<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-01-17 02:22:22"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C07SLe0071O22-vj5My/GenomeThreader_SGN_U_tomato/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C07SLe0071O22-vj5My/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_U_tomato" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C07SLe0071O22-vj5My/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_U_tomato" ref_id="SGN-U346248" ref_strand="+" ref_description="SGN-U346248        Tomato 200607 #1 [1 ESTs aligned]">
      <seq>ccacacacatattagtgtagtgtcggagtttcgacaggatatataatatacgtagatcttatcagtatcattaacaaatagatatgaagttgtttttgataatcgtcgattaaaaacaaaaaaaaaagaagtgaaaatacaatagttatgaaaacctaagcaaaaataggtagttgcattacatttttcttgtttctacttttataagaatttggatcttgaaataaataaatcatgctctatataatagttattgatattaattttggtattatataaacccataaatatcgtggatttataatatcaagatatccttatttggaaccacacgattctaaatgatactgtgttcgtccattttacttgttcagtattgatattttaatgtatcagataagtaaaagtggacagaaagctaataccagtcaatataaatgtataaacttgtatcaaactatattatatatctctntataactatattatatatctctttatttcaatacttatgaaatttatttatttat</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07SLe0071O22-vj5My/GenomeThreader_SGN_U_tomato/un_xed_seqs" temp_id="C07SLe0071O22.1" temp_strand="+" temp_description="C07SLe0071O22.1  AC232631.1 htgs_phase:3 submitted_to_sgn_as:gi|205277508|gb|AC232631.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07SLe0071O22, complete sequence">
        <position start="754" stop="1884"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="1054" g_stop="1584" g_length="531"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="530" r_length="530" r_score="0.994"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07SLe0071O22.1" gen_strand="+" ref_id="SGN-U346248" ref_strand="+">
        <total_alignment_score>0.994</total_alignment_score>
        <cumulative_length_of_scored_exons>531</cumulative_length_of_scored_exons>
        <coverage percentage="1.002" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07SLe0071O22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-U346248" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="1054" e_stop="1584"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>CCACACACATATTAGTGTAGTGTCGGAGTTTCGACAGGATATATAATATACGTAGATCTTATCAGTATCATTAACAAATAGATATGAAGTTGTTTTTGATAATCGTCGATTAAAAACAAAAAAAAAAAGAAGTAAAAATACAATAGTTATGAAAACCTAAGCAAAAATAGGTAGTTGCATTACATTTTTCTTGTTTCTACTTTTATAAGAATTTGGATCTTGAAATAAATAAATCATGCTCTATATAATAGTTATTGATATTAATTTTGGTATTATATAAACCCATAAATATCGTGGATTTATAATATCAAGATATCCTTATTTGGAACCACACGATTCTAAATGATACTGTGTTCGTCCATTTTACTTGTTCAGTATTGATATTTTAATGTATCAGATAAGTAAAAGTGGACAGAAAGCTAATACCAGTCAATATAAATGTATAAACTTGTATCAAACTATATTATATATCTCTTTATAACTATATTATATATCTCTTTATTTCAATACTTATGAAATTTATTTATTTAT</genome_strand>
        <mrna_strand>CCACACACATATTAGTGTAGTGTCGGAGTTTCGACAGGATATATAATATACGTAGATCTTATCAGTATCATTAACAAATAGATATGAAGTTGTTTTTGATAATCGTCGATTAAAAAC-AAAAAAAAAAGAAGTGAAAATACAATAGTTATGAAAACCTAAGCAAAAATAGGTAGTTGCATTACATTTTTCTTGTTTCTACTTTTATAAGAATTTGGATCTTGAAATAAATAAATCATGCTCTATATAATAGTTATTGATATTAATTTTGGTATTATATAAACCCATAAATATCGTGGATTTATAATATCAAGATATCCTTATTTGGAACCACACGATTCTAAATGATACTGTGTTCGTCCATTTTACTTGTTCAGTATTGATATTTTAATGTATCAGATAAGTAAAAGTGGACAGAAAGCTAATACCAGTCAATATAAATGTATAAACTTGTATCAAACTATATTATATATCTCTNTATAACTATATTATATATCTCTTTATTTCAATACTTATGAAATTTATTTATTTAT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="+" PGL_start="1054" PGL_stop="1584"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="1054" e_stop="1584"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.994"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.994">
