<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-01-19 11:24:30"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C09SLe0060E05-KPR5n/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C09SLe0060E05-KPR5n/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C09SLe0060E05-KPR5n/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M2252" ref_strand="+" ref_description="SGN-M2252 T1761 [cos_markers]">
      <seq>aaaaatttcctagtacttctatttctatattagagaaccatcctattatgttttcttttaaaaaatgggttcaaaaggaaagttaatttccgaaatagaaataaaaggttgcaaggatttatttcatgaaatattttgtgaaaaaccacaccatcttccaaatattgtaccacaaactattcaagctgttgatttacatgaaggtgattggggtactgctggctccgttgtaaattggaattatactatcgaggggcaagaaaaagttgtaaaggtggttgtcgatgacataaacaaggaaaaaaggttagtgacattcaaggcatttgaaggtcatttgatagaggaatacacggccttctaagcaactcttcatattgagaatgaaggagataacaacttggttatatggactattgaatatgaaaagcaaaatgaagaaattcaagaacccttctcttatttgcaattagccactaatctaaccaaagatgttgacactcatcatg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C09SLe0060E05-KPR5n/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C09SLe0060E05.2" temp_strand="-" temp_description="C09SLe0060E05.2  AC232937.2 htgs_phase:2 submitted_to_sgn_as:gnl|gbrgsp|C09SLe0060E05 upload_account_name:spain (1 - 73057)">
        <position start="11197" stop="9804"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="10908" g_stop="10657" g_length="252"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="251" r_length="251" r_score="0.948"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="10656" i_stop="10362" i_length="295">
            <donor d_prob="0.974" d_score="0.98"/>
            <acceptor a_prob="0.998" a_score="0.96"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="10361" g_stop="10104" g_length="258"/>
          <reference_exon_boundary r_type="cDNA" r_start="252" r_stop="509" r_length="258" r_score="0.984"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C09SLe0060E05.2" gen_strand="-" ref_id="SGN-M2252" ref_strand="+">
        <total_alignment_score>0.967</total_alignment_score>
        <cumulative_length_of_scored_exons>510</cumulative_length_of_scored_exons>
        <coverage percentage="1.002" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C09SLe0060E05.2" gen_strand="-"/>
        <rDNA rDNA_id="SGN-M2252" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="10908" e_stop="10657"/>
          <exon e_start="10361" e_stop="10104"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAAAATTTCAATAATACTTCTATTTCTATATTTGAGAACAATTTTATTATATTTTCTTTTGAAAAATGGGTTTAAAAGGAAAGTTGATTTCCGAAATAGAAATAAAAGGTTGTAAGGATTTATTTCATGAAATATTTTGTGAAAAACCACACCATCTTCCAAATATTGTACCACAAACTATTCAAGCTGTTGATTTACATGAAGGTGATTGGGGTACTGTTGGCTCCGTTGTAAATTGGAATTATACTATCGGTAATATTTTCATTTTGATTAACGATTATTTATAACAGTTTTTCTCTATTTATAATCGAAAAATAAGACTCTAAATAAAGCGTTAAACATAAAGGATTATTTGTGTACCAAACAACAAATTTACTTTTCATTGAGCCAATAATAATATTTATTTGTATTCTTGATTATGTTCATTTATAAATAGAAAATCTCAAAAAATATACATTATATTTGGAGAAAAATATTACATTTAATGTATCATTTTTTTTTTATAAATATGTAACTTTCCATCTCTTTTTTTTTTCACAAAAAATAGAGGGGCAGGAAAAAGTTGTAAAGGTGGTTGTTGATGACATAAACAAGGAAAAAAGGTTAGTGACATTCAAGGCATTTGAAGGTCATTTGATAGAGGAATACAAGGCCTTCAAAGCAACTCTTCATATTGAGAATGAAGGAGATAACAACTTGGTTATATGGACTATTGAATATGAAAAGCAAAATGAAGAAATTCAAGAACCCTTCTCTTATTTGCAATTAGCCACTAATCTAACCAAAGATGTTGACACTCATCATG</genome_strand>
