BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Tomato genome chromosomes (Build SL4.0) 13 sequences; 782,520,033 total letters Query= Length=26 Score E Sequences producing significant alignments: (Bits) Value SL4.0ch09 49.1 5e-06 SL4.0ch12 32.5 0.51 SL4.0ch01 32.5 0.51 SL4.0ch08 30.7 1.8 SL4.0ch06 30.7 1.8 SL4.0ch05 30.7 1.8 SL4.0ch03 30.7 1.8 SL4.0ch11 28.8 6.6 SL4.0ch10 28.8 6.6 SL4.0ch07 28.8 6.6 SL4.0ch04 28.8 6.6 SL4.0ch02 28.8 6.6 SL4.0ch00 25.1 85 >SL4.0ch09 Length=68513564 Score = 49.1 bits (26), Expect = 5e-06 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACACATTCACATGATGG 26 |||||||||||||||||||||||||| Sbjct 68091913 CCAAATAGTACACATTCACATGATGG 68091938 Score = 34.4 bits (18), Expect = 0.14 Identities = 20/21 (95%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 5 ATAGTACACATTCACATGATG 25 ||||| ||||||||||||||| Sbjct 50653839 ATAGTTCACATTCACATGATG 50653819 Score = 30.7 bits (16), Expect = 1.8 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATTCA 18 |||||||||||||||| Sbjct 63285330 AAATAGTACACATTCA 63285345 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACATT 16 ||||||||||||||| Sbjct 33396823 CAAATAGTACACATT 33396837 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 12 ACATTCACATGATGG 26 ||||||||||||||| Sbjct 44985670 ACATTCACATGATGG 44985656 Score = 28.8 bits (15), Expect = 6.6 Identities = 18/19 (95%), Gaps = 1/19 (5%) Strand=Plus/Plus Query 4 AATAGT-ACACATTCACAT 21 |||||| |||||||||||| Sbjct 49688179 AATAGTCACACATTCACAT 49688197 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 8 GTACACATTCACATGAT 24 |||||||||||||| || Sbjct 1376161 GTACACATTCACATTAT 1376145 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATGG 26 ||| ||||||||||||| Sbjct 16039617 ACATATTCACATGATGG 16039633 Score = 27.0 bits (14), Expect = 24 Identities = 21/24 (88%), Gaps = 1/24 (4%) Strand=Plus/Minus Query 2 CAAATAGTACA-CATTCACATGAT 24 |||| | |||| |||||||||||| Sbjct 24700660 CAAAGATTACACCATTCACATGAT 24700637 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTCACAT 21 |||| |||||||||||| Sbjct 27011729 ATAGAACACATTCACAT 27011745 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 4 AATAGTACACATTC 17 |||||||||||||| Sbjct 29435311 AATAGTACACATTC 29435298 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 GTACACATTCACAT 21 |||||||||||||| Sbjct 38109390 GTACACATTCACAT 38109377 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATGG 26 ||| ||||||||||||| Sbjct 41184701 ACATATTCACATGATGG 41184717 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGATGG 26 ||| ||||||||||||| Sbjct 41831760 ACATATTCACATGATGG 41831744 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 9 TACACATTCACATG 22 |||||||||||||| Sbjct 41907889 TACACATTCACATG 41907902 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGATGG 26 ||| ||||||||||||| Sbjct 41939505 ACATATTCACATGATGG 41939489 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGA 23 |||||||||||||| Sbjct 43859866 ACACATTCACATGA 43859853 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGATG 25 ||||||||||| ||||| Sbjct 43876324 TACACATTCACGTGATG 43876308 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 9 TACACATTCACATG 22 |||||||||||||| Sbjct 47978877 TACACATTCACATG 47978890 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CCAAATAGTACACA 14 |||||||||||||| Sbjct 48460087 CCAAATAGTACACA 48460074 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGA 23 |||||||||||||| Sbjct 49380839 ACACATTCACATGA 49380826 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 12 ACATTCACATGATG 25 |||||||||||||| Sbjct 51353682 ACATTCACATGATG 51353695 Score = 27.0 bits (14), Expect = 24 Identities = 21/24 (88%), Gaps = 2/24 (8%) Strand=Plus/Minus Query 3 AAATAGTACACAT-TC-ACATGAT 24 ||||||||||||| || |||| || Sbjct 62253636 AAATAGTACACATATCGACATAAT 62253613 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACAT 15 |||||||||||||| Sbjct 64264754 CAAATAGTACACAT 64264741 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Minus Query 5 ATAGTACACATTCACATG 22 ||||||||||||| |||| Sbjct 64789560 ATAGTACACATTC-CATG 64789544 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 4906787 AAATAGTACACAT 4906775 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 6 TAGTACACATTCACATG 22 ||||||||||||| ||| Sbjct 7345545 TAGTACACATTCA-ATG 7345530 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 14 ATTCACATGATGG 26 ||||||||||||| Sbjct 7621680 ATTCACATGATGG 7621668 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACACATTCAC 19 || |||||||||||| ||| Sbjct 8239411 CCTAATAGTACACATCCAC 8239429 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 9486599 ACATTCACATGAT 9486611 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 CCAAATAGTACAC 13 ||||||||||||| Sbjct 10608431 CCAAATAGTACAC 10608419 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 10964379 ACATTCACATGAT 10964367 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 15175277 AAATAGTACACAT 15175265 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 15902741 AAATAGTACACAT 15902729 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 16790083 ACATTCACATGAT 16790095 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 17116110 AAATAGTACACAT 17116098 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 19028126 TACACATTCACAT 19028138 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 21049950 TACACATTCACAT 21049938 