BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Tomato genome chromosomes (Build SL4.0) 13 sequences; 782,520,033 total letters Query= Untitled_sequence Length=24 Score E Sequences producing significant alignments: (Bits) Value SL4.0ch10 45.4 5e-05 SL4.0ch01 34.4 0.11 >SL4.0ch10 Length=64792705 Score = 45.4 bits (24), Expect = 5e-05 Identities = 24/24 (100%), Gaps = 0/24 (0%) Strand=Plus/Plus Query 1 CTGGGTTATCGGTTTGCTCGATTG 24 |||||||||||||||||||||||| Sbjct 60137109 CTGGGTTATCGGTTTGCTCGATTG 60137132 >SL4.0ch01 Length=90863682 Score = 34.4 bits (18), Expect = 0.11 Identities = 18/18 (100%), Gaps = 0/18 (0%) Strand=Plus/Minus Query 6 TTATCGGTTTGCTCGATT 23 |||||||||||||||||| Sbjct 59975559 TTATCGGTTTGCTCGATT 59975542 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 2347559280 Database: Tomato genome chromosomes (Build SL4.0) Posted date: Mar 21, 2024 4:17 PM Number of letters in database: 782,520,033 Number of sequences in database: 13 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5