<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2008-03-26 23:59:04"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C07HBa0166A09-J8GzX/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/cxgn-bacpublish-resources-X4HUu1/sgn_marker_seqs" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-X4HUu1/sgn_marker_seqs" ref_id="SGN-M1464" ref_strand="+" ref_description="SGN-M1464 T0538 [cos_markers]">
      <seq>tttattaggcatattacttgaatccaatatgaaagaaattgaacaacacggaaacaaagatttcggattgacaacaacagaagtgattgaagaatgcaagttattctattttgctggacaggagaccacttcagtgttgctcgtgtggacgatggttttgctatgcctacatccagagtggcaagtacgggccagagaggaggttttacaggtcttcggaaatgaaaaaccagatttggaaggactaagtcacctcaaaattgtgacaatgatcttatacgagacattaaggctattccccccattaccggtatttagtagaaggaacaaagaagaagtcaaattaggggagctgcagctaccagctgaagtgatacttattatacctgcaatctttattcattatgacaaggaaatatggggcgaagatgcgaaggaattcaaaccagaaag</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0166A09-J8GzX/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C07HBa0166A09.1" temp_strand="+" temp_description="C07HBa0166A09.1  AC210359.1 htgs_phase:3 submitted_to_sgn_as:C07HBa0166A09 upload_account_name:france">
        <position start="107922" stop="109236"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="108222" g_stop="108483" g_length="262"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="262" r_length="262" r_score="1.000"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="108484" i_stop="108745" i_length="262">
            <donor d_prob="0.318" d_score="1.00"/>
            <acceptor a_prob="0.990" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="108746" g_stop="108936" g_length="191"/>
          <reference_exon_boundary r_type="cDNA" r_start="263" r_stop="453" r_length="191" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0166A09.1" gen_strand="+" ref_id="SGN-M1464" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>453</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0166A09.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M1464" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="108222" e_stop="108483"/>
          <exon e_start="108746" e_stop="108936"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>TTTATTAGGCATATTACTTGAATCCAATATGAAAGAAATTGAACAACACGGAAACAAAGATTTCGGATTGACAACAACAGAAGTGATTGAAGAATGCAAGTTATTCTATTTTGCTGGACAGGAGACCACTTCAGTGTTGCTCGTGTGGACGATGGTTTTGCTATGCCTACATCCAGAGTGGCAAGTACGGGCCAGAGAGGAGGTTTTACAGGTCTTCGGAAATGAAAAACCAGATTTGGAAGGACTAAGTCACCTCAAAATTGTAAGTACTTTCCGCTATGTCGTTGGCATAGATCAAACTTCAACAATCAAGGAAACTATAAAATCAGGATAAAACAAGTAGCTGTTAATGTGAAATCGTTCCGACTGGGCTCAGATAGCTAGGCCACTTCTATAATCCTATTTCAGTCTCGGAAGGGCAATTACTATGAGACTAAAATATCTCGCGAAGGCATGACCCCTGAATTTTGTAAGAAGTGAACTAATTCTACTTCCAACTTACGCAATGTATTTTTTTTCCATAGGTGACAATGATCTTATACGAGACATTAAGGCTATTCCCCCCATTACCGGTATTTAGTAGAAGGAACAAAGAAGAAGTCAAATTAGGGGAGCTGCAGCTACCAGCTGAAGTGATACTTATTATACCTGCAATCTTTATTCATTATGACAAGGAAATATGGGGCGAAGATGCGAAGGAATTCAAACCAGAAAG</genome_strand>