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 21506905 ACATTCACATGAT 21506893 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 21596940 TACACATTCACAT 21596952 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 21673766 AATAGTACACATT 21673754 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 21822878 AATAGTACACATT 21822890 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 22006614 ACACATTCACATG 22006626 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Minus Query 5 ATA-GTACACATTCACATGA 23 ||| ||| |||||||||||| Sbjct 24482134 ATAGGTAGACATTCACATGA 24482115 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 24523263 TACACATTCACAT 24523251 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 25475852 ACATTCACATGAT 25475864 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 25847602 TACACATTCACAT 25847614 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 25973112 TACACATTCACAT 25973100 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 26907142 TACACATTCACAT 26907154 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 5 ATAGTACACATTCACAT 21 ||| ||||||||||||| Sbjct 27082324 ATA-TACACATTCACAT 27082339 >SL4.0ch12 Length=66688036 Score = 32.5 bits (17), Expect = 0.51 Identities = 22/24 (92%), Gaps = 1/24 (4%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACATGATGG 26 |||||||||||||| ||||| ||| Sbjct 7515107 AAATAGTACACATTAACATG-TGG 7515129 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 11 CACATTCACATGATG 25 ||||||||||||||| Sbjct 11148968 CACATTCACATGATG 11148982 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 7 AGTACACATTCACAT 21 ||||||||||||||| Sbjct 17457839 AGTACACATTCACAT 17457825 Score = 28.8 bits (15), Expect = 6.6 Identities = 20/22 (91%), Gaps = 1/22 (5%) Strand=Plus/Minus Query 4 AATAGTACACATTCACATGATG 25 |||| |||||||||||||| || Sbjct 23083514 AATA-TACACATTCACATGTTG 23083494 Score = 28.8 bits (15), Expect = 6.6 Identities = 20/22 (91%), Gaps = 1/22 (5%) Strand=Plus/Plus Query 5 ATAGTACACATTCA-CATGATG 25 |||||||||||||| ||| ||| Sbjct 56592123 ATAGTACACATTCAACATAATG 56592144 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Plus Query 10 ACACATTCACATG-ATGG 26 ||||||||||||| |||| Sbjct 465866 ACACATTCACATGCATGG 465883 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACAT 15 |||||||||||||| Sbjct 2243539 CAAATAGTACACAT 2243526 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 21031596 AAATAGTACACATT 21031609 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 24892994 TACACATTCACATCATG 24892978 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 1/21 (5%) Strand=Plus/Plus Query 4 AATAGTAC-ACATTCACATGA 23 |||| ||| |||||||||||| Sbjct 29745896 AATAATACAACATTCACATGA 29745916 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Plus Query 1 CCAAATAGTACACATTCA 18 ||||| |||||||||||| Sbjct 39918606 CCAAA-AGTACACATTCA 39918622 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 4 AATAGTACACATTCACA 20 ||| ||||||||||||| Sbjct 43598780 AATCGTACACATTCACA 43598764 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACAT 15 |||||||||||||| Sbjct 51837114 CAAATAGTACACAT 51837127 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 GTACACATTCACAT 21 |||||||||||||| Sbjct 53810779 GTACACATTCACAT 53810766 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 13 CATTCACATGATGG 26 |||||||||||||| Sbjct 54367617 CATTCACATGATGG 54367630 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 2510399 TACACATTCACAT 2510387 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 4329155 AAATAGTACACAT 4329143 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 4387922 AAATAGTACACAT 4387910 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 4407183 AAATAGTACACAT 4407171 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 5649505 CACATTCACATGA 5649493 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 6365149 CAAATAGTACACA 6365161 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 6452514 AATAGTACACATT 6452502 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 5 ATAGTACACATTCACAT 21 |||||||||||| |||| Sbjct 6910324 ATAGTACACATT-ACAT 6910309 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 7306783 TACACATTCACAT 7306771 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGAT 24 ||||||||||||| || Sbjct 8062349 TACACATTCACATAAT 8062334 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 6 TAGTACACATTCACATG 22 ||||||||||||| ||| Sbjct 9118203 TAGTACACATTCA-ATG 9118188 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 15074828 TACACATTCACAT 15074840 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 15336961 ACATTCACATGAT 15336973 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 18843479 TACACATTCACAT 18843491 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACAT 21 || || ||||||||||||| Sbjct 22451141 AACTATTACACATTCACAT 22451159 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 ATAGTACACATTC 17 ||||||||||||| Sbjct 22865715 ATAGTACACATTC 22865703 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 6 TAGTACACATTCACATG 22 ||||||||||||| ||| Sbjct 23884309 TAGTACACATTCA-ATG 23884294 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACATTCACA 20 |||||| ||||||||||| Sbjct 24537870 CAAATACAACACATTCACA 24537852 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGAT 24 ||||||||||||| || Sbjct 24909540 TACACATTCACATCAT 24909525 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 