<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-01-06 14:22:13"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C07HBa0130B18-4DyN9/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C07HBa0130B18-4DyN9/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C07HBa0130B18-4DyN9/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M2354" ref_strand="+" ref_description="SGN-M2354 T1905 [cos_markers]">
      <seq>tcaattggtgaatcagattaccccaaggaaagtggttctaagaaacgggcaagggttgaatcatgtgctccaacaagttccaaagcttgcagagagaaactgcgaagagataggctgaatgacaagttcatggaattgggtgcactccttgagcctggaagaccccctaaaacagacaaatccgctattcttgttgatgctgttcgcttggtgacccagttacgtgatgaagctcaaaagttgaaagactcaaacttgaatctgcaagaaaagatcaaggagttaaaggttgagaaaaccgagcttcgagatgaaaaacacaggctgaaagctgaaaaggagaagctagagcaacaactaaagactacaagtgcacagcctagttacttgcctcctgctataccttctgcatttgctgctcatggtcaatttccaggaagcaagctggtgccaatcatgagttaccctggtgtcgcgatgtggcaattcatgcctcctgctgctgttgatacttcac</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0130B18-4DyN9/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C07HBa0130B18.1" temp_strand="+" temp_description="C07HBa0130B18.1  AC210356.2 htgs_phase:3 submitted_to_sgn_as:C07HBa0130B18 upload_account_name:france">
        <position start="30326" stop="32287"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="30626" g_stop="30672" g_length="47"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="47" r_length="47" r_score="1.000"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="30673" i_stop="31260" i_length="588">
            <donor d_prob="0.999" d_score="1.00"/>
            <acceptor a_prob="0.998" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="31261" g_stop="31338" g_length="78"/>
          <reference_exon_boundary r_type="cDNA" r_start="48" r_stop="125" r_length="78" r_score="1.000"/>
        </exon>
        <intron i_serial="2">
          <gDNA_intron_boundary i_start="31339" i_stop="31414" i_length="76">
            <donor d_prob="0.963" d_score="1.00"/>
            <acceptor a_prob="0.936" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="3">
          <gDNA_exon_boundary g_start="31415" g_stop="31577" g_length="163"/>
          <reference_exon_boundary r_type="cDNA" r_start="126" r_stop="288" r_length="163" r_score="1.000"/>
        </exon>
        <intron i_serial="3">
          <gDNA_intron_boundary i_start="31578" i_stop="31758" i_length="181">
            <donor d_prob="0.999" d_score="1.00"/>
            <acceptor a_prob="0.986" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="4">
          <gDNA_exon_boundary g_start="31759" g_stop="31987" g_length="229"/>
          <reference_exon_boundary r_type="cDNA" r_start="289" r_stop="517" r_length="229" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0130B18.1" gen_strand="+" ref_id="SGN-M2354" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>517</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0130B18.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M2354" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="30626" e_stop="30672"/>
          <exon e_start="31261" e_stop="31338"/>
          <exon e_start="31415" e_stop="31577"/>