        <mrna_strand>AAAAATTTC-CTAGTACTTCTATTTCTATATTAGAGAACCATCCTATTATGTTTTCTTTTAAAAAATGGGTTCAAAAGGAAAGTTAATTTCCGAAATAGAAATAAAAGGTTGCAAGGATTTATTTCATGAAATATTTTGTGAAAAACCACACCATCTTCCAAATATTGTACCACAAACTATTCAAGCTGTTGATTTACATGAAGGTGATTGGGGTACTGCTGGCTCCGTTGTAAATTGGAATTATACTATCG.......................................................................................................................................................................................................................................................................................................AGGGGCAAGAAAAAGTTGTAAAGGTGGTTGTCGATGACATAAACAAGGAAAAAAGGTTAGTGACATTCAAGGCATTTGAAGGTCATTTGATAGAGGAATACACGGCCTTCTAAGCAACTCTTCATATTGAGAATGAAGGAGATAACAACTTGGTTATATGGACTATTGAATATGAAAAGCAAAATGAAGAAATTCAAGAACCCTTCTCTTATTTGCAATTAGCCACTAATCTAACCAAAGATGTTGACACTCATCATG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C09SLe0060E05-KPR5n/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M3162" ref_strand="+" ref_description="SGN-M3162 cLPT-4-C24 [est_clones]">
      <seq>gcaaatccgctcgtcctgtttttccctttcttttcgaaaacccagatctgaaaaagggtctctgttcatcaaatttcaaacccaaaccctaaattcttctcattcacacgttattccgattcgaatcaaccttcaaaattgatccgaatcgagaaatcttcacacaacaatgggggatttcaatctcgccttggttattgtagccattgtagtatgtattctcgttttcatagtcaatgtctatcttctcatcaattatcagcatcctgatgatgctaatcaagcctatttccccaaatttgttgtcgtctttggcttatcagtcgctgccatttctattctcatgttaccggccgatgttgctaatcggcaggcatgtcaacacgcgatttataatggagcgtgtaatctcacgctcccgatgaagcaactatggcttgctatctacattgttgatgctattctcgttttcttcgtcattccttgtgctatgttttattacgaaggcgaccaggataagactattgccaaaaggcttaaaagtgcaatgtgttgggtg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C09SLe0060E05-KPR5n/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C09SLe0060E05.2" temp_strand="+" temp_description="C09SLe0060E05.2  AC232937.2 htgs_phase:2 submitted_to_sgn_as:gnl|gbrgsp|C09SLe0060E05 upload_account_name:spain (1 - 73057)">
        <position start="62198" stop="63440"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="62498" g_stop="63017" g_length="520"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="519" r_length="519" r_score="0.985"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="63018" i_stop="63100" i_length="83">
            <donor d_prob="0.553" d_score="0.98"/>
            <acceptor a_prob="0.996" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="63101" g_stop="63140" g_length="40"/>
          <reference_exon_boundary r_type="cDNA" r_start="520" r_stop="559" r_length="40" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C09SLe0060E05.2" gen_strand="+" ref_id="SGN-M3162" ref_strand="+">
        <total_alignment_score>0.985</total_alignment_score>
        <cumulative_length_of_scored_exons>560</cumulative_length_of_scored_exons>
        <coverage percentage="1.002" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C09SLe0060E05.2" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M3162" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="62498" e_stop="63017"/>