27213677 AAATAGTACACAT 27213689 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 29515419 TACACATTCACAT 29515431 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 29806326 ACACATTCACATG 29806338 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 31268381 CACATTCACATGA 31268369 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 31622315 AAATAGTACACAT 31622303 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 32855940 ACATTCACATGAT 32855952 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 33307132 TACACATTCACAT 33307120 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 33825990 ACACATTCACATG 33825978 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 7 AGTACACATTCACATG 22 ||| |||||||||||| Sbjct 36040973 AGTTCACATTCACATG 36040958 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 10 ACACATTCACATGATGG 26 |||||||||||| |||| Sbjct 37477468 ACACATTCACAT-ATGG 37477453 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 41831210 ACATTCACATGAT 41831222 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 42831276 TACACATTCACAT 42831264 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 6 TAGTACACATTCACATG 22 ||||||||||||| ||| Sbjct 44057911 TAGTACACATTCA-ATG 44057896 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 47813488 CAAATAGTACACA 47813500 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 49343553 AAATAGTACACAT 49343565 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 49463787 ACATTCACATGAT 49463775 >SL4.0ch01 Length=90863682 Score = 32.5 bits (17), Expect = 0.51 Identities = 17/17 (100%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 5 ATAGTACACATTCACAT 21 ||||||||||||||||| Sbjct 75672230 ATAGTACACATTCACAT 75672214 Score = 30.7 bits (16), Expect = 1.8 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 9 TACACATTCACATGAT 24 |||||||||||||||| Sbjct 27569419 TACACATTCACATGAT 27569434 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGAT 24 ||||||||||||||| Sbjct 20446965 ACACATTCACATGAT 20446979 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGAT 24 ||||||||||||||| Sbjct 31948612 ACACATTCACATGAT 31948626 Score = 28.8 bits (15), Expect = 6.6 Identities = 18/19 (95%), Gaps = 1/19 (5%) Strand=Plus/Minus Query 6 TAG-TACACATTCACATGA 23 ||| ||||||||||||||| Sbjct 44922497 TAGCTACACATTCACATGA 44922479 Score = 28.8 bits (15), Expect = 6.6 Identities = 18/19 (95%), Gaps = 1/19 (5%) Strand=Plus/Minus Query 1 CCAAATAGTACACATTCAC 19 ||||||||||||||| ||| Sbjct 84457905 CCAAATAGTACACAT-CAC 84457888 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 12 ACATTCACATGATGG 26 ||||||||||||||| Sbjct 87481691 ACATTCACATGATGG 87481705 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 2/21 (10%) Strand=Plus/Plus Query 5 ATAGTACACATTCACATGATG 25 ||| |||| |||||||||||| Sbjct 746989 ATA-TACA-ATTCACATGATG 747007 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 1/21 (5%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACATGA 23 ||||||||||||| |||||| Sbjct 6163223 AAATAGTACACATG-ACATGA 6163242 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACAT 15 |||||||||||||| Sbjct 6238912 CAAATAGTACACAT 6238899 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 1/21 (5%) Strand=Plus/Minus Query 4 AATAGTA-CACATTCACATGA 23 ||||||| |||||||||||| Sbjct 14818980 AATAGTATGACATTCACATGA 14818960 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 9 TACACATTCACATG 22 |||||||||||||| Sbjct 17017133 TACACATTCACATG 17017146 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 9 TACACATTCACATG 22 |||||||||||||| Sbjct 17734092 TACACATTCACATG 17734079 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 12 ACATTCACATGATG 25 |||||||||||||| Sbjct 30493242 ACATTCACATGATG 30493229 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTCA 18 |||||||||||||| Sbjct 35065961 ATAGTACACATTCA 35065974 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 37486231 TACACATTCACATCATG 37486215 Score = 27.0 bits (14), Expect = 24 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACACATTCACA 20 ||||||||||| ||| |||| Sbjct 39720840 CCAAATAGTACTCATGCACA 39720859 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATGG 26 |||||||||||| |||| Sbjct 40744049 ACACATTCACATAATGG 40744065 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACAT 15 |||||||||||||| Sbjct 42422747 CAAATAGTACACAT 42422734 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 11 CACATTCACATGAT 24 |||||||||||||| Sbjct 45878749 CACATTCACATGAT 45878736 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 12 ACATTCACATGATG 25 |||||||||||||| Sbjct 47385024 ACATTCACATGATG 47385011 Score = 27.0 bits (14), Expect = 24 Identities = 21/24 (88%), Gaps = 1/24 (4%) Strand=Plus/Plus Query 2 CAAATAGTACACATTCACATGATG 25 ||||| ||||||||||||| ||| Sbjct 51927704 CAAAT-TTACACATTCACATCATG 51927726 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 4 AATAGTACACATTC 17 |||||||||||||| Sbjct 52527769 AATAGTACACATTC 52527782 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGA 23 |||||||||||||| Sbjct 53488203 ACACATTCACATGA 53488216 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 62228010 AAATAGTACACATT 62227997 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 1144886 ACACATTCACATG 1144898 Score = 25.1 bits (13), Expect = 85 Identities = 19/22 (86%), Gaps = 0/22 (0%) Strand=Plus/Plus Query 4 AATAGTACACATTCACATGATG 25 ||| ||| || ||||||||||| Sbjct 2552773 AATTGTAAACTTTCACATGATG 2552794 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATTCA 18 |||||||||||| ||| Sbjct 3569536 AAATAGTACACAATCA 3569551 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 4142328 AAATAGTACACAT 4142316 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTCACA 20 |||||||||||| ||| Sbjct 4403881 ATAGTACACATTTACA 4403896 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 5286539 CACATTCACATGA 5286527 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Plus Query 4 AATAGTACACATTCACATGA 23 |||||||||||| |||||| Sbjct 5942314 AATAGTACACATG-ACATGA 5942332 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 5947264 ACATTCACATGAT 5947252 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 11 CACATTCACATGATGG 26 |||| ||||||||||| Sbjct 9286136 CACAATCACATGATGG 9286121 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 9575317 AAATAGTACACAT 9575329 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 9909547 AAATAGTACACAT 9909559 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 10105521 AAATAGTACACAT 10105533 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 10386540 AAATAGTACACAT 10386552 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 10592881 TACACATTCACAT 10592893 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 10923649 TACACATTCACAT 10923637 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 12092686 AATAGTACACATT 12092698 Score = 25.1 bits (13), Expect = 85 Identities = 20/23 (87%), Gaps = 1/23 (4%) Strand=Plus/Minus Query 2 CAAATAGTACACATTCACATGAT 24 ||||||||||||| || ||||| Sbjct 12851277 CAAATAGTACACAATCG-ATGAT 12851256 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Plus Query 3 AAATAG-TACACATTCACAT 21 ||| || ||||||||||||| Sbjct 13261504 AAAAAGATACACATTCACAT 13261523 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 11 CAC-ATTCACATGATGG 26 ||| ||||||||||||| Sbjct 13348959 CACAATTCACATGATGG 13348943 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 6 TAGTACACATTCACAT 21 ||||||||||| |||| Sbjct 14201162 TAGTACACATTTACAT 14201177 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 16281799 TACACATTCACAT 16281787 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 16860320 TAGTACACATTCA 16860308 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 16861367 TAGTACACATTCA 16861355 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 14 ATTCACATGATGG 26 ||||||||||||| Sbjct 16889675 ATTCACATGATGG 16889663 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 17445656 TAGTACACATTCA 17445668 >SL4.0ch08 Length=63995357 Score = 30.7 bits (16), Expect = 1.8 Identities = 18/19 (95%), Gaps = 0/19 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCACATGAT 24 ||||||| ||||||||||| Sbjct 62966711 TAGTACATATTCACATGAT 62966693 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 13635637 AAATAGTACACATT 13635650 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Minus Query 2 CAAATAGTACACA-TTCA 18 ||||||||||||| |||| Sbjct 21533795 CAAATAGTACACAATTCA 21533778 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 40020078 AAATAGTACACATT 40020091 Score = 27.0 bits (14), Expect = 24 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACATTCACAT 21 ||||||||||| | |||||| Sbjct 56317273 CAAATAGTACAAACTCACAT 56317254 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 9 TACACATTCACATG 22 |||||||||||||| Sbjct 56857181 TACACATTCACATG 56857194 Score = 27.0 bits (14), Expect = 24 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACATG 22 |||| | ||||||||||||| Sbjct 59134026 AAATTGAACACATTCACATG 59134045 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 59144388 AAATAGTACACATT 59144401 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 1541243 AAATAGTACACAT 1541231 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 1780837 TACACATTCACAT 1780849 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Minus Query 2 CAAATAGTACACATTCACAT 21 |||| | ||||||||||||| Sbjct 4458929 CAAA-ACTACACATTCACAT 4458911 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 5198850 CACATTCACATGA 5198838 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 5202133 AAATAGTACACAT 5202121 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 6215691 ACACATTCACATG 6215703 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 10805004 AAATAGTACACAT 10805016 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 12141999 TACACATTCACAT 12141987 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 12720261 ACATTCACATGAT 12720249 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 13 CATTCACATGATG 25 ||||||||||||| Sbjct 17769576 CATTCACATGATG 17769588 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 19741304 AATAGTACACATT 19741292 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 9 TACACATTCACATGAT 24 || ||||||||||||| Sbjct 21850968 TAAACATTCACATGAT 21850983 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 22320103 ACACATTCACATG 22320091 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 22391385 ACACATTCACATG 22391373 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 13 CATTCACATGATG 25 ||||||||||||| Sbjct 22845299 CATTCACATGATG 22845287 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 31268962 CAAATAGTACACA 31268974 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 11 CACATTCACATGATGG 26 || ||||||||||||| Sbjct 31933782 CAAATTCACATGATGG 