTATGAAGCAACGATTTTGATTTGGAAGATCGACAAATTTGATTTTGTTGCTTGCATGGGAGCATTTTTTGGTGTGGTTTTTGCCTCTGTTGAGATTGGTCTTATAATTGCTGTAAGTATTTCTCTCAGCAATGCTTAACAAATTCATCAGGGAAAGCCGCGACAGTTCAATGATTGTATCTCGTTGTTTTTATTATTATATAGGTCTCAATATCATTTGCTAAGATTCTCCTCCAAGTCACAAGGCCACGAACAGCTCTTCTTGGCAAGATCCCTAGGACAAATGTATATAGGAACATTCAACAATATCCCGAGGCAACACAAGTTCCCGGTGTACTAATAGTGAGAGTTGATTCTGCTATC</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>4</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="+" PGL_start="4726" PGL_stop="5238"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="4726" e_stop="5238"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="4726" e_stop="5238" e_length="513"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="4726" stop="5238"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M373-F" strand="+"/>
          </PGS_line>
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="4726" stop="5230"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M583-F" strand="+"/>
          </PGS_line>
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="4727" stop="5233"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M373-R" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>GGGACTTTGCGGAACAGGTCAGGACAGCATCTCCTACAGTGAGAAAGATCTTGTCCTCGCCAATTTGATTCACAAAATCAGATGCATGCAGCTTGTCAATCACTACTCTTCCAGGATTCGACAGAACTAACTGTTCACACACAAATTTTAGTTCAGATACTATGTTAGGGTCCTAATTAGATTATCAGGTTTATAAAAATTACCTGAACTTCTCTCTTATGTAGGCTTCTGTGCAACTCTTCAAAGGCATGGATACCACTAGTGTCAATGTCAGTCACAGCTGGAAAAAAGAAAAACGAGATGAGTGTCATTTGCCTCTATGGTTATCATATTTGGTTTGGGATTTTTAAAGACAAAGGTAAGCATTTTCTCCACTTACGCGACATGTCAACTATCAAGAACTGAATTTTAGGTTGGTTAACTGATTCTAGTTGCTCGTCTTCGTCAGTTAGCCATCTCAATATCCTGGAAAACAAGTTCATTCTCATGAATCAGACACTCTTTTCGCCACTA</gDNA_template>
            <first_frame> G  T  L  R  N  R  S  G  Q  H  L  L  Q  *  E  R  S  C  P  R  Q  F  D  S  Q  N  Q  M  H  A  A  C  Q  S  L  L  F  Q  D  S  T  E  L  T  V  H  T  Q  I  L  V  Q  I  L  C  *  G  P  N  *  I  I  R  F  I  K  I  T  *  T  S  L  L  C  R  L  L  C  N  S  S  K  A  W  I  P  L  V  S  M  S  V  T  A  G  K  K  K  N  E  M  S  V  I  C  L  Y  G  Y  H  I  W  F  G  I  F  K  D  K  G  K  H  F  L  H  L  R  D  M  S  T  I  K  N  *  I  L  G  W  L  T  D  S  S  C  S  S  S  S  V  S  H  L  N  I  L  E  N  K  F  I  L  M  N  Q  T  L  F  S  P  L </first_frame>
            <second_frame>  G  L  C  G  T  G  Q  D  S  I  S  Y  S  E  K  D  L  V  L  A  N  L  I  H  K  I  R  C  M  Q  L  V  N  H  Y  S  S  R  I  R  Q  N  *  L  F  T  H  K  F  *  F  R  Y  Y  V  R  V  L  I  R  L  S  G  L  *  K  L  P  E  L  L  S  Y  V  G  F  C  A  T  L  Q  R  H  G  Y  H  *  C  Q  C  Q  S  Q  L  E  K  R  K  T  R  *  V  S  F  A  S  M  V  I  I  F  G  L  G  F  L  K  T  K  V  S  I  F  S  T  Y  A  T  C  Q  L  S  R  T  E  F  *  V  G  *  L  I  L  V  A  R  L  R  Q  L  A  I  S  I  S  W  K  T  S  S  F  S  *  I  R  H  S  F  R  H   </second_frame>
            <third_frame>   D  F  A  E  Q  V  R  T  A  S  P  T  V  R  K  I  L  S  S  P  I  *  F  T  K  S  D  A  C  S  L  S  I  T  T  L  P  G  F  D  R  T  N  C  S  H  T  N  F  S  S  D  T  M  L  G  S  *  L  D  Y  Q  V  Y  K  N  Y  L  N  F  S  L  M  *  A  S  V  Q  L  F  K  G  M  D  T  T  S  V  N  V  S  H  S  W  K  K  E  K  R  D  E  C  H  L  P  L  W  L  S  Y  L  V  W  D  F  *  R  Q  R  *  A  F  S  P  L  T  R  H  V  N  Y  Q  E  L  N  F  R  L  V  N  *  F  *  L  L  V  F  V  S  *  P  S  Q  Y  P  G  K  Q  V  H  S  H  E  S  D  T  L  F  A  T  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C04HBa0064G18.1" strand="+"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="4933" stop="5130"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>195</number_coding_nucleotides>
                  <number_encoded_amino_acids>65</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>TSLLCRLLCNSSKAWIPLVSMSVTAGKKKNEMSVICLYGYHIWFGIFKDKGKHFLHLRDMSTIKN*</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="2" PGL_strand="-" PGL_start="5841" PGL_stop="5355"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="5841" e_stop="5355"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.998"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.998">