          <exon e_start="63101" e_stop="63140"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GCAAATCCGCCCGTCCTGTTTTTCCCCTTTCTTTTCGAAAACCCAGATCTGAAAAAGGGTCTCTGTTCATCAAATTTCAAACCCAAACCCTAAATTCTTCTCATTCACACGTTATTCCGATTCGAATCAACCTTCAAAATTGATCCGAATCGAGAAATCTTCACACAACAATGGGGGATTTCAATCTCGCCTTGGTTATTGTAGCCATTGTAGTATGTATTCTCGTTTTCGTAGTCAATGTCTATCTTCTCATCAATTATCAGCACCCTGATGATGCAAATCAAGCCTATTTCCCCAAATTTGTTGTCGTTTTTGGCTTATCAGTCGCTGCCATTTCTATTCTCATGTTACCGGCCGATGTTGCTAATCGGCAGGCATGTCAACACGCGATTTATAATGGAGCGTGTAATCTCACGCTCCCAATGAAGCAACTATGGCTTGCTATCTACATTGTTGATGCTATTCTCGTTTTCTTCGTCATTCCTTTTGCTATGTTTTATTACGAAGGCGACCAGGATAAGTACGTGAATTTGAACAATTTTGGATGTGATGTGTATGGTATGGTATTGCTGTTCTGATGTTTTTATTTTCTGTTTTCTGTAGGACTATTGCCAAAAGGCTTAAAAGTGCAATGTGTTGGGTG</genome_strand>
        <mrna_strand>GCAAATCCGCTCGTCCTGTTTTT-CCCTTTCTTTTCGAAAACCCAGATCTGAAAAAGGGTCTCTGTTCATCAAATTTCAAACCCAAACCCTAAATTCTTCTCATTCACACGTTATTCCGATTCGAATCAACCTTCAAAATTGATCCGAATCGAGAAATCTTCACACAACAATGGGGGATTTCAATCTCGCCTTGGTTATTGTAGCCATTGTAGTATGTATTCTCGTTTTCATAGTCAATGTCTATCTTCTCATCAATTATCAGCATCCTGATGATGCTAATCAAGCCTATTTCCCCAAATTTGTTGTCGTCTTTGGCTTATCAGTCGCTGCCATTTCTATTCTCATGTTACCGGCCGATGTTGCTAATCGGCAGGCATGTCAACACGCGATTTATAATGGAGCGTGTAATCTCACGCTCCCGATGAAGCAACTATGGCTTGCTATCTACATTGTTGATGCTATTCTCGTTTTCTTCGTCATTCCTTGTGCTATGTTTTATTACGAAGGCGACCAGGATAA...................................................................................GACTATTGCCAAAAGGCTTAAAAGTGCAATGTGTTGGGTG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>2</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="10908" PGL_stop="10104"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="10908" e_stop="10657"/>
            <exon e_start="10361" e_stop="10104"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.974" acc_prob="0.998" e_score="0.948"/>
          <exon-only e_score="0.984"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.948">
            <gDNA_exon_boundary e_start="10908" e_stop="10657" e_length="252"/>
          </exon>
          <intron i_serial="1" don_prob="0.974" acc_prob="0.998">
            <gDNA_intron_boundary i_start="10656" i_stop="10362" i_length="295"/>
          </intron>
          <exon e_serial="2" e_score="0.984">
            <gDNA_exon_boundary e_start="10361" e_stop="10104" e_length="258"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="10908" stop="10657"/>
              <exon start="10361" stop="10104"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M2252" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>AAAAATTTCAATAATACTTCTATTTCTATATTTGAGAACAATTTTATTATATTTTCTTTTGAAAAATGGGTTTAAAAGGAAAGTTGATTTCCGAAATAGAAATAAAAGGTTGTAAGGATTTATTTCATGAAATATTTTGTGAAAAACCACACCATCTTCCAAATATTGTACCACAAACTATTCAAGCTGTTGATTTACATGAAGGTGATTGGGGTACTGTTGGCTCCGTTGTAAATTGGAATTATACTATCG : AGGGGCAGGAAAAAGTTGTAAAGGTGGTTGTTGATGACATAAACAAGGAAAAAAGGTTAGTGACATTCAAGGCATTTGAAGGTCATTTGATAGAGGAATACAAGGCCTTCAAAGCAACTCTTCATATTGAGAATGAAGGAGATAACAACTTGGTTATATGGACTATTGAATATGAAAAGCAAAATGAAGAAATTCAAGAACCCTTCTCTTATTTGCAATTAGCCACTAATCTAACCAAAGATGTTGACACTCATCATG</gDNA_template>
            <first_frame> K  N  F  N  N  T  S  I  S  I  F  E  N  N  F  I  I  F  S  F  E  K  W  V  *  K  E  S  *  F  P  K  *  K  *  K  V  V  R  I  Y  F  M  K  Y  F  V  K  N  H  T  I  F  Q  I  L  Y  H  K  L  F  K  L  L  I  Y  M  K  V  I  G  V  L  L  A  P  L  *  I  G  I  I  L  S  :  R  G  R  K  K  L  *  R  W  L  L  M  T  *  T  R  K  K  G  *  *  H  S  R  H  L  K  V  I  *  *  R  N  T  R  P  S  K  Q  L  F  I  L  R  M  K  E  I  T  T  W  L  Y  G  L  L  N  M  K  S  K  M  K  K  F  K  N  P  S  L  I  C  N  *  P  L  I  *  P  K  M  L  T  L  I  M </first_frame>