31933797 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 11 CACATTCACATGATGG 26 ||| |||||||||||| Sbjct 33792830 CACTTTCACATGATGG 33792815 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 8 GTACACATTCACA 20 ||||||||||||| Sbjct 36494891 GTACACATTCACA 36494903 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 37376523 TACACATTCACAT 37376511 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 37466874 TACACATTCACAT 37466886 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 40314004 ACATTCACATGAT 40314016 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 42761735 CAAATAGTACACA 42761723 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 11 CACATTCACATGATGG 26 |||||||||||| ||| Sbjct 43703536 CACATTCACATGCTGG 43703551 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGATG 25 ||| |||||||||||| Sbjct 45855827 ACAAATTCACATGATG 45855812 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 8 GTACACATTCACA 20 ||||||||||||| Sbjct 47805835 GTACACATTCACA 47805823 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AGTACACATTCAC 19 ||||||||||||| Sbjct 47945941 AGTACACATTCAC 47945953 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 48212843 CACATTCACATGA 48212855 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 6 TAGT-ACACATTCACAT 21 |||| |||||||||||| Sbjct 48953512 TAGTAACACATTCACAT 48953528 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 49369534 AATAGTACACATT 49369546 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 50553566 AATAGTACACATT 50553578 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 51557101 AAATAGTACACAT 51557113 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 13 CATTCACATGATG 25 ||||||||||||| Sbjct 52058079 CATTCACATGATG 52058067 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 53393456 TACACATTCACAT 53393444 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 58688729 CAAATAGTACACA 58688741 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 59174372 TACACATTCACAT 59174384 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 59569017 ACATTCACATGAT 59569029 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 13 CATTCACATGAT 24 |||||||||||| Sbjct 62172 CATTCACATGAT 62161 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 5 ATAGTACACATT 16 |||||||||||| Sbjct 353748 ATAGTACACATT 353759 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 13 CATTCACATGAT 24 |||||||||||| Sbjct 808399 CATTCACATGAT 808410 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 9 TACACATTCACA 20 |||||||||||| Sbjct 929401 TACACATTCACA 929412 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 15 TTCACATGATGG 26 |||||||||||| Sbjct 1020496 TTCACATGATGG 1020485 >SL4.0ch06 Length=47258699 Score = 30.7 bits (16), Expect = 1.8 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 8 GTACACATTCACATGA 23 |||||||||||||||| Sbjct 15989705 GTACACATTCACATGA 15989690 Score = 30.7 bits (16), Expect = 1.8 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATTCA 18 |||||||||||||||| Sbjct 33100335 AAATAGTACACATTCA 33100320 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGAT 24 ||||||||||||||| Sbjct 5921646 ACACATTCACATGAT 5921660 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGATG 25 ||||||||||| ||||| Sbjct 3843856 TACACATTCACTTGATG 3843840 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 11401729 TACACATTCACATCATG 11401745 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 2/21 (10%) Strand=Plus/Minus Query 3 AAATAGTACACAT-TCA-CAT 21 ||||||||||||| ||| ||| Sbjct 13841282 AAATAGTACACATATCATCAT 13841262 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGA 23 |||||||||||||| Sbjct 15549474 ACACATTCACATGA 15549487 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Plus Query 8 GTACACATTCAC-ATGAT 24 |||||||||||| ||||| Sbjct 15711766 GTACACATTCACGATGAT 15711783 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 5 ATAGTACACATTCA 18 |||||||||||||| Sbjct 22618838 ATAGTACACATTCA 22618825 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATGG 26 |||| |||||||||||| Sbjct 26705343 ACACTTTCACATGATGG 26705359 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Minus Query 9 TACACATTCACATGATGG 26 ||||||||||||| |||| Sbjct 31036757 TACACATTCACAT-ATGG 31036741 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 37367829 AAATAGTACACATT 37367816 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 9 TACACATTCACAT-GAT 24 ||||||||||||| ||| Sbjct 1900803 TACACATTCACATAGAT 1900819 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 3495019 AAATAGTACACAT 3495007 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 5488368 AATAGTACACATT 5488356 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 6 TAGTACACATTCACAT 21 ||| |||||||||||| Sbjct 5864257 TAGGACACATTCACAT 5864272 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 6726273 TAGTACACATTCA 6726261 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 6745710 TAGTACACATTCA 6745698 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 7771952 ACATTCACATGAT 7771940 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 8 GTACACATTCACA 20 ||||||||||||| Sbjct 8869518 GTACACATTCACA 8869506 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 15780843 TACACATTCACAT 15780855 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 14 ATTCACATGATGG 26 ||||||||||||| Sbjct 17602661 ATTCACATGATGG 17602649 