        <mrna_strand>TTTATTAGGCATATTACTTGAATCCAATATGAAAGAAATTGAACAACACGGAAACAAAGATTTCGGATTGACAACAACAGAAGTGATTGAAGAATGCAAGTTATTCTATTTTGCTGGACAGGAGACCACTTCAGTGTTGCTCGTGTGGACGATGGTTTTGCTATGCCTACATCCAGAGTGGCAAGTACGGGCCAGAGAGGAGGTTTTACAGGTCTTCGGAAATGAAAAACCAGATTTGGAAGGACTAAGTCACCTCAAAATT......................................................................................................................................................................................................................................................................GTGACAATGATCTTATACGAGACATTAAGGCTATTCCCCCCATTACCGGTATTTAGTAGAAGGAACAAAGAAGAAGTCAAATTAGGGGAGCTGCAGCTACCAGCTGAAGTGATACTTATTATACCTGCAATCTTTATTCATTATGACAAGGAAATATGGGGCGAAGATGCGAAGGAATTCAAACCAGAAAG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-X4HUu1/sgn_marker_seqs" ref_id="SGN-M656-R" ref_strand="+" ref_description="SGN-M656-R CT226-R [rflp_markers_reverse]">
      <seq>ttttttttttttttgggaatgaacaatttatatgcagcagtttatatagattttcattacataaacttattcgctcacaaaagacacgaggataacatttcaaaactacaacattgaaattcgaaaagggtgacttcagtcatagctcaactatttagtagtattcgagctgacaaatgaagaatatccatttcaatgtttgcgcagaagcagaggagcaccatactgtggatgaatagtaattgttgcaaatggagcatgcgtataagacggacagagttcaaaggagaacttttgtagtatcattgctattgccatttttgcttccatcattgcaaagttttgtccgatgcaaattcgagggccccaaccaaacggaataaacgagacttgaccttt</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0166A09-J8GzX/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C07HBa0166A09.1" temp_strand="-" temp_description="C07HBa0166A09.1  AC210359.1 htgs_phase:3 submitted_to_sgn_as:C07HBa0166A09 upload_account_name:france">
        <position start="109650" stop="108665"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="109363" g_stop="108965" g_length="399"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="399" r_length="399" r_score="0.967"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0166A09.1" gen_strand="-" ref_id="SGN-M656-R" ref_strand="+">
        <total_alignment_score>0.967</total_alignment_score>
        <cumulative_length_of_scored_exons>399</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0166A09.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-M656-R" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="109363" e_stop="108965"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GTATAAATAGGACTGGGAATGAACAATTTATATGCAGCAGTTTATATAGATTTTCATTACATAAACTTATTCGCTCACAAAAGACACGAGGATAACATTTCAAAACTACAACATTGAAATTCGAAAAGGGTGACTTCAGTCATAGCTCAACTATTTAGTAGTATTCGAGCTGATAAATGAAGAATATCCATTTCAATGTTTGCGCAGAAGCAGAGGAGCACCATACTGTGGATGAATAGTAATTGTTGCAAATGGAGCATGCGTATAAGACGGAGAGAGTTCAAAGGAGAACTTTTGTAGTATCATTGCTATTGCCATTTTTGCTTCCATCATTGCAAAGTTTTGTCCGATGCAAATTCGAGGTCCCCAACCAAACGGAATAAACGAGACTTGACCTTT</genome_strand>
        <mrna_strand>TTTTTTTTTTTTTTGGGAATGAACAATTTATATGCAGCAGTTTATATAGATTTTCATTACATAAACTTATTCGCTCACAAAAGACACGAGGATAACATTTCAAAACTACAACATTGAAATTCGAAAAGGGTGACTTCAGTCATAGCTCAACTATTTAGTAGTATTCGAGCTGACAAATGAAGAATATCCATTTCAATGTTTGCGCAGAAGCAGAGGAGCACCATACTGTGGATGAATAGTAATTGTTGCAAATGGAGCATGCGTATAAGACGGACAGAGTTCAAAGGAGAACTTTTGTAGTATCATTGCTATTGCCATTTTTGCTTCCATCATTGCAAAGTTTTGTCCGATGCAAATTCGAGGGCCCCAACCAAACGGAATAAACGAGACTTGACCTTT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>2</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="+" PGL_start="108222" PGL_stop="108936"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="108222" e_stop="108483"/>