          <exon e_start="31759" e_stop="31987"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>TCAATTGGTGAATCAGATTACCCCAAGGAAAGTGGTTCTAAGAAACGGTAAGAATTTTTGCCTTTTCTGAACATTTGTGCTGATCTCCATCATTGATGTTGAATAAAGATGTGGTGCTGCCCTCAATTGTTAAATGTAGTTTAATTTGATTAGCTTCTGTTTCATATAATTATTATTTAAATCTGTGAGGTGACACATTTCCCACTCTCTTTCTAAGTTTTGAGTTTTTTTAAATCCTTTTTTATTCTGTGATTCATCATCTTGAAAAATCTGTTGTATTCTGCTTCTAACTGGCAAGATTTGAGAATGTAGAATCCATTAAACCGATTTATATGTTCTTGATTTAAAAGCCTGCATAATTCAAGACATATTCTTAAGTCTCTATTCGAAAGAATTCACTATGCCCTGGCATTCTTCAAGTTCATAAACGCTTCAACATTGTGTGATTTAACATGTTTCACGAAGTCCCACTGATATATTCCTAATCCTATAATTACAATGCAAGTTGAACGAATTTGTTGGTTGAAGTATTCCTTTTAGCTCCGGGGCCTCAATTTTACTGTTGAAAGGAAAGTCAGATGTCTTGACCTATATCTGTTTACTATTTTCTCTCACCATTTAGGTAATTGTTACAGGGCAAGGGTTGAATCATGTGCTCCAACAAGTTCCAAAGCTTGCAGAGAGAAACTGCGAAGAGATAGGCTGAATGACAAGTGATCTCACAACCCATTTCATAAAAACTTCTCCATTTATTTCATCCTTAATTGCTAAAATTGATCTACTTATCAGGTTCATGGAATTGGGTGCACTCCTTGAGCCTGGAAGACCCCCTAAAACAGACAAATCCGCTATTCTTGTTGATGCTGTTCGCTTGGTGACCCAGTTACGTGATGAAGCTCAAAAGTTGAAAGACTCAAACTTGAATCTGCAAGAAAAGATCAAGGAGTTAAAGGCTAGTATTAATTCCCTCGCAATGCTCCTAATAGAAAGTTGACTTTTTCTTAATCTTGCATCTGTCATTCCATTTGTTTAATGGTACCAAGGCTTTTCCATTTTGTAATGGTGACAAGACAAGCTAGAACATCACTTCACTCTTCTGCTCCTGAACTTCAAGCATGTGTTAACTTGTGTAGGTTGAGAAAACCGAGCTTCGAGATGAAAAACACAGGCTGAAAGCTGAAAAGGAGAAGCTAGAGCAACAACTAAAGACTACAAGTGCACAGCCTAGTTACTTGCCTCCTGCTATACCTTCTGCATTTGCTGCTCATGGTCAATTTCCAGGAAGCAAGCTGGTGCCAATCATGAGTTACCCTGGTGTCGCGATGTGGCAATTCATGCCTCCTGCTGCTGTTGATACTTCAC</genome_strand>
        <mrna_strand>TCAATTGGTGAATCAGATTACCCCAAGGAAAGTGGTTCTAAGAAACG............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCAAGGGTTGAATCATGTGCTCCAACAAGTTCCAAAGCTTGCAGAGAGAAACTGCGAAGAGATAGGCTGAATGACAA............................................................................GTTCATGGAATTGGGTGCACTCCTTGAGCCTGGAAGACCCCCTAAAACAGACAAATCCGCTATTCTTGTTGATGCTGTTCGCTTGGTGACCCAGTTACGTGATGAAGCTCAAAAGTTGAAAGACTCAAACTTGAATCTGCAAGAAAAGATCAAGGAGTTAAAG.....................................................................................................................................................................................GTTGAGAAAACCGAGCTTCGAGATGAAAAACACAGGCTGAAAGCTGAAAAGGAGAAGCTAGAGCAACAACTAAAGACTACAAGTGCACAGCCTAGTTACTTGCCTCCTGCTATACCTTCTGCATTTGCTGCTCATGGTCAATTTCCAGGAAGCAAGCTGGTGCCAATCATGAGTTACCCTGGTGTCGCGATGTGGCAATTCATGCCTCCTGCTGCTGTTGATACTTCAC</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C07HBa0130B18-4DyN9/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M75-F" ref_strand="+" ref_description="SGN-M75-F TG438-F [rflp_markers_forward]">
      <seq>atggaggccctttaacaaatgtcccacctccgggaggaattgttagagtgggagttgcctgtcagcagtatttgtccaacacttcagttgagcaattattttttgtcctagatttttacacatattttgggagagtaagcgaaaagatagcagttgctgggaggttcaattcgcaggcggaagtaagtcataaaactttaggtcgatcattaagcaaaaaggttcccggagatgctgctgtatgtttatcagtaaatgatctgcacctaagatttttggaatcttctgccgctgacatttcaggaatgccgttggtccaatttataggcaaagggctgtccatcaaagttactcatagaaccttggggggtgctatagccatttcgtccagtttgctttgggaaggtgttgaagttgattgtgcagacactctgagtagcttgccacgtgaggacagctcggtgtggactt</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0130B18-4DyN9/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C07HBa0130B18.1" temp_strand="+" temp_description="C07HBa0130B18.1  AC210356.2 htgs_phase:3 submitted_to_sgn_as:C07HBa0130B18 upload_account_name:france">