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 14 ATTCACATGATGG 26 ||||||||||||| Sbjct 19194741 ATTCACATGATGG 19194753 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 24010418 TAGTACACATTCA 24010406 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 2/20 (10%) Strand=Plus/Minus Query 2 CAAATAGTACACATTCACAT 21 ||||| | |||||||||||| Sbjct 24769477 CAAAT-G-ACACATTCACAT 24769460 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 7 AGTACACATTCACATGATG 25 ||| ||| ||||||||||| Sbjct 27242150 AGTGCACGTTCACATGATG 27242168 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 5 ATAGTACACATTCACAT 21 ||| ||||||||||||| Sbjct 27510471 ATA-TACACATTCACAT 27510486 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 27638517 ACATTCACATGAT 27638505 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 29979204 CACATTCACATGA 29979192 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 30376833 AAATAGTACACAT 30376821 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 6 TAGTACACATTCACATG 22 ||||||||||||| ||| Sbjct 31216751 TAGTACACATTCA-ATG 31216766 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 31237916 TACACATTCACAT 31237904 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACATTCACA 20 ||||| | ||||||||||| Sbjct 33142432 CAAATTGCACACATTCACA 33142414 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 34266356 CACATTCACATGA 34266344 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 34615451 AAATAGTACACAT 34615463 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 8 GTACACATTCACA 20 ||||||||||||| Sbjct 34868557 GTACACATTCACA 34868545 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Minus Query 4 AATAGTACACATTCACATGA 23 |||||||||||| |||||| Sbjct 35282479 AATAGTACACATG-ACATGA 35282461 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCACAT 21 ||||||||||| |||| Sbjct 36835173 TAGTACACATTTACAT 36835158 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 7 AGTACACATTCA-CATG 22 |||||||||||| |||| Sbjct 37060297 AGTACACATTCAACATG 37060313 Score = 25.1 bits (13), Expect = 85 Identities = 20/23 (87%), Gaps = 2/23 (9%) Strand=Plus/Minus Query 4 AATAGTACACATTCACATG-ATG 25 ||| || |||||||||||| ||| Sbjct 38003989 AAT-GTGCACATTCACATGCATG 38003968 Score = 25.1 bits (13), Expect = 85 Identities = 20/23 (87%), Gaps = 2/23 (9%) Strand=Plus/Minus Query 4 AATAGTACACATTCACATG-ATG 25 ||| || |||||||||||| ||| Sbjct 38013608 AAT-GTGCACATTCACATGCATG 38013587 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 38034817 ACATTCACATGAT 38034805 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 2/20 (10%) Strand=Plus/Plus Query 2 CAAATAGTACACATTCACAT 21 |||| | ||||||||||||| Sbjct 38550662 CAAA-A-TACACATTCACAT 38550679 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 40324177 ACATTCACATGAT 40324189 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 44570146 AATAGTACACATT 44570158 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 5 ATAGTACACATTCACA 20 ||| |||||||||||| Sbjct 46063871 ATAATACACATTCACA 46063856 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 9 TACACATTCACATGAT 24 |||| ||||||||||| Sbjct 46112781 TACAAATTCACATGAT 46112796 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 47179106 CACATTCACATGA 47179118 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 11 CACATTCACATG 22 |||||||||||| Sbjct 77589 CACATTCACATG 77600 Score = 23.3 bits (12), Expect = 307 Identities = 17/19 (89%), Gaps = 1/19 (5%) Strand=Plus/Plus Query 3 AAATAGTACACATT-CACA 20 |||||||||||| | |||| Sbjct 374433 AAATAGTACACAATACACA 374451 >SL4.0ch05 Length=65269487 Score = 30.7 bits (16), Expect = 1.8 Identities = 18/19 (95%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACACATTCAC 19 |||||| |||||||||||| Sbjct 14622180 CCAAATTGTACACATTCAC 14622198 Score = 28.8 bits (15), Expect = 6.6 Identities = 19/21 (90%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATTCACATGA 23 ||||||||||||| |||||| Sbjct 19652793 AAATAGTACACATGTACATGA 19652773 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 11 CACATTCACATGATG 25 ||||||||||||||| Sbjct 26425894 CACATTCACATGATG 26425880 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACATT 16 ||||||||||||||| Sbjct 65035685 CAAATAGTACACATT 65035671 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGA 23 |||||||||||||| Sbjct 968978 ACACATTCACATGA 968965 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 1/21 (5%) Strand=Plus/Minus Query 5 ATAGTACACATTCACATGATG 25 ||| ||||||||||||| ||| Sbjct 5155566 ATA-TACACATTCACATTATG 5155547 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 5 ATAGTACACATTCA 18 |||||||||||||| Sbjct 21083710 ATAGTACACATTCA 21083697 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 1/21 (5%) Strand=Plus/Minus Query 6 TAGTACACATTCACATGATGG 26 ||| || |||||||||||||| Sbjct 29814460 TAGAAC-CATTCACATGATGG 29814441 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 35408595 AAATAGTACACATT 35408582 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACAT 15 |||||||||||||| Sbjct 44758603 CAAATAGTACACAT 44758616 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Plus Query 2 CAAATAGTACACAT-TCA 18 |||||||||||||| ||| Sbjct 60314292 CAAATAGTACACATATCA 60314309 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Plus Query 7 AGTACACATTCACATGAT 24 |||| ||||||||||||| Sbjct 65078601 AGTA-ACATTCACATGAT 65078617 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 7 AGTACACATTCACATGATG 25 ||| || |||||||||||| Sbjct 687623 AGTTCAAATTCACATGATG 687641 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 1539122 AATAGTACACATT 1539134 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 9 TACACATTCACATGATG 25 |||| |||||||||||| Sbjct 1666472 TACA-ATTCACATGATG 1666457 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGATG 25 |||||||||||| ||| Sbjct 2321944 ACACATTCACATAATG 2321929 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACAC 13 ||||||||||||| Sbjct 3819314 CCAAATAGTACAC 3819326 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGAT 24 ||| |||||||||||| Sbjct 4349795 TACTCATTCACATGAT 4349780 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 4374519 ACATTCACATGAT 4374531 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGAT 24 ||| |||||||||||| Sbjct 5533089 TACTCATTCACATGAT 5533074 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 5612216 ACATTCACATGAT 5612228 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 7835503 AAATAGTACACAT 7835515 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 7872221 AATAGTACACATT 7872233 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 3 AAATAGTACACAT-TCA 18 ||||||||||||| ||| Sbjct 9778220 AAATAGTACACATCTCA 9778236 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 6 TAG-TACACATTCACAT 21 ||| ||||||||||||| Sbjct 10290338 TAGCTACACATTCACAT 10290322 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 10790394 TAGTACACATTCA 10790382 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 6 TAGT-ACACATTCACAT 21 |||| |||||||||||| Sbjct 10833189 TAGTCACACATTCACAT 10833205 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AGTACACATTCAC 19 ||||||||||||| Sbjct 11649016 AGTACACATTCAC 11649028 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 12855217 ACATTCACATGAT 12855229 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 14499284 TACACATTCACAT 14499272 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATTCA 18 ||||||||||| |||| Sbjct 14906508 AAATAGTACACTTTCA 14906493 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 15809754 TAGTACACATTCA 15809742 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGATG 25 |||||||||||| ||| Sbjct 15850977 ACACATTCACATAATG 15850962 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 CCAAATAGTACAC 13 ||||||||||||| Sbjct 19873528 CCAAATAGTACAC 19873516 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATTCA 18 |||| ||||||||||| Sbjct 20552159 AAATCGTACACATTCA 20552144 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 21126855 ACATTCACATGAT 21126867 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACACATTCAC 19 || |||||||||||| ||| Sbjct 21242926 CCTAATAGTACACATCCAC 21242944 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 27428361 TACACATTCACAT 27428373 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 28388887 TACACATTCACAT 28388875 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 9 TAC-ACATTCACATGAT 24 ||| ||||||||||||| Sbjct 30322768 TACTACATTCACATGAT 30322752 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 33670072 TACACATTCACAT 33670060 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 33969667 TACACATTCACAT 33969655 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 8 GTACACATTCACA 20 ||||||||||||| Sbjct 34079405 GTACACATTCACA 34079393 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 36384396 ACACATTCACATG 36384408 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 37159791 ACATTCACATGAT 37159779 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 37781469 TACACATTCACAT-ATG 37781484 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 38682297 AATAGTACACATT 38682309 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 38997557 ACACATTCACATG 38997545 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATG 25 ||| |||||||||||| Sbjct 39543589 ACAAATTCACATGATG 39543604 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 39962770 AAATAGTACACAT 39962782 >SL4.0ch03 Length=65298490 Score = 30.7 bits (16), Expect = 1.8 Identities = 21/23 (91%), Gaps = 1/23 (4%) Strand=Plus/Plus Query 1 CCAAATAGTACACATTCACATGA 23 ||||| || |||||||||||||| Sbjct 57364571 CCAAA-AGAACACATTCACATGA 57364592 Score = 28.8 bits (15), Expect = 6.6 Identities = 18/19 (95%), Gaps = 1/19 (5%) Strand=Plus/Minus Query 3 AAAT-AGTACACATTCACA 20 |||| |||||||||||||| Sbjct 27491538 AAATAAGTACACATTCACA 27491520 Score = 28.8 bits (15), Expect = 6.6 Identities = 18/19 (95%), Gaps = 1/19 (5%) Strand=Plus/Minus Query 8 GTACACATTCACAT-GATG 25 |||||||||||||| |||| Sbjct 28694624 GTACACATTCACATTGATG 28694606 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGA 23 ||||||||||||||| Sbjct 30823896 TACACATTCACATGA 30823882 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 7 AGTACACATTCACAT 21 ||||||||||||||| Sbjct 36630355 AGTACACATTCACAT 36630369 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGA 23 ||||||||||||||| Sbjct 42930613 TACACATTCACATGA 42930599 Score = 28.8 bits (15), Expect = 6.6 Identities = 20/22 (91%), Gaps = 2/22 (9%) Strand=Plus/Minus Query 5 ATAGTACACATTCACATG-ATG 25 ||| |||||||||||||| ||| Sbjct 44426368 ATA-TACACATTCACATGTATG 44426348 Score = 28.8 bits (15), Expect = 6.6 Identities = 20/22 (91%), Gaps = 1/22 (5%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACATGAT 24 ||| |||| ||||||||||||| Sbjct 52113348 AAAAAGTA-ACATTCACATGAT 52113368 