            <exon e_start="108746" e_stop="108936"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.318" acc_prob="0.990" e_score="1.000"/>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="108222" e_stop="108483" e_length="262"/>
          </exon>
          <intron i_serial="1" don_prob="0.318" acc_prob="0.990">
            <gDNA_intron_boundary i_start="108484" i_stop="108745" i_length="262"/>
          </intron>
          <exon e_serial="2" e_score="1.000">
            <gDNA_exon_boundary e_start="108746" e_stop="108936" e_length="191"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="108222" stop="108483"/>
              <exon start="108746" stop="108936"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M1464" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>TTTATTAGGCATATTACTTGAATCCAATATGAAAGAAATTGAACAACACGGAAACAAAGATTTCGGATTGACAACAACAGAAGTGATTGAAGAATGCAAGTTATTCTATTTTGCTGGACAGGAGACCACTTCAGTGTTGCTCGTGTGGACGATGGTTTTGCTATGCCTACATCCAGAGTGGCAAGTACGGGCCAGAGAGGAGGTTTTACAGGTCTTCGGAAATGAAAAACCAGATTTGGAAGGACTAAGTCACCTCAAAATT : GTGACAATGATCTTATACGAGACATTAAGGCTATTCCCCCCATTACCGGTATTTAGTAGAAGGAACAAAGAAGAAGTCAAATTAGGGGAGCTGCAGCTACCAGCTGAAGTGATACTTATTATACCTGCAATCTTTATTCATTATGACAAGGAAATATGGGGCGAAGATGCGAAGGAATTCAAACCAGAAAG</gDNA_template>
            <first_frame> F  I  R  H  I  T  *  I  Q  Y  E  R  N  *  T  T  R  K  Q  R  F  R  I  D  N  N  R  S  D  *  R  M  Q  V  I  L  F  C  W  T  G  D  H  F  S  V  A  R  V  D  D  G  F  A  M  P  T  S  R  V  A  S  T  G  Q  R  G  G  F  T  G  L  R  K  *  K  T  R  F  G  R  T  K  S  P  Q  N   : C  D  N  D  L  I  R  D  I  K  A  I  P  P  I  T  G  I  *  *  K  E  Q  R  R  S  Q  I  R  G  A  A  A  T  S  *  S  D  T  Y  Y  T  C  N  L  Y  S  L  *  Q  G  N  M  G  R  R  C  E  G  I  Q  T  R  K </first_frame>
            <second_frame>  L  L  G  I  L  L  E  S  N  M  K  E  I  E  Q  H  G  N  K  D  F  G  L  T  T  T  E  V  I  E  E  C  K  L  F  Y  F  A  G  Q  E  T  T  S  V  L  L  V  W  T  M  V  L  L  C  L  H  P  E  W  Q  V  R  A  R  E  E  V  L  Q  V  F  G  N  E  K  P  D  L  E  G  L  S  H  L  K  I  :  V  T  M  I  L  Y  E  T  L  R  L  F  P  P  L  P  V  F  S  R  R  N  K  E  E  V  K  L  G  E  L  Q  L  P  A  E  V  I  L  I  I  P  A  I  F  I  H  Y  D  K  E  I  W  G  E  D  A  K  E  F  K  P  E   </second_frame>
            <third_frame>   Y  *  A  Y  Y  L  N  P  I  *  K  K  L  N  N  T  E  T  K  I  S  D  *  Q  Q  Q  K  *  L  K  N  A  S  Y  S  I  L  L  D  R  R  P  L  Q  C  C  S  C  G  R  W  F  C  Y  A  Y  I  Q  S  G  K  Y  G  P  E  R  R  F  Y  R  S  S  E  M  K  N  Q  I  W  K  D  *  V  T  S  K  L :   *  Q  *  S  Y  T  R  H  *  G  Y  S  P  H  Y  R  Y  L  V  E  G  T  K  K  K  S  N  *  G  S  C  S  Y  Q  L  K  *  Y  L  L  Y  L  Q  S  L  F  I  M  T  R  K  Y  G  A  K  M  R  R  N  S  N  Q  K  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0166A09.1" strand="+"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="108223" stop="108483"/>
                    <exon start="108746" stop="108934"/>
                  </exon_boundaries>
                  <frame>1</frame>
                  <number_coding_nucleotides>450</number_coding_nucleotides>
                  <number_encoded_amino_acids>150</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>LLGILLESNMKEIEQHGNKDFGLTTTEVIEECKLFYFAGQETTSVLLVWTMVLLCLHPEWQVRAREEVLQVFGNEKPDLEGLSHLKIVTMILYETLRLFPPLPVFSRRNKEEVKLGELQLPAEVILIIPAIFIHYDKEIWGEDAKEFKPE</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="2" PGL_strand="-" PGL_start="109363" PGL_stop="108965"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="109363" e_stop="108965"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.967"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.967">
            <gDNA_exon_boundary e_start="109363" e_stop="108965" e_length="399"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="109363" stop="108965"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M656-R" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="2" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>GTATAAATAGGACTGGGAATGAACAATTTATATGCAGCAGTTTATATAGATTTTCATTACATAAACTTATTCGCTCACAAAAGACACGAGGATAACATTTCAAAACTACAACATTGAAATTCGAAAAGGGTGACTTCAGTCATAGCTCAACTATTTAGTAGTATTCGAGCTGATAAATGAAGAATATCCATTTCAATGTTTGCGCAGAAGCAGAGGAGCACCATACTGTGGATGAATAGTAATTGTTGCAAATGGAGCATGCGTATAAGACGGAGAGAGTTCAAAGGAGAACTTTTGTAGTATCATTGCTATTGCCATTTTTGCTTCCATCATTGCAAAGTTTTGTCCGATGCAAATTCGAGGTCCCCAACCAAACGGAATAAACGAGACTTGACCTTT</gDNA_template>
            <first_frame> V  *  I  G  L  G  M  N  N  L  Y  A  A  V  Y  I  D  F  H  Y  I  N  L  F  A  H  K  R  H  E  D  N  I  S  K  L  Q  H  *  N  S  K  R  V  T  S  V  I  A  Q  L  F  S  S  I  R  A  D  K  *  R  I  S  I  S  M  F  A  Q  K  Q  R  S  T  I  L  W  M  N  S  N  C  C  K  W  S  M  R  I  R  R  R  E  F  K  G  E  L  L  *  Y  H  C  Y  C  H  F  C  F  H  H  C  K  V  L  S  D  A  N  S  R  S  P  T  K  R  N  K  R  D  L  T  F </first_frame>
            <second_frame>  Y  K  *  D  W  E  *  T  I  Y  M  Q  Q  F  I  *  I  F  I  T  *  T  Y  S  L  T  K  D  T  R  I  T  F  Q  N  Y  N  I  E  I  R  K  G  *  L  Q  S  *  L  N  Y  L  V  V  F  E  L  I  N  E  E  Y  P  F  Q  C  L  R  R  S  R  G  A  P  Y  C  G  *  I  V  I  V  A  N  G  A  C  V  *  D  G  E  S  S  K  E  N  F  C  S  I  I  A  I  A  I  F  A  S  I  I  A  K  F  C  P  M  Q  I  R  G  P  Q  P  N  G  I  N  E  T  *  P   </second_frame>
            <third_frame>   I  N  R  T  G  N  E  Q  F  I  C  S  S  L  Y  R  F  S  L  H  K  L  I  R  S  Q  K  T  R  G  *  H  F  K  T  T  T  L  K  F  E  K  G  D  F  S  H  S  S  T  I  *  *  Y  S  S  *  *  M  K  N  I  H  F  N  V  C  A  E  A  E  E  H  H  T  V  D  E  *  *  L  L  Q  M  E  H  A  Y  K  T  E  R  V  Q  R  R  T  F  V  V  S  L  L  L  P  F  L  L  P  S  L  Q  S  F  V  R  C  K  F  E  V  P  N  Q  T  E  *  T  R  L  D  L  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <none gDNA_id="C07HBa0166A09.1"/>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 15 chains have been computed
$ 
$ memory statistics:
$ 4320 bytes spliced alignments in total
$ 2 spliced alignments have been stored
$ 2160 bytes was the average size of a spliced alignment
$ 6736 bytes predicted gene locations in total
$ 2 predicted gene locations have been stored
$ 3368 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 17 backtrace matrices have been allocated
$ 
$ date finished: 2008-03-26 23:59:10
-->
