BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Tomato genome chromosomes (Build SL4.0) 13 sequences; 782,520,033 total letters Query= SLM6‐17 Length=45 Score E Sequences producing significant alignments: (Bits) Value SL4.0ch06 38.1 0.058 SL4.0ch12 34.4 0.75 >SL4.0ch06 Length=47258699 Score = 38.1 bits (20), Expect = 0.058 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 TCCTTCAAATCTCCCATCAA 20 |||||||||||||||||||| Sbjct 36319734 TCCTTCAAATCTCCCATCAA 36319753 Score = 38.1 bits (20), Expect = 0.058 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 26 ACGAGCAATTGCAAGGAAAA 45 |||||||||||||||||||| Sbjct 36319925 ACGAGCAATTGCAAGGAAAA 36319906 >SL4.0ch12 Length=66688036 Score = 34.4 bits (18), Expect = 0.75 Identities = 18/18 (100%), Gaps = 0/18 (0%) Strand=Plus/Plus Query 3 CTTCAAATCTCCCATCAA 20 |||||||||||||||||| Sbjct 2030132 CTTCAAATCTCCCATCAA 2030149 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 16432914141 Database: Tomato genome chromosomes (Build SL4.0) Posted date: Mar 21, 2024 4:17 PM Number of letters in database: 782,520,033 Number of sequences in database: 13 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5