            <second_frame>  K  I  S  I  I  L  L  F  L  Y  L  R  T  I  L  L  Y  F  L  L  K  N  G  F  K  R  K  V  D  F  R  N  R  N  K  R  L  *  G  F  I  S  *  N  I  L  *  K  T  T  P  S  S  K  Y  C  T  T  N  Y  S  S  C  *  F  T  *  R  *  L  G  Y  C  W  L  R  C  K  L  E  L  Y  Y  R :   G  A  G  K  S  C  K  G  G  C  *  *  H  K  Q  G  K  K  V  S  D  I  Q  G  I  *  R  S  F  D  R  G  I  Q  G  L  Q  S  N  S  S  Y  *  E  *  R  R  *  Q  L  G  Y  M  D  Y  *  I  *  K  A  K  *  R  N  S  R  T  L  L  L  F  A  I  S  H  *  S  N  Q  R  C  *  H  S  S   </second_frame>
            <third_frame>   K  F  Q  *  Y  F  Y  F  Y  I  *  E  Q  F  Y  Y  I  F  F  *  K  M  G  L  K  G  K  L  I  S  E  I  E  I  K  G  C  K  D  L  F  H  E  I  F  C  E  K  P  H  H  L  P  N  I  V  P  Q  T  I  Q  A  V  D  L  H  E  G  D  W  G  T  V  G  S  V  V  N  W  N  Y  T  I   : E  G  Q  E  K  V  V  K  V  V  V  D  D  I  N  K  E  K  R  L  V  T  F  K  A  F  E  G  H  L  I  E  E  Y  K  A  F  K  A  T  L  H  I  E  N  E  G  D  N  N  L  V  I  W  T  I  E  Y  E  K  Q  N  E  E  I  Q  E  P  F  S  Y  L  Q  L  A  T  N  L  T  K  D  V  D  T  H  H  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C09SLe0060E05.2" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="10846" stop="10657"/>
                    <exon start="10361" stop="10105"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>447</number_coding_nucleotides>
                  <number_encoded_amino_acids>149</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>KMGLKGKLISEIEIKGCKDLFHEIFCEKPHHLPNIVPQTIQAVDLHEGDWGTVGSVVNWNYTIEGQEKVVKVVVDDINKEKRLVTFKAFEGHLIEEYKAFKATLHIENEGDNNLVIWTIEYEKQNEEIQEPFSYLQLATNLTKDVDTHH</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="2" PGL_strand="+" PGL_start="62498" PGL_stop="63140"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="62498" e_stop="63017"/>
            <exon e_start="63101" e_stop="63140"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.553" acc_prob="0.996" e_score="0.985"/>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.985">
            <gDNA_exon_boundary e_start="62498" e_stop="63017" e_length="520"/>
          </exon>
          <intron i_serial="1" don_prob="0.553" acc_prob="0.996">
            <gDNA_intron_boundary i_start="63018" i_stop="63100" i_length="83"/>
          </intron>
          <exon e_serial="2" e_score="1.000">
            <gDNA_exon_boundary e_start="63101" e_stop="63140" e_length="40"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="62498" stop="63017"/>
              <exon start="63101" stop="63140"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M3162" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="2" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>GCAAATCCGCCCGTCCTGTTTTTCCCCTTTCTTTTCGAAAACCCAGATCTGAAAAAGGGTCTCTGTTCATCAAATTTCAAACCCAAACCCTAAATTCTTCTCATTCACACGTTATTCCGATTCGAATCAACCTTCAAAATTGATCCGAATCGAGAAATCTTCACACAACAATGGGGGATTTCAATCTCGCCTTGGTTATTGTAGCCATTGTAGTATGTATTCTCGTTTTCGTAGTCAATGTCTATCTTCTCATCAATTATCAGCACCCTGATGATGCAAATCAAGCCTATTTCCCCAAATTTGTTGTCGTTTTTGGCTTATCAGTCGCTGCCATTTCTATTCTCATGTTACCGGCCGATGTTGCTAATCGGCAGGCATGTCAACACGCGATTTATAATGGAGCGTGTAATCTCACGCTCCCAATGAAGCAACTATGGCTTGCTATCTACATTGTTGATGCTATTCTCGTTTTCTTCGTCATTCCTTTTGCTATGTTTTATTACGAAGGCGACCAGGATAA : GACTATTGCCAAAAGGCTTAAAAGTGCAATGTGTTGGGTG</gDNA_template>
            <first_frame> A  N  P  P  V  L  F  F  P  F  L  F  E  N  P  D  L  K  K  G  L  C  S  S  N  F  K  P  K  P  *  I  L  L  I  H  T  L  F  R  F  E  S  T  F  K  I  D  P  N  R  E  I  F  T  Q  Q  W  G  I  S  I  S  P  W  L  L  *  P  L  *  Y  V  F  S  F  S  *  S  M  S  I  F  S  S  I  I  S  T  L  M  M  Q  I  K  P  I  S  P  N  L  L  S  F  L  A  Y  Q  S  L  P  F  L  F  S  C  Y  R  P  M  L  L  I  G  R  H  V  N  T  R  F  I  M  E  R  V  I  S  R  S  Q  *  S  N  Y  G  L  L  S  T  L  L  M  L  F  S  F  S  S  S  F  L  L  L  C  F  I  T  K  A  T  R  I   : R  L  L  P  K  G  L  K  V  Q  C  V  G   </first_frame>
            <second_frame>  Q  I  R  P  S  C  F  S  P  F  F  S  K  T  Q  I  *  K  R  V  S  V  H  Q  I  S  N  P  N  P  K  F  F  S  F  T  R  Y  S  D  S  N  Q  P  S  K  L  I  R  I  E  K  S  S  H  N  N  G  G  F  Q  S  R  L  G  Y  C  S  H  C  S  M  Y  S  R  F  R  S  Q  C  L  S  S  H  Q  L  S  A  P  *  *  C  K  S  S  L  F  P  Q  I  C  C  R  F  W  L  I  S  R  C  H  F  Y  S  H  V  T  G  R  C  C  *  S  A  G  M  S  T  R  D  L  *  W  S  V  *  S  H  A  P  N  E  A  T  M  A  C  Y  L  H  C  *  C  Y  S  R  F  L  R  H  S  F  C  Y  V  L  L  R  R  R  P  G  *  :  D  Y  C  Q  K  A  *  K  C  N  V  L  G  </second_frame>
            <third_frame>   K  S  A  R  P  V  F  P  L  S  F  R  K  P  R  S  E  K  G  S  L  F  I  K  F  Q  T  Q  T  L  N  S  S  H  S  H  V  I  P  I  R  I  N  L  Q  N  *  S  E  S  R  N  L  H  T  T  M  G  D  F  N  L  A  L  V  I  V  A  I  V  V  C  I  L  V  F  V  V  N  V  Y  L  L  I  N  Y  Q  H  P  D  D  A  N  Q  A  Y  F  P  K  F  V  V  V  F  G  L  S  V  A  A  I  S  I  L  M  L  P  A  D  V  A  N  R  Q  A  C  Q  H  A  I  Y  N  G  A  C  N  L  T  L  P  M  K  Q  L  W  L  A  I  Y  I  V  D  A  I  L  V  F  F  V  I  P  F  A  M  F  Y  Y  E  G  D  Q  D  K :   T  I  A  K  R  L  K  S  A  M  C  W  V </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C09SLe0060E05.2" strand="+"/>
                <serials PGL_serial="2" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="62641" stop="63017"/>
                    <exon start="63101" stop="63140"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>417</number_coding_nucleotides>
                  <number_encoded_amino_acids>139</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>SESRNLHTTMGDFNLALVIVAIVVCILVFVVNVYLLINYQHPDDANQAYFPKFVVVFGLSVAAISILMLPADVANRQACQHAIYNGACNLTLPMKQLWLAIYIVDAILVFFVIPFAMFYYEGDQDKTIAKRLKSAMCWV</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 6 chains have been computed
$ 
$ memory statistics:
$ 4560 bytes spliced alignments in total
$ 2 spliced alignments have been stored
$ 2280 bytes was the average size of a spliced alignment
$ 6768 bytes predicted gene locations in total
$ 2 predicted gene locations have been stored
$ 3384 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 6 backtrace matrices have been allocated
$ 
$ date finished: 2009-01-19 11:24:34
-->
