<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-01-19 11:27:55"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C09SLf0089I03-npLqx/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C09SLf0089I03-npLqx/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C09SLf0089I03-npLqx/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M1461" ref_strand="+" ref_description="SGN-M1461 T0532 [cos_markers]">
      <seq>accaaccctaagagggtcgccaaggcaattgcagagaagacttgcaatgctcttcttctcaaggttaaccaaatcggtagtgtgaccgagagtattgaagctgtgaagatgtccaagaaggcaggttggggtgtaatgaccagtcaccgcagtggagaaacagaagataccttcattgctgatcttgctgtcggtttgtcaacgggacaaatcaagactggagctccttgcaggtcagagcgtctcgccaagtacaaccagctgttgaggatcgaagaggaactcggatcagaggctgtttatgcaggagcaagcttccgcaagcccgttgagccctactaaatttcagcagttccaagtgttgag</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C09SLf0089I03-npLqx/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C09SLf0089I03.1" temp_strand="+" temp_description="C09SLf0089I03.1  AC234218.1 htgs_phase:2 submitted_to_sgn_as:gnl|gbrgsp|C09SLf0089I03 upload_account_name:spain (1 - 33962)">
        <position start="15640" stop="16959"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="15793" g_stop="15804" g_length="12"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="12" r_length="12" r_score="1.000"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="15805" i_stop="15941" i_length="137">
            <donor d_prob="1.000" d_score="0.00"/>
            <acceptor a_prob="1.000" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="15942" g_stop="15992" g_length="51"/>
          <reference_exon_boundary r_type="cDNA" r_start="13" r_stop="63" r_length="51" r_score="1.000"/>
        </exon>
        <intron i_serial="2">
          <gDNA_intron_boundary i_start="15993" i_stop="16078" i_length="86">
            <donor d_prob="0.994" d_score="1.00"/>
            <acceptor a_prob="0.965" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="3">
          <gDNA_exon_boundary g_start="16079" g_stop="16167" g_length="89"/>
          <reference_exon_boundary r_type="cDNA" r_start="64" r_stop="152" r_length="89" r_score="1.000"/>
        </exon>
        <intron i_serial="3">
          <gDNA_intron_boundary i_start="16168" i_stop="16271" i_length="104">
            <donor d_prob="0.982" d_score="1.00"/>
            <acceptor a_prob="0.998" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="4">
          <gDNA_exon_boundary g_start="16272" g_stop="16323" g_length="52"/>
          <reference_exon_boundary r_type="cDNA" r_start="153" r_stop="204" r_length="52" r_score="1.000"/>
        </exon>
        <intron i_serial="4">
          <gDNA_intron_boundary i_start="16324" i_stop="16404" i_length="81">
            <donor d_prob="0.999" d_score="1.00"/>
            <acceptor a_prob="0.000" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="5">
          <gDNA_exon_boundary g_start="16405" g_stop="16461" g_length="57"/>
          <reference_exon_boundary r_type="cDNA" r_start="205" r_stop="261" r_length="57" r_score="1.000"/>
        </exon>
        <intron i_serial="5">
          <gDNA_intron_boundary i_start="16462" i_stop="16554" i_length="93">
            <donor d_prob="0.997" d_score="1.00"/>
            <acceptor a_prob="0.962" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="6">
          <gDNA_exon_boundary g_start="16555" g_stop="16659" g_length="105"/>
          <reference_exon_boundary r_type="cDNA" r_start="262" r_stop="366" r_length="105" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C09SLf0089I03.1" gen_strand="+" ref_id="SGN-M1461" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>366</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C09SLf0089I03.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M1461" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="15793" e_stop="15804"/>
          <exon e_start="15942" e_stop="15992"/>
          <exon e_start="16079" e_stop="16167"/>
          <exon e_start="16272" e_stop="16323"/>
          <exon e_start="16405" e_stop="16461"/>
          <exon e_start="16555" e_stop="16659"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>ACCAACCCTAAGGTAAGGTTGAAGCTTGAACTATATTAAGTGGTTGCATATCACAGTTTTTGTTGCCATTGAAAAGAAAAGACAGACCGTCAATCAATTTCTCTAGGTGTTATTGTTTACCATGTTTACTTATTTATAATGGCTTGCAGAGGGTCGCCAAGGCAATTGCAGAGAAGACTTGCAATGCTCTTCTTCTCAAGGTATAGGTCATATATATCCCCGTCATGATAATCAAAGTTTCCTCTTTGAGATTGTATTAAAACATTTCTCTCTCGCTGTGTGTCAGGTTAACCAAATCGGTAGTGTGACCGAGAGTATTGAAGCTGTGAAGATGTCCAAGAAGGCAGGTTGGGGTGTAATGACCAGTCACCGCAGGTAAAGAACCAACGATCCTCATCCTCCACGATATCACTTCACAGAAAGTATAATAAATTTCGAGTAGTCATGTTCTAATTATCTCATAAAACTAATTGTTGCAGTGGAGAAACAGAAGATACCTTCATTGCTGATCTTGCTGTCGGTTTGTCAACGGTAAGCTTTATAGAATCCAGATTATGATACTCAACAGATTGTAGGTGTTAACTTAACGAGTATTCTCCCGAATATAATCAGGGACAAATCAAGACTGGAGCTCCTTGCAGGTCAGAGCGTCTCGCCAAGTACAACCAGGTAATTTATCGTTCAAAAATCCAGCCGTTGAACTCTTTCAAGTACACTTGCATTCCCAGCAAGCTTTTCTGATATTTCGTTCATCCTATTTAGCTGTTGAGGATCGAAGAGGAACTCGGATCAGAGGCTGTTTATGCAGGAGCAAGCTTCCGCAAGCCCGTTGAGCCCTACTAAATTTCAGCAGTTCCAAGTGTTGAG</genome_strand>
        <mrna_strand>ACCAACCCTAAG.........................................................................................................................................AGGGTCGCCAAGGCAATTGCAGAGAAGACTTGCAATGCTCTTCTTCTCAAG......................................................................................GTTAACCAAATCGGTAGTGTGACCGAGAGTATTGAAGCTGTGAAGATGTCCAAGAAGGCAGGTTGGGGTGTAATGACCAGTCACCGCAG........................................................................................................TGGAGAAACAGAAGATACCTTCATTGCTGATCTTGCTGTCGGTTTGTCAACG.................................................................................GGACAAATCAAGACTGGAGCTCCTTGCAGGTCAGAGCGTCTCGCCAAGTACAACCAG.............................................................................................CTGTTGAGGATCGAAGAGGAACTCGGATCAGAGGCTGTTTATGCAGGAGCAAGCTTCCGCAAGCCCGTTGAGCCCTACTAAATTTCAGCAGTTCCAAGTGTTGAG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="+" PGL_start="15793" PGL_stop="16659"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="15793" e_stop="15804"/>
            <exon e_start="15942" e_stop="15992"/>
            <exon e_start="16079" e_stop="16167"/>
            <exon e_start="16272" e_stop="16323"/>
            <exon e_start="16405" e_stop="16461"/>
            <exon e_start="16555" e_stop="16659"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="1.000" acc_prob="1.000" e_score="1.000"/>
          <exon-intron don_prob="0.994" acc_prob="0.965" e_score="1.000"/>
          <exon-intron don_prob="0.982" acc_prob="0.998" e_score="1.000"/>
          <exon-intron don_prob="0.999" acc_prob="0.000" e_score="1.000"/>
          <exon-intron don_prob="0.997" acc_prob="0.962" e_score="1.000"/>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="15793" e_stop="15804" e_length="12"/>
          </exon>
          <intron i_serial="1" don_prob="1.000" acc_prob="1.000">
            <gDNA_intron_boundary i_start="15805" i_stop="15941" i_length="137"/>
          </intron>
          <exon e_serial="2" e_score="1.000">
            <gDNA_exon_boundary e_start="15942" e_stop="15992" e_length="51"/>
          </exon>
          <intron i_serial="2" don_prob="0.994" acc_prob="0.965">
            <gDNA_intron_boundary i_start="15993" i_stop="16078" i_length="86"/>
          </intron>
          <exon e_serial="3" e_score="1.000">
            <gDNA_exon_boundary e_start="16079" e_stop="16167" e_length="89"/>
          </exon>
          <intron i_serial="3" don_prob="0.982" acc_prob="0.998">
            <gDNA_intron_boundary i_start="16168" i_stop="16271" i_length="104"/>
          </intron>
          <exon e_serial="4" e_score="1.000">
            <gDNA_exon_boundary e_start="16272" e_stop="16323" e_length="52"/>
          </exon>
          <intron i_serial="4" don_prob="0.999" acc_prob="0.000">
            <gDNA_intron_boundary i_start="16324" i_stop="16404" i_length="81"/>
          </intron>
          <exon e_serial="5" e_score="1.000">
            <gDNA_exon_boundary e_start="16405" e_stop="16461" e_length="57"/>
          </exon>
          <intron i_serial="5" don_prob="0.997" acc_prob="0.962">
            <gDNA_intron_boundary i_start="16462" i_stop="16554" i_length="93"/>
          </intron>
          <exon e_serial="6" e_score="1.000">
            <gDNA_exon_boundary e_start="16555" e_stop="16659" e_length="105"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="15793" stop="15804"/>
              <exon start="15942" stop="15992"/>
              <exon start="16079" stop="16167"/>
              <exon start="16272" stop="16323"/>
              <exon start="16405" stop="16461"/>
              <exon start="16555" stop="16659"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M1461" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>ACCAACCCTAAG : AGGGTCGCCAAGGCAATTGCAGAGAAGACTTGCAATGCTCTTCTTCTCAAG : GTTAACCAAATCGGTAGTGTGACCGAGAGTATTGAAGCTGTGAAGATGTCCAAGAAGGCAGGTTGGGGTGTAATGACCAGTCACCGCAG : TGGAGAAACAGAAGATACCTTCATTGCTGATCTTGCTGTCGGTTTGTCAACG : GGACAAATCAAGACTGGAGCTCCTTGCAGGTCAGAGCGTCTCGCCAAGTACAACCAG : CTGTTGAGGATCGAAGAGGAACTCGGATCAGAGGCTGTTTATGCAGGAGCAAGCTTCCGCAAGCCCGTTGAGCCCTACTAAATTTCAGCAGTTCCAAGTGTTGAG</gDNA_template>
            <first_frame> T  N  P  K  :  R  V  A  K  A  I  A  E  K  T  C  N  A  L  L  L  K  :  V  N  Q  I  G  S  V  T  E  S  I  E  A  V  K  M  S  K  K  A  G  W  G  V  M  T  S  H  R  S :   G  E  T  E  D  T  F  I  A  D  L  A  V  G  L  S  T  :  G  Q  I  K  T  G  A  P  C  R  S  E  R  L  A  K  Y  N  Q  :  L  L  R  I  E  E  E  L  G  S  E  A  V  Y  A  G  A  S  F  R  K  P  V  E  P  Y  *  I  S  A  V  P  S  V  E </first_frame>
            <second_frame>  P  T  L  R :   G  S  P  R  Q  L  Q  R  R  L  A  M  L  F  F  S  R :   L  T  K  S  V  V  *  P  R  V  L  K  L  *  R  C  P  R  R  Q  V  G  V  *  *  P  V  T  A   : V  E  K  Q  K  I  P  S  L  L  I  L  L  S  V  C  Q  R :   D  K  S  R  L  E  L  L  A  G  Q  S  V  S  P  S  T  T  S :   C  *  G  S  K  R  N  S  D  Q  R  L  F  M  Q  E  Q  A  S  A  S  P  L  S  P  T  K  F  Q  Q  F  Q  V  L   </second_frame>
            <third_frame>   Q  P  *   : E  G  R  Q  G  N  C  R  E  D  L  Q  C  S  S  S  Q   : G  *  P  N  R  *  C  D  R  E  Y  *  S  C  E  D  V  Q  E  G  R  L  G  C  N  D  Q  S  P  Q  :  W  R  N  R  R  Y  L  H  C  *  S  C  C  R  F  V  N   : G  T  N  Q  D  W  S  S  L  Q  V  R  A  S  R  Q  V  Q  P   : A  V  E  D  R  R  G  T  R  I  R  G  C  L  C  R  S  K  L  P  Q  A  R  *  A  L  L  N  F  S  S  S  K  C  *  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C09SLf0089I03.1" strand="+"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="15793" stop="15804"/>
                    <exon start="15942" stop="15992"/>
                    <exon start="16079" stop="16167"/>
                    <exon start="16272" stop="16323"/>
                    <exon start="16405" stop="16461"/>
                    <exon start="16555" stop="16635"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>339</number_coding_nucleotides>
                  <number_encoded_amino_acids>113</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>TNPKRVAKAIAEKTCNALLLKVNQIGSVTESIEAVKMSKKAGWGVMTSHRSGETEDTFIADLAVGLSTGQIKTGAPCRSERLAKYNQLLRIEEELGSEAVYAGASFRKPVEPY*</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 10 chains have been computed
$ 
$ memory statistics:
$ 2024 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 2024 bytes was the average size of a spliced alignment
$ 5688 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5688 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 10 backtrace matrices have been allocated
$ 
$ date finished: 2009-01-19 11:27:58
-->