        <position start="62422" stop="63492"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="62722" g_stop="63192" g_length="471"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="471" r_length="471" r_score="0.994"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0130B18.1" gen_strand="+" ref_id="SGN-M75-F" ref_strand="+">
        <total_alignment_score>0.994</total_alignment_score>
        <cumulative_length_of_scored_exons>471</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0130B18.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M75-F" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="62722" e_stop="63192"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>ATGGAGGCCCTTTAACAAATGTCCCACCTCCGGGAGGAATTGTTAGAGTGGGAGTTGCCTGTCAGCAGTATTTGTCCAACACTTCAGTTGAGCAATTATTTTTTGTCCTAGATTTTTACACATATTTTGGGAGAGTAAGCGAAAAGATAGCAGTTGCTGGGAGGTTCAATTCGCAGGCGGAAGTAAGTCATAAAACTTTAGGTCGATCATTAAGCAAAAAGGTTCCCGGAGATGCTGCTGTATGTTTATCAGTAAATGATCTGCACCTAAGATTTTTGGAATCTTCTGCTGCTGACATTTCAGGAATGCCGTTGGTCCAATTTATAGGCAAAGGCCTGTTCATCAAAGTTACTCATAGAACCTTGGGGGGTGCTATAGCCATTTCGTCCAGTTTGCTTTGGGAAGGTGTTGAAGTTGATTGTGCAGACACTCTGAGTAGCTTGCCACGTGAGGACAGCTCGGTGTGGACTT</genome_strand>
        <mrna_strand>ATGGAGGCCCTTTAACAAATGTCCCACCTCCGGGAGGAATTGTTAGAGTGGGAGTTGCCTGTCAGCAGTATTTGTCCAACACTTCAGTTGAGCAATTATTTTTTGTCCTAGATTTTTACACATATTTTGGGAGAGTAAGCGAAAAGATAGCAGTTGCTGGGAGGTTCAATTCGCAGGCGGAAGTAAGTCATAAAACTTTAGGTCGATCATTAAGCAAAAAGGTTCCCGGAGATGCTGCTGTATGTTTATCAGTAAATGATCTGCACCTAAGATTTTTGGAATCTTCTGCCGCTGACATTTCAGGAATGCCGTTGGTCCAATTTATAGGCAAAGGGCTGTCCATCAAAGTTACTCATAGAACCTTGGGGGGTGCTATAGCCATTTCGTCCAGTTTGCTTTGGGAAGGTGTTGAAGTTGATTGTGCAGACACTCTGAGTAGCTTGCCACGTGAGGACAGCTCGGTGTGGACTT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C07HBa0130B18-4DyN9/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M75-R" ref_strand="+" ref_description="SGN-M75-R TG438-R [rflp_markers_reverse]">
      <seq>cagctcctagttaggttacttgtcttaaaaatctccatgaaaagaaaaaaagttacaagtaagtgagcaaaagtgacaataactgcaaggcctcaatcccaatcaagttgggatcgactatatgaatactgaccatgttgctccatttaaacacatctcaggccattattaaaacaagagaacaaagaaactagttatttgcataaagactaaggttagtgcatatttatctgttttaagctataaagatagatggaaaaacagcaaaacaatcattgcaatgtttcttgtctagaccttgttttaaagttacagtcggaaaaaccccatatgcaagatataaagtattttctaacatgaatcaaagtttatcatttccaccaaggcaaatatattgcacaataagaataaagtgcttacagtaatcaactcgagggggtatctttttttgccaggagattttccgctgtcatttgttacatgcttagaactgct</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0130B18-4DyN9/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C07HBa0130B18.1" temp_strand="-" temp_description="C07HBa0130B18.1  AC210356.2 htgs_phase:3 submitted_to_sgn_as:C07HBa0130B18 upload_account_name:france">
        <position start="64964" stop="63871"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="64664" g_stop="64171" g_length="494"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="495" r_length="495" r_score="0.996"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0130B18.1" gen_strand="-" ref_id="SGN-M75-R" ref_strand="+">
        <total_alignment_score>0.996</total_alignment_score>
        <cumulative_length_of_scored_exons>494</cumulative_length_of_scored_exons>
        <coverage percentage="0.998" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0130B18.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-M75-R" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="64664" e_stop="64171"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>CAGCTCCTAGTTAGGTTACTTGTCTTAAAAATCTCCATGAAAAGAAAAAAAGTTACAAGTAAGTGAGCAAAAGTGACAATAACTGCAAGGCCTCAATCCCAATCAAGTTGGGATCGACTATATGAATACTGACCATGTTGCTCCATTTAAACACATCTCAGGCCATTATTAAAACAAGAGAACAAAGAAACTAGTTATTTGCATAAAGACTAAGGTTAGTGCATATTTATCTGTTTTAAGCTATAAAGATAGATGGAAAAACAGCAAAACAATCATTGCAATGTTTCTTGTCTAGACCTTGTTTTAAAGTTACAGTCGGAAAAACCCCATATGCAAGATATAAAGTATTTTCTAACATGAATC-AAGTTTATCATTTCCACCAAGGCAAATATATTGCACAATAAGAATAAAGTGCTTACAGTAATCAACTCGAGGGGGTATCTTTTTTTGCCAGGAGATTTTCCGCTGTCATTTGTTACATGCTTAGAACTGCT</genome_strand>
        <mrna_strand>CAGCTCCTAGTTAGGTTACTTGTCTTAAAAATCTCCATGAAAAGAAAAAAAGTTACAAGTAAGTGAGCAAAAGTGACAATAACTGCAAGGCCTCAATCCCAATCAAGTTGGGATCGACTATATGAATACTGACCATGTTGCTCCATTTAAACACATCTCAGGCCATTATTAAAACAAGAGAACAAAGAAACTAGTTATTTGCATAAAGACTAAGGTTAGTGCATATTTATCTGTTTTAAGCTATAAAGATAGATGGAAAAACAGCAAAACAATCATTGCAATGTTTCTTGTCTAGACCTTGTTTTAAAGTTACAGTCGGAAAAACCCCATATGCAAGATATAAAGTATTTTCTAACATGAATCAAAGTTTATCATTTCCACCAAGGCAAATATATTGCACAATAAGAATAAAGTGCTTACAGTAATCAACTCGAGGGGGTATCTTTTTTTGCCAGGAGATTTTCCGCTGTCATTTGTTACATGCTTAGAACTGCT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>3</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="+" PGL_start="30626" PGL_stop="31987"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="30626" e_stop="30672"/>
            <exon e_start="31261" e_stop="31338"/>
            <exon e_start="31415" e_stop="31577"/>
            <exon e_start="31759" e_stop="31987"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.999" acc_prob="0.998" e_score="1.000"/>
          <exon-intron don_prob="0.963" acc_prob="0.936" e_score="1.000"/>
          <exon-intron don_prob="0.999" acc_prob="0.986" e_score="1.000"/>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="30626" e_stop="30672" e_length="47"/>
          </exon>
          <intron i_serial="1" don_prob="0.999" acc_prob="0.998">
            <gDNA_intron_boundary i_start="30673" i_stop="31260" i_length="588"/>
          </intron>
          <exon e_serial="2" e_score="1.000">
            <gDNA_exon_boundary e_start="31261" e_stop="31338" e_length="78"/>
          </exon>
          <intron i_serial="2" don_prob="0.963" acc_prob="0.936">
            <gDNA_intron_boundary i_start="31339" i_stop="31414" i_length="76"/>
          </intron>
          <exon e_serial="3" e_score="1.000">
            <gDNA_exon_boundary e_start="31415" e_stop="31577" e_length="163"/>
          </exon>
          <intron i_serial="3" don_prob="0.999" acc_prob="0.986">
            <gDNA_intron_boundary i_start="31578" i_stop="31758" i_length="181"/>
          </intron>
          <exon e_serial="4" e_score="1.000">
            <gDNA_exon_boundary e_start="31759" e_stop="31987" e_length="229"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="30626" stop="30672"/>
              <exon start="31261" stop="31338"/>
              <exon start="31415" stop="31577"/>
              <exon start="31759" stop="31987"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M2354" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>TCAATTGGTGAATCAGATTACCCCAAGGAAAGTGGTTCTAAGAAACG : GGCAAGGGTTGAATCATGTGCTCCAACAAGTTCCAAAGCTTGCAGAGAGAAACTGCGAAGAGATAGGCTGAATGACAA : GTTCATGGAATTGGGTGCACTCCTTGAGCCTGGAAGACCCCCTAAAACAGACAAATCCGCTATTCTTGTTGATGCTGTTCGCTTGGTGACCCAGTTACGTGATGAAGCTCAAAAGTTGAAAGACTCAAACTTGAATCTGCAAGAAAAGATCAAGGAGTTAAAG : GTTGAGAAAACCGAGCTTCGAGATGAAAAACACAGGCTGAAAGCTGAAAAGGAGAAGCTAGAGCAACAACTAAAGACTACAAGTGCACAGCCTAGTTACTTGCCTCCTGCTATACCTTCTGCATTTGCTGCTCATGGTCAATTTCCAGGAAGCAAGCTGGTGCCAATCATGAGTTACCCTGGTGTCGCGATGTGGCAATTCATGCCTCCTGCTGCTGTTGATACTTCAC</gDNA_template>
            <first_frame> S  I  G  E  S  D  Y  P  K  E  S  G  S  K  K  R :   A  R  V  E  S  C  A  P  T  S  S  K  A  C  R  E  K  L  R  R  D  R  L  N  D  K :   F  M  E  L  G  A  L  L  E  P  G  R  P  P  K  T  D  K  S  A  I  L  V  D  A  V  R  L  V  T  Q  L  R  D  E  A  Q  K  L  K  D  S  N  L  N  L  Q  E  K  I  K  E  L  K  :  V  E  K  T  E  L  R  D  E  K  H  R  L  K  A  E  K  E  K  L  E  Q  Q  L  K  T  T  S  A  Q  P  S  Y  L  P  P  A  I  P  S  A  F  A  A  H  G  Q  F  P  G  S  K  L  V  P  I  M  S  Y  P  G  V  A  M  W  Q  F  M  P  P  A  A  V  D  T  S  </first_frame>
            <second_frame>  Q  L  V  N  Q  I  T  P  R  K  V  V  L  R  N   : G  Q  G  L  N  H  V  L  Q  Q  V  P  K  L  A  E  R  N  C  E  E  I  G  *  M  T   : S  S  W  N  W  V  H  S  L  S  L  E  D  P  L  K  Q  T  N  P  L  F  L  L  M  L  F  A  W  *  P  S  Y  V  M  K  L  K  S  *  K  T  Q  T  *  I  C  K  K  R  S  R  S  *  R :   L  R  K  P  S  F  E  M  K  N  T  G  *  K  L  K  R  R  S  *  S  N  N  *  R  L  Q  V  H  S  L  V  T  C  L  L  L  Y  L  L  H  L  L  L  M  V  N  F  Q  E  A  S  W  C  Q  S  *  V  T  L  V  S  R  C  G  N  S  C  L  L  L  L  L  I  L  H </second_frame>
            <third_frame>   N  W  *  I  R  L  P  Q  G  K  W  F  *  E  T  :  G  K  G  *  I  M  C  S  N  K  F  Q  S  L  Q  R  E  T  A  K  R  *  A  E  *  Q  :  V  H  G  I  G  C  T  P  *  A  W  K  T  P  *  N  R  Q  I  R  Y  S  C  *  C  C  S  L  G  D  P  V  T  *  *  S  S  K  V  E  R  L  K  L  E  S  A  R  K  D  Q  G  V  K   : G  *  E  N  R  A  S  R  *  K  T  Q  A  E  S  *  K  G  E  A  R  A  T  T  K  D  Y  K  C  T  A  *  L  L  A  S  C  Y  T  F  C  I  C  C  S  W  S  I  S  R  K  Q  A  G  A  N  H  E  L  P  W  C  R  D  V  A  I  H  A  S  C  C  C  *  Y  F   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0130B18.1" strand="+"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="30626" stop="30672"/>
                    <exon start="31261" stop="31338"/>
                    <exon start="31415" stop="31577"/>
                    <exon start="31759" stop="31986"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>516</number_coding_nucleotides>
                  <number_encoded_amino_acids>172</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>SIGESDYPKESGSKKRARVESCAPTSSKACREKLRRDRLNDKFMELGALLEPGRPPKTDKSAILVDAVRLVTQLRDEAQKLKDSNLNLQEKIKELKVEKTELRDEKHRLKAEKEKLEQQLKTTSAQPSYLPPAIPSAFAAHGQFPGSKLVPIMSYPGVAMWQFMPPAAVDTS</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="2" PGL_strand="+" PGL_start="62722" PGL_stop="63192"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="62722" e_stop="63192"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.994"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.994">
            <gDNA_exon_boundary e_start="62722" e_stop="63192" e_length="471"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="62722" stop="63192"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M75-F" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="2" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>ATGGAGGCCCTTTAACAAATGTCCCACCTCCGGGAGGAATTGTTAGAGTGGGAGTTGCCTGTCAGCAGTATTTGTCCAACACTTCAGTTGAGCAATTATTTTTTGTCCTAGATTTTTACACATATTTTGGGAGAGTAAGCGAAAAGATAGCAGTTGCTGGGAGGTTCAATTCGCAGGCGGAAGTAAGTCATAAAACTTTAGGTCGATCATTAAGCAAAAAGGTTCCCGGAGATGCTGCTGTATGTTTATCAGTAAATGATCTGCACCTAAGATTTTTGGAATCTTCTGCTGCTGACATTTCAGGAATGCCGTTGGTCCAATTTATAGGCAAAGGCCTGTTCATCAAAGTTACTCATAGAACCTTGGGGGGTGCTATAGCCATTTCGTCCAGTTTGCTTTGGGAAGGTGTTGAAGTTGATTGTGCAGACACTCTGAGTAGCTTGCCACGTGAGGACAGCTCGGTGTGGACTT</gDNA_template>
            <first_frame> M  E  A  L  *  Q  M  S  H  L  R  E  E  L  L  E  W  E  L  P  V  S  S  I  C  P  T  L  Q  L  S  N  Y  F  L  S  *  I  F  T  H  I  L  G  E  *  A  K  R  *  Q  L  L  G  G  S  I  R  R  R  K  *  V  I  K  L  *  V  D  H  *  A  K  R  F  P  E  M  L  L  Y  V  Y  Q  *  M  I  C  T  *  D  F  W  N  L  L  L  L  T  F  Q  E  C  R  W  S  N  L  *  A  K  A  C  S  S  K  L  L  I  E  P  W  G  V  L  *  P  F  R  P  V  C  F  G  K  V  L  K  L  I  V  Q  T  L  *  V  A  C  H  V  R  T  A  R  C  G  L </first_frame>
            <second_frame>  W  R  P  F  N  K  C  P  T  S  G  R  N  C  *  S  G  S  C  L  S  A  V  F  V  Q  H  F  S  *  A  I  I  F  C  P  R  F  L  H  I  F  W  E  S  K  R  K  D  S  S  C  W  E  V  Q  F  A  G  G  S  K  S  *  N  F  R  S  I  I  K  Q  K  G  S  R  R  C  C  C  M  F  I  S  K  *  S  A  P  K  I  F  G  I  F  C  C  *  H  F  R  N  A  V  G  P  I  Y  R  Q  R  P  V  H  Q  S  Y  S  *  N  L  G  G  C  Y  S  H  F  V  Q  F  A  L  G  R  C  *  S  *  L  C  R  H  S  E  *  L  A  T  *  G  Q  L  G  V  D   </second_frame>
            <third_frame>   G  G  P  L  T  N  V  P  P  P  G  G  I  V  R  V  G  V  A  C  Q  Q  Y  L  S  N  T  S  V  E  Q  L  F  F  V  L  D  F  Y  T  Y  F  G  R  V  S  E  K  I  A  V  A  G  R  F  N  S  Q  A  E  V  S  H  K  T  L  G  R  S  L  S  K  K  V  P  G  D  A  A  V  C  L  S  V  N  D  L  H  L  R  F  L  E  S  S  A  A  D  I  S  G  M  P  L  V  Q  F  I  G  K  G  L  F  I  K  V  T  H  R  T  L  G  G  A  I  A  I  S  S  S  L  L  W  E  G  V  E  V  D  C  A  D  T  L  S  S  L  P  R  E  D  S  S  V  W  T  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0130B18.1" strand="+"/>
                <serials PGL_serial="2" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="62724" stop="63191"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>468</number_coding_nucleotides>
                  <number_encoded_amino_acids>156</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>GGPLTNVPPPGGIVRVGVACQQYLSNTSVEQLFFVLDFYTYFGRVSEKIAVAGRFNSQAEVSHKTLGRSLSKKVPGDAAVCLSVNDLHLRFLESSAADISGMPLVQFIGKGLFIKVTHRTLGGAIAISSSLLWEGVEVDCADTLSSLPREDSSVWT</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="3" PGL_strand="-" PGL_start="64664" PGL_stop="64171"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="64664" e_stop="64171"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.996"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.996">
            <gDNA_exon_boundary e_start="64664" e_stop="64171" e_length="494"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="64664" stop="64171"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M75-R" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="3" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>CAGCTCCTAGTTAGGTTACTTGTCTTAAAAATCTCCATGAAAAGAAAAAAAGTTACAAGTAAGTGAGCAAAAGTGACAATAACTGCAAGGCCTCAATCCCAATCAAGTTGGGATCGACTATATGAATACTGACCATGTTGCTCCATTTAAACACATCTCAGGCCATTATTAAAACAAGAGAACAAAGAAACTAGTTATTTGCATAAAGACTAAGGTTAGTGCATATTTATCTGTTTTAAGCTATAAAGATAGATGGAAAAACAGCAAAACAATCATTGCAATGTTTCTTGTCTAGACCTTGTTTTAAAGTTACAGTCGGAAAAACCCCATATGCAAGATATAAAGTATTTTCTAACATGAATCAAGTTTATCATTTCCACCAAGGCAAATATATTGCACAATAAGAATAAAGTGCTTACAGTAATCAACTCGAGGGGGTATCTTTTTTTGCCAGGAGATTTTCCGCTGTCATTTGTTACATGCTTAGAACTGCT</gDNA_template>
            <first_frame> Q  L  L  V  R  L  L  V  L  K  I  S  M  K  R  K  K  V  T  S  K  *  A  K  V  T  I  T  A  R  P  Q  S  Q  S  S  W  D  R  L  Y  E  Y  *  P  C  C  S  I  *  T  H  L  R  P  L  L  K  Q  E  N  K  E  T  S  Y  L  H  K  D  *  G  *  C  I  F  I  C  F  K  L  *  R  *  M  E  K  Q  Q  N  N  H  C  N  V  S  C  L  D  L  V  L  K  L  Q  S  E  K  P  H  M  Q  D  I  K  Y  F  L  T  *  I  K  F  I  I  S  T  K  A  N  I  L  H  N  K  N  K  V  L  T  V  I  N  S  R  G  Y  L  F  L  P  G  D  F  P  L  S  F  V  T  C  L  E  L   </first_frame>
            <second_frame>  S  S  *  L  G  Y  L  S  *  K  S  P  *  K  E  K  K  L  Q  V  S  E  Q  K  *  Q  *  L  Q  G  L  N  P  N  Q  V  G  I  D  Y  M  N  T  D  H  V  A  P  F  K  H  I  S  G  H  Y  *  N  K  R  T  K  K  L  V  I  C  I  K  T  K  V  S  A  Y  L  S  V  L  S  Y  K  D  R  W  K  N  S  K  T  I  I  A  M  F  L  V  *  T  L  F  *  S  Y  S  R  K  N  P  I  C  K  I  *  S  I  F  *  H  E  S  S  L  S  F  P  P  R  Q  I  Y  C  T  I  R  I  K  C  L  Q  *  S  T  R  G  G  I  F  F  C  Q  E  I  F  R  C  H  L  L  H  A  *  N  C  </second_frame>
            <third_frame>   A  P  S  *  V  T  C  L  K  N  L  H  E  K  K  K  S  Y  K  *  V  S  K  S  D  N  N  C  K  A  S  I  P  I  K  L  G  S  T  I  *  I  L  T  M  L  L  H  L  N  T  S  Q  A  I  I  K  T  R  E  Q  R  N  *  L  F  A  *  R  L  R  L  V  H  I  Y  L  F  *  A  I  K  I  D  G  K  T  A  K  Q  S  L  Q  C  F  L  S  R  P  C  F  K  V  T  V  G  K  T  P  Y  A  R  Y  K  V  F  S  N  M  N  Q  V  Y  H  F  H  Q  G  K  Y  I  A  Q  *  E  *  S  A  Y  S  N  Q  L  E  G  V  S  F  F  A  R  R  F  S  A  V  I  C  Y  M  L  R  T  A </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <none gDNA_id="C07HBa0130B18.1"/>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 12 chains have been computed
$ 
$ memory statistics:
$ 6360 bytes spliced alignments in total
$ 3 spliced alignments have been stored
$ 2120 bytes was the average size of a spliced alignment
$ 7976 bytes predicted gene locations in total
$ 3 predicted gene locations have been stored
$ 2658 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 12 backtrace matrices have been allocated
$ 
$ date finished: 2009-01-06 14:22:16
-->