            <gDNA_exon_boundary e_start="5841" e_stop="5355" e_length="487"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="5841" stop="5355"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M583-R" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="2" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>TTTCCAACATTGTCATGTCTATTGTTGTGGTCCTGACATTGTTGTTCATAACCCCTCTTTTTGAGTACACTCCGAATGCAATACTCTCTGCCATCATTATCTCTGCTGTCATTGGATTGGTAGACTATGAAGCAACGATTTTGATTTGGAAGATCGACAAATTTGATTTTGTTGCTTGCATGGGAGCATTTTTTGGTGTGGTTTTTGCCTCTGTTGAGATTGGTCTTATAATTGCTGTAAGTATTTCTCTCAGCAATGCTTAACAAATTCATCAGGGAAAGCCGCGACAGTTCAATGATTGTATCTCGTTGTTTTTATTATTATATAGGTCTCAATATCATTTGCTAAGATTCTCCTCCAAGTCACAAGGCCACGAACAGCTCTTCTTGGCAAGATCCCTAGGACAAATGTATATCGGAACATTCAACAATATCCCGAGGCAACACAAGTTCCCGGTGTACTAATAGTGAGAGTTGATTCTGCTATC</gDNA_template>
            <first_frame> F  P  T  L  S  C  L  L  L  W  S  *  H  C  C  S  *  P  L  F  L  S  T  L  R  M  Q  Y  S  L  P  S  L  S  L  L  S  L  D  W  *  T  M  K  Q  R  F  *  F  G  R  S  T  N  L  I  L  L  L  A  W  E  H  F  L  V  W  F  L  P  L  L  R  L  V  L  *  L  L  *  V  F  L  S  A  M  L  N  K  F  I  R  E  S  R  D  S  S  M  I  V  S  R  C  F  Y  Y  Y  I  G  L  N  I  I  C  *  D  S  P  P  S  H  K  A  T  N  S  S  S  W  Q  D  P  *  D  K  C  I  S  E  H  S  T  I  S  R  G  N  T  S  S  R  C  T  N  S  E  S  *  F  C  Y  </first_frame>
            <second_frame>  F  Q  H  C  H  V  Y  C  C  G  P  D  I  V  V  H  N  P  S  F  *  V  H  S  E  C  N  T  L  C  H  H  Y  L  C  C  H  W  I  G  R  L  *  S  N  D  F  D  L  E  D  R  Q  I  *  F  C  C  L  H  G  S  I  F  W  C  G  F  C  L  C  *  D  W  S  Y  N  C  C  K  Y  F  S  Q  Q  C  L  T  N  S  S  G  K  A  A  T  V  Q  *  L  Y  L  V  V  F  I  I  I  *  V  S  I  S  F  A  K  I  L  L  Q  V  T  R  P  R  T  A  L  L  G  K  I  P  R  T  N  V  Y  R  N  I  Q  Q  Y  P  E  A  T  Q  V  P  G  V  L  I  V  R  V  D  S  A  I </second_frame>
            <third_frame>   S  N  I  V  M  S  I  V  V  V  L  T  L  L  F  I  T  P  L  F  E  Y  T  P  N  A  I  L  S  A  I  I  I  S  A  V  I  G  L  V  D  Y  E  A  T  I  L  I  W  K  I  D  K  F  D  F  V  A  C  M  G  A  F  F  G  V  V  F  A  S  V  E  I  G  L  I  I  A  V  S  I  S  L  S  N  A  *  Q  I  H  Q  G  K  P  R  Q  F  N  D  C  I  S  L  F  L  L  L  Y  R  S  Q  Y  H  L  L  R  F  S  S  K  S  Q  G  H  E  Q  L  F  L  A  R  S  L  G  Q  M  Y  I  G  T  F  N  N  I  P  R  Q  H  K  F  P  V  Y  *  *  *  E  L  I  L  L   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C04HBa0064G18.1" strand="-"/>
                <serials PGL_serial="2" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="5839" stop="5579"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>258</number_coding_nucleotides>
                  <number_encoded_amino_acids>86</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>SNIVMSIVVVLTLLFITPLFEYTPNAILSAIIISAVIGLVDYEATILIWKIDKFDFVACMGAFFGVVFASVEIGLIIAVSISLSNA*</predicted_protein_sequence>
            </orf_entry>
            <orf_entry>
              <id_line>
                <gDNA id="C04HBa0064G18.1" strand="-"/>
                <serials PGL_serial="2" AGS_serial="1" PPS_serial="2"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="5578" stop="5378"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>198</number_coding_nucleotides>
                  <number_encoded_amino_acids>66</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>QIHQGKPRQFNDCISLFLLLYRSQYHLLRFSSKSQGHEQLFLARSLGQMYIGTFNNIPRQHKFPVY*</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 13 chains have been computed
$ 
$ memory statistics:
$ 7136 bytes spliced alignments in total
$ 4 spliced alignments have been stored
$ 1784 bytes was the average size of a spliced alignment
$ 6704 bytes predicted gene locations in total
$ 2 predicted gene locations have been stored
$ 3352 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 13 backtrace matrices have been allocated
$ 
$ date finished: 2009-02-20 08:44:16
-->