            <gDNA_exon_boundary e_start="1054" e_stop="1584" e_length="531"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="1054" stop="1584"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-U346248" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>CCACACACATATTAGTGTAGTGTCGGAGTTTCGACAGGATATATAATATACGTAGATCTTATCAGTATCATTAACAAATAGATATGAAGTTGTTTTTGATAATCGTCGATTAAAAACAAAAAAAAAAAGAAGTAAAAATACAATAGTTATGAAAACCTAAGCAAAAATAGGTAGTTGCATTACATTTTTCTTGTTTCTACTTTTATAAGAATTTGGATCTTGAAATAAATAAATCATGCTCTATATAATAGTTATTGATATTAATTTTGGTATTATATAAACCCATAAATATCGTGGATTTATAATATCAAGATATCCTTATTTGGAACCACACGATTCTAAATGATACTGTGTTCGTCCATTTTACTTGTTCAGTATTGATATTTTAATGTATCAGATAAGTAAAAGTGGACAGAAAGCTAATACCAGTCAATATAAATGTATAAACTTGTATCAAACTATATTATATATCTCTTTATAACTATATTATATATCTCTTTATTTCAATACTTATGAAATTTATTTATTTAT</gDNA_template>
            <first_frame> P  H  T  Y  *  C  S  V  G  V  S  T  G  Y  I  I  Y  V  D  L  I  S  I  I  N  K  *  I  *  S  C  F  *  *  S  S  I  K  N  K  K  K  K  K  *  K  Y  N  S  Y  E  N  L  S  K  N  R  *  L  H  Y  I  F  L  V  S  T  F  I  R  I  W  I  L  K  *  I  N  H  A  L  Y  N  S  Y  *  Y  *  F  W  Y  Y  I  N  P  *  I  S  W  I  Y  N  I  K  I  S  L  F  G  T  T  R  F  *  M  I  L  C  S  S  I  L  L  V  Q  Y  *  Y  F  N  V  S  D  K  *  K  W  T  E  S  *  Y  Q  S  I  *  M  Y  K  L  V  S  N  Y  I  I  Y  L  F  I  T  I  L  Y  I  S  L  F  Q  Y  L  *  N  L  F  I  Y </first_frame>
            <second_frame>  H  T  H  I  S  V  V  S  E  F  R  Q  D  I  *  Y  T  *  I  L  S  V  S  L  T  N  R  Y  E  V  V  F  D  N  R  R  L  K  T  K  K  K  R  S  K  N  T  I  V  M  K  T  *  A  K  I  G  S  C  I  T  F  F  L  F  L  L  L  *  E  F  G  S  *  N  K  *  I  M  L  Y  I  I  V  I  D  I  N  F  G  I  I  *  T  H  K  Y  R  G  F  I  I  S  R  Y  P  Y  L  E  P  H  D  S  K  *  Y  C  V  R  P  F  Y  L  F  S  I  D  I  L  M  Y  Q  I  S  K  S  G  Q  K  A  N  T  S  Q  Y  K  C  I  N  L  Y  Q  T  I  L  Y  I  S  L  *  L  Y  Y  I  S  L  Y  F  N  T  Y  E  I  Y  L  F   </second_frame>
            <third_frame>   T  H  I  L  V  *  C  R  S  F  D  R  I  Y  N  I  R  R  S  Y  Q  Y  H  *  Q  I  D  M  K  L  F  L  I  I  V  D  *  K  Q  K  K  K  E  V  K  I  Q  *  L  *  K  P  K  Q  K  *  V  V  A  L  H  F  S  C  F  Y  F  Y  K  N  L  D  L  E  I  N  K  S  C  S  I  *  *  L  L  I  L  I  L  V  L  Y  K  P  I  N  I  V  D  L  *  Y  Q  D  I  L  I  W  N  H  T  I  L  N  D  T  V  F  V  H  F  T  C  S  V  L  I  F  *  C  I  R  *  V  K  V  D  R  K  L  I  P  V  N  I  N  V  *  T  C  I  K  L  Y  Y  I  S  L  Y  N  Y  I  I  Y  L  F  I  S  I  L  M  K  F  I  Y  L  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <none gDNA_id="C07SLe0071O22.1"/>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 3 chains have been computed
$ 
$ memory statistics:
$ 2040 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 2040 bytes was the average size of a spliced alignment
$ 5528 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5528 bytes was the average size of a predicted gene location
$ 1 megabytes was the average size of the backtrace matrix
$ 4 backtrace matrices have been allocated
$ 
$ date finished: 2009-01-17 02:22:37
-->
