<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-01-17 23:26:58"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C09SLm0018L06-QNRoK/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C09SLm0018L06-QNRoK/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C09SLm0018L06-QNRoK/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M8202-2" ref_strand="+" ref_description="SGN-M8202-2 C2_At4g09350-2 [cosii_markers]">
      <seq>gagaaagcccctccctctaagactactcaaatcagacacaaaacaaatttccaatttcatggcctcagcaacagctccaccagctccattcaccttcctttcaaggaacctaagcaataatgatcacagaacagatgccagatggttgacaacaaaacaaagaagacgccgtgttggcttacaagtttatgcaacagaagaaggggctagtgggcaacaacgtgctcctcctggtgttgacacaagaattcactgggaaaacgaagatgaaggatgggtaggagagagtaaatcacggtccacacaagaacgaatcaaaacagacaaaaagaatctccttgatgagaaattctcagacctcctcaacagttcagctaattctcactaccagttcttgggagtatctgcaacagctgatctggaggaaattaaagctgcatataggaggctatcaaaggagtatcatccagacacaactaaccttcctataagagcagcatcagagaaattcatgaaactaagagaaatttatgatgtcctgagtgatgaggaacaacgtcgattctatgattggacactagctcaggagacagcaagtcgagaagcagagaaaatgaaaatgaggctgcaag</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C09SLm0018L06-QNRoK/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C09SLm0018L06.1" temp_strand="+" temp_description="C09SLm0018L06.1  EF647612.1 htgs_phase:2 submitted_to_sgn_as:C09SLm0018L06 upload_account_name:spain">
        <position start="4657" stop="5974"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="4957" g_stop="5346" g_length="390"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="390" r_length="390" r_score="0.962"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="5347" i_stop="5432" i_length="86">
            <donor d_prob="0.998" d_score="0.98"/>
            <acceptor a_prob="0.999" a_score="0.98"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="5433" g_stop="5674" g_length="242"/>
          <reference_exon_boundary r_type="cDNA" r_start="391" r_stop="632" r_length="242" r_score="0.983"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C09SLm0018L06.1" gen_strand="+" ref_id="SGN-M8202-2" ref_strand="+">
        <total_alignment_score>0.970</total_alignment_score>
        <cumulative_length_of_scored_exons>632</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C09SLm0018L06.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M8202-2" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="4957" e_stop="5346"/>
          <exon e_start="5433" e_stop="5674"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GAGAAAGCCCCTCCCTCTAAGACTACTCAAATCAGACACAAAACAAATTTCCAATTCCATGGCGTCAGCAACAGCTCCACCAGCTCCATTCACCTTTCTTACAAGGAACCAAACCAATAATGAGCACAGAACAGATACCAGATGGTTGACAACAAAACAAAGAAGACGCCGTGTTGGCTTACAAGTTTATGCAAAAGAAGAAGGGGCTACTGGGCGACAACGTGCTCCTCCTGGTGTTGACACAAGAATTCACTGGGAAAACGAAGATGAAGGATGGGTAGGAGAGAGTAAGTCACGGTCCACACAAGAACGAATCAAAACAGACGAAAAGAATCTCTTTGATGAAAAATTCTCAGACCTCCTCAACAGTTCAGCTAATTCTCACTACCAGTTAGTCTTCATTATCTACTTTGCTATCTTCATCTTATCTCTTAATGTGTGGCTCACAGTTCATAATTCTAATGTTTCAAATTCAGGTTCTTGGGAGTATCTGCAACAGCTGATCTAGAGGAAATTAAAGCTGCATATAGGAGGCTATCAAAGGAGTATCATCCAGACACAACTAATCTTCCTATAAGAGCAGCATCAGAGAAATTTATGAAACTAAGAGAAATTTATGATGTCCTGAGTGATGAGGAACAACGACGATTCTATGATTGGACACTAGCTCAGGAGACAGCAAGTCGAGAAGCAGAGAAAATGAAAATGAGGCTGCAAG</genome_strand>
        <mrna_strand>GAGAAAGCCCCTCCCTCTAAGACTACTCAAATCAGACACAAAACAAATTTCCAATTTCATGGCCTCAGCAACAGCTCCACCAGCTCCATTCACCTTCCTTTCAAGGAACCTAAGCAATAATGATCACAGAACAGATGCCAGATGGTTGACAACAAAACAAAGAAGACGCCGTGTTGGCTTACAAGTTTATGCAACAGAAGAAGGGGCTAGTGGGCAACAACGTGCTCCTCCTGGTGTTGACACAAGAATTCACTGGGAAAACGAAGATGAAGGATGGGTAGGAGAGAGTAAATCACGGTCCACACAAGAACGAATCAAAACAGACAAAAAGAATCTCCTTGATGAGAAATTCTCAGACCTCCTCAACAGTTCAGCTAATTCTCACTACCA......................................................................................GTTCTTGGGAGTATCTGCAACAGCTGATCTGGAGGAAATTAAAGCTGCATATAGGAGGCTATCAAAGGAGTATCATCCAGACACAACTAACCTTCCTATAAGAGCAGCATCAGAGAAATTCATGAAACTAAGAGAAATTTATGATGTCCTGAGTGATGAGGAACAACGTCGATTCTATGATTGGACACTAGCTCAGGAGACAGCAAGTCGAGAAGCAGAGAAAATGAAAATGAGGCTGCAAG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C09SLm0018L06-QNRoK/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M8202" ref_strand="+" ref_description="SGN-M8202 C2_At4g09350 [cosii_markers]">
      <seq>aaatttccaattccatggcgtcagcaacagctccaccagctccattcacctttcttacaaggaaccaaaccaataatgagcacagaacagataccagatggttgacaacaaaacaaagaagacgccgtgttggcttacaagtttatgcaaaagaagaaggggctactgggcgacaacgtgctcctcctggtgttgacacaagaattcactgggaaaacgaagatgaaggatgggtaggagagagtaagtcacggtccacacaagaacgaatcaaaacagacgaaaagaatctctttgatgaaaaattctcagacctcctcaacagttcagctaattctcactaccagttcttgggagtatctgcaacagctgatctagaggaaattaaagctgcatataggaggctatcaaaggagtatcatccagacacaactaatcttcctataagagcagcatcagagaaatttatgaaactaagagaaatttatgatgtcctgagtgatgaggaacaacgacgattctatgattggacactagctcaggagacagcaagtcgagaagcagagaaaatgaaaatgaggctgcaagatccacgcatgctggaagtagaaaactgggaatctgtccagacatggtggatcgacttggtggaagggaacatgagctg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C09SLm0018L06-QNRoK/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C09SLm0018L06.1" temp_strand="+" temp_description="C09SLm0018L06.1  EF647612.1 htgs_phase:2 submitted_to_sgn_as:C09SLm0018L06 upload_account_name:spain">
        <position start="4701" stop="6054"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="5001" g_stop="5346" g_length="346"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="346" r_length="346" r_score="1.000"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="5347" i_stop="5432" i_length="86">
            <donor d_prob="0.998" d_score="1.00"/>
            <acceptor a_prob="0.999" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="5433" g_stop="5754" g_length="322"/>
          <reference_exon_boundary r_type="cDNA" r_start="347" r_stop="667" r_length="321" r_score="0.988"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C09SLm0018L06.1" gen_strand="+" ref_id="SGN-M8202" ref_strand="+">
        <total_alignment_score>0.994</total_alignment_score>
        <cumulative_length_of_scored_exons>668</cumulative_length_of_scored_exons>
        <coverage percentage="1.001" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C09SLm0018L06.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M8202" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="5001" e_stop="5346"/>
          <exon e_start="5433" e_stop="5754"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAATTTCCAATTCCATGGCGTCAGCAACAGCTCCACCAGCTCCATTCACCTTTCTTACAAGGAACCAAACCAATAATGAGCACAGAACAGATACCAGATGGTTGACAACAAAACAAAGAAGACGCCGTGTTGGCTTACAAGTTTATGCAAAAGAAGAAGGGGCTACTGGGCGACAACGTGCTCCTCCTGGTGTTGACACAAGAATTCACTGGGAAAACGAAGATGAAGGATGGGTAGGAGAGAGTAAGTCACGGTCCACACAAGAACGAATCAAAACAGACGAAAAGAATCTCTTTGATGAAAAATTCTCAGACCTCCTCAACAGTTCAGCTAATTCTCACTACCAGTTAGTCTTCATTATCTACTTTGCTATCTTCATCTTATCTCTTAATGTGTGGCTCACAGTTCATAATTCTAATGTTTCAAATTCAGGTTCTTGGGAGTATCTGCAACAGCTGATCTAGAGGAAATTAAAGCTGCATATAGGAGGCTATCAAAGGAGTATCATCCAGACACAACTAATCTTCCTATAAGAGCAGCATCAGAGAAATTTATGAAACTAAGAGAAATTTATGATGTCCTGAGTGATGAGGAACAACGACGATTCTATGATTGGACACTAGCTCAGGAGACAGCAAGTCGAGAAGCAGAGAAAATGAAAATGAGGCTGCAAGATCCACGCATGCTGGAAGTAGAAAACTGGGAATCTGTTCCAGACATGGTGGATCGACTTGGTGGAA-GGAACATGGAGCTG</genome_strand>
        <mrna_strand>AAATTTCCAATTCCATGGCGTCAGCAACAGCTCCACCAGCTCCATTCACCTTTCTTACAAGGAACCAAACCAATAATGAGCACAGAACAGATACCAGATGGTTGACAACAAAACAAAGAAGACGCCGTGTTGGCTTACAAGTTTATGCAAAAGAAGAAGGGGCTACTGGGCGACAACGTGCTCCTCCTGGTGTTGACACAAGAATTCACTGGGAAAACGAAGATGAAGGATGGGTAGGAGAGAGTAAGTCACGGTCCACACAAGAACGAATCAAAACAGACGAAAAGAATCTCTTTGATGAAAAATTCTCAGACCTCCTCAACAGTTCAGCTAATTCTCACTACCA......................................................................................GTTCTTGGGAGTATCTGCAACAGCTGATCTAGAGGAAATTAAAGCTGCATATAGGAGGCTATCAAAGGAGTATCATCCAGACACAACTAATCTTCCTATAAGAGCAGCATCAGAGAAATTTATGAAACTAAGAGAAATTTATGATGTCCTGAGTGATGAGGAACAACGACGATTCTATGATTGGACACTAGCTCAGGAGACAGCAAGTCGAGAAGCAGAGAAAATGAAAATGAGGCTGCAAGATCCACGCATGCTGGAAGTAGAAAACTGGGAATCTG-TCCAGACATGGTGGATCGACTTGGTGGAAGGGAACAT-GAGCTG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>2</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="+" PGL_start="4957" PGL_stop="5754"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="4957" e_stop="5346"/>
            <exon e_start="5433" e_stop="5754"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.998" acc_prob="0.999" e_score="0.962"/>
          <exon-only e_score="0.988"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.962">
            <gDNA_exon_boundary e_start="4957" e_stop="5346" e_length="390"/>
          </exon>
          <intron i_serial="1" don_prob="0.998" acc_prob="0.999">
            <gDNA_intron_boundary i_start="5347" i_stop="5432" i_length="86"/>
          </intron>
          <exon e_serial="2" e_score="0.988">
            <gDNA_exon_boundary e_start="5433" e_stop="5754" e_length="322"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="4957" stop="5346"/>
              <exon start="5433" stop="5674"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M8202-2" strand="+"/>
          </PGS_line>
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="5001" stop="5346"/>
              <exon start="5433" stop="5754"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M8202" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>GAGAAAGCCCCTCCCTCTAAGACTACTCAAATCAGACACAAAACAAATTTCCAATTCCATGGCGTCAGCAACAGCTCCACCAGCTCCATTCACCTTTCTTACAAGGAACCAAACCAATAATGAGCACAGAACAGATACCAGATGGTTGACAACAAAACAAAGAAGACGCCGTGTTGGCTTACAAGTTTATGCAAAAGAAGAAGGGGCTACTGGGCGACAACGTGCTCCTCCTGGTGTTGACACAAGAATTCACTGGGAAAACGAAGATGAAGGATGGGTAGGAGAGAGTAAGTCACGGTCCACACAAGAACGAATCAAAACAGACGAAAAGAATCTCTTTGATGAAAAATTCTCAGACCTCCTCAACAGTTCAGCTAATTCTCACTACCA : GTTCTTGGGAGTATCTGCAACAGCTGATCTAGAGGAAATTAAAGCTGCATATAGGAGGCTATCAAAGGAGTATCATCCAGACACAACTAATCTTCCTATAAGAGCAGCATCAGAGAAATTTATGAAACTAAGAGAAATTTATGATGTCCTGAGTGATGAGGAACAACGACGATTCTATGATTGGACACTAGCTCAGGAGACAGCAAGTCGAGAAGCAGAGAAAATGAAAATGAGGCTGCAAGATCCACGCATGCTGGAAGTAGAAAACTGGGAATCTGTTCCAGACATGGTGGATCGACTTGGTGGAAGGAACATGGAGCTG</gDNA_template>
            <first_frame> E  K  A  P  P  S  K  T  T  Q  I  R  H  K  T  N  F  Q  F  H  G  V  S  N  S  S  T  S  S  I  H  L  S  Y  K  E  P  N  Q  *  *  A  Q  N  R  Y  Q  M  V  D  N  K  T  K  K  T  P  C  W  L  T  S  L  C  K  R  R  R  G  Y  W  A  T  T  C  S  S  W  C  *  H  K  N  S  L  G  K  R  R  *  R  M  G  R  R  E  *  V  T  V  H  T  R  T  N  Q  N  R  R  K  E  S  L  *  *  K  I  L  R  P  P  Q  Q  F  S  *  F  S  L  P  :  V  L  G  S  I  C  N  S  *  S  R  G  N  *  S  C  I  *  E  A  I  K  G  V  S  S  R  H  N  *  S  S  Y  K  S  S  I  R  E  I  Y  E  T  K  R  N  L  *  C  P  E  *  *  G  T  T  T  I  L  *  L  D  T  S  S  G  D  S  K  S  R  S  R  E  N  E  N  E  A  A  R  S  T  H  A  G  S  R  K  L  G  I  C  S  R  H  G  G  S  T  W  W  K  E  H  G  A  </first_frame>
            <second_frame>  R  K  P  L  P  L  R  L  L  K  S  D  T  K  Q  I  S  N  S  M  A  S  A  T  A  P  P  A  P  F  T  F  L  T  R  N  Q  T  N  N  E  H  R  T  D  T  R  W  L  T  T  K  Q  R  R  R  R  V  G  L  Q  V  Y  A  K  E  E  G  A  T  G  R  Q  R  A  P  P  G  V  D  T  R  I  H  W  E  N  E  D  E  G  W  V  G  E  S  K  S  R  S  T  Q  E  R  I  K  T  D  E  K  N  L  F  D  E  K  F  S  D  L  L  N  S  S  A  N  S  H  Y  Q :   F  L  G  V  S  A  T  A  D  L  E  E  I  K  A  A  Y  R  R  L  S  K  E  Y  H  P  D  T  T  N  L  P  I  R  A  A  S  E  K  F  M  K  L  R  E  I  Y  D  V  L  S  D  E  E  Q  R  R  F  Y  D  W  T  L  A  Q  E  T  A  S  R  E  A  E  K  M  K  M  R  L  Q  D  P  R  M  L  E  V  E  N  W  E  S  V  P  D  M  V  D  R  L  G  G  R  N  M  E  L </second_frame>
            <third_frame>   E  S  P  S  L  *  D  Y  S  N  Q  T  Q  N  K  F  P  I  P  W  R  Q  Q  Q  L  H  Q  L  H  S  P  F  L  Q  G  T  K  P  I  M  S  T  E  Q  I  P  D  G  *  Q  Q  N  K  E  D  A  V  L  A  Y  K  F  M  Q  K  K  K  G  L  L  G  D  N  V  L  L  L  V  L  T  Q  E  F  T  G  K  T  K  M  K  D  G  *  E  R  V  S  H  G  P  H  K  N  E  S  K  Q  T  K  R  I  S  L  M  K  N  S  Q  T  S  S  T  V  Q  L  I  L  T  T   : S  S  W  E  Y  L  Q  Q  L  I  *  R  K  L  K  L  H  I  G  G  Y  Q  R  S  I  I  Q  T  Q  L  I  F  L  *  E  Q  H  Q  R  N  L  *  N  *  E  K  F  M  M  S  *  V  M  R  N  N  D  D  S  M  I  G  H  *  L  R  R  Q  Q  V  E  K  Q  R  K  *  K  *  G  C  K  I  H  A  C  W  K  *  K  T  G  N  L  F  Q  T  W  W  I  D  L  V  E  G  T  W  S   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C09SLm0018L06.1" strand="+"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="4958" stop="5346"/>
                    <exon start="5433" stop="5754"/>
                  </exon_boundaries>
                  <frame>1</frame>
                  <number_coding_nucleotides>711</number_coding_nucleotides>
                  <number_encoded_amino_acids>237</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>RKPLPLRLLKSDTKQISNSMASATAPPAPFTFLTRNQTNNEHRTDTRWLTTKQRRRRVGLQVYAKEEGATGRQRAPPGVDTRIHWENEDEGWVGESKSRSTQERIKTDEKNLFDEKFSDLLNSSANSHYQFLGVSATADLEEIKAAYRRLSKEYHPDTTNLPIRAASEKFMKLREIYDVLSDEEQRRFYDWTLAQETASREAEKMKMRLQDPRMLEVENWESVPDMVDRLGGRNMEL</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 13 chains have been computed
$ 
$ memory statistics:
$ 4816 bytes spliced alignments in total
$ 2 spliced alignments have been stored
$ 2408 bytes was the average size of a spliced alignment
$ 5560 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5560 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 13 backtrace matrices have been allocated
$ 
$ date finished: 2009-01-17 23:27:02
-->