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 12 ACATTCACATGATGG 26 ||||||||||||||| Sbjct 60343958 ACATTCACATGATGG 60343972 Score = 28.8 bits (15), Expect = 6.6 Identities = 18/19 (95%), Gaps = 1/19 (5%) Strand=Plus/Minus Query 4 AATAGT-ACACATTCACAT 21 |||||| |||||||||||| Sbjct 65003195 AATAGTAACACATTCACAT 65003177 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 1062447 AAATAGTACACATT 1062434 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 1089659 AAATAGTACACATT 1089646 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 2124608 AAATAGTACACATT 2124595 Score = 27.0 bits (14), Expect = 24 Identities = 20/23 (87%), Gaps = 0/23 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACATTCACATGAT 24 |||||||||||| || | ||||| Sbjct 6418363 CAAATAGTACACGTTTATATGAT 6418385 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 1/21 (5%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACATGA 23 |||| |||| ||||||||||| Sbjct 17745951 AAAT-GTACTCATTCACATGA 17745970 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Plus Query 9 TACA-CATTCACATGATG 25 |||| ||||||||||||| Sbjct 25155910 TACATCATTCACATGATG 25155927 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 GTACACATTCACAT 21 |||||||||||||| Sbjct 35681562 GTACACATTCACAT 35681549 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 36107974 AAATAGTACACATT 36107987 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATGG 26 ||| ||||||||||||| Sbjct 38284189 ACATATTCACATGATGG 38284205 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 60902782 AAATAGTACACATT 60902795 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 131137 TACACATTCACAT 131125 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 383361 ACACATTCACATG 383373 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 CCAAATAGTACAC 13 ||||||||||||| Sbjct 577462 CCAAATAGTACAC 577450 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACATTC 17 ||||||||||| |||| Sbjct 2642940 CAAATAGTACAGATTC 2642955 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 11 CACATTCACATGATGG 26 || ||||||||||||| Sbjct 4007391 CAAATTCACATGATGG 4007406 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 4749724 ACATTCACATGAT 4749736 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 5176434 TACACATTCACAT 5176446 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 5262875 CACATTCACATGA 5262887 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 5287889 CACATTCACATGA 5287877 Score = 25.1 bits (13), Expect = 85 Identities = 19/22 (86%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATTCACATGAT 24 |||| ||| | ||||||||||| Sbjct 5919604 AAATTGTATAAATTCACATGAT 5919583 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 7944333 CAAATAGTACACA 7944345 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 7964870 CAAATAGTACACA 7964882 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 8283207 AAATAGTACACAT 8283219 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Plus Query 3 AAATAGTACACAT-TCACAT 21 ||||||||||||| | |||| Sbjct 8300012 AAATAGTACACATATAACAT 8300031 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 8434190 AAATAGTACACAT 8434202 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 8445255 AAATAGTACACAT 8445267 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 8636627 AAATAGTACACAT 8636639 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 7 AGTACACATTCACATG 22 |||||||||||| ||| Sbjct 9991207 AGTACACATTCATATG 9991192 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATTCA 18 |||||||||||| ||| Sbjct 10522557 AAATAGTACACACTCA 10522542 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Plus Query 2 CAAATAGTACACATTCACAT 21 |||| ||| ||||||||||| Sbjct 12789354 CAAA-AGTTCACATTCACAT 12789372 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 15162668 AAATAGTACACAT 15162656 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 23594611 TACACATTCACAT-ATG 23594626 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 9 TACACATTCACATGAT 24 || ||||||||||||| Sbjct 26840588 TATACATTCACATGAT 26840603 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 29245975 AATAGTACACATT 29245987 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATTCA 18 ||||||||||| |||| Sbjct 30850119 AAATAGTACACTTTCA 30850104 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 32449814 AAATAGTACACAT 32449802 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACATG 22 ||||| | |||||||||||| Sbjct 33853642 AAATA-TGCACATTCACATG 33853660 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 7 AGTACACATTCACATG 22 ||| |||||||||||| Sbjct 35641079 AGTTCACATTCACATG 35641064 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 36142876 TACACATTCACAT 36142888 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 36794643 ACACATTCACATG 36794631 >SL4.0ch11 Length=54379777 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 4 AATAGTACACATTCA 18 ||||||||||||||| Sbjct 35854684 AATAGTACACATTCA 35854698 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 12 ACATTCACATGATGG 26 ||||||||||||||| Sbjct 50856559 ACATTCACATGATGG 50856573 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACATTCA 18 ||||||||||||| ||| Sbjct 3136970 CAAATAGTACACAATCA 3136954 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 1 CCAAATAGTACACATTC 17 |||||||||||| |||| Sbjct 5855036 CCAAATAGTACAAATTC 5855020 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 11 CACATTCACATGