BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Tomato Genome cDNA (ITAG release 2.40) 34,725 sequences; 41,981,568 total letters Query= Untitled_sequence Length=51 Score E Sequences producing significant alignments: (Bits) Value Solyc01g099010.2GDSL esterase/lipase At1g28590 (AHRD V1 **** GDL8... 95.3 3e-20 Solyc01g099030.2GDSL esterase/lipase At1g28590 (AHRD V1 **** GDL8... 76.8 9e-15 >Solyc01g099010.2 GDSL esterase/lipase At1g28590 (AHRD V1 **** GDL8_ARATH); contains Interpro domain(s) IPR001087 Lipase, GDSL Length=1443 Score = 95.3 bits (51), Expect = 3e-20 Identities = 51/51 (100%), Gaps = 0/51 (0%) Strand=Plus/Plus Query 1 CCCGAATACTCACATCAGTTGGGATGGAATTCATTTTACACAAAATGCATA 51 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1091 CCCGAATACTCACATCAGTTGGGATGGAATTCATTTTACACAAAATGCATA 1141 >Solyc01g099030.2 GDSL esterase/lipase At1g28590 (AHRD V1 **** GDL8_ARATH); contains Interpro domain(s) IPR001087 Lipase, GDSL Length=1568 Score = 76.8 bits (41), Expect = 9e-15 Identities = 47/50 (94%), Gaps = 0/50 (0%) Strand=Plus/Plus Query 2 CCGAATACTCACATCAGTTGGGATGGAATTCATTTTACACAAAATGCATA 51 |||| |||||||||||||||||||||| ||||||| |||||||||||||| Sbjct 1290 CCGAGTACTCACATCAGTTGGGATGGAGTTCATTTGACACAAAATGCATA 1339 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 1237570290 Database: Tomato Genome cDNA (ITAG release 2.40) Posted date: Mar 21, 2024 3:33 PM Number of letters in database: 41,981,568 Number of sequences in database: 34,725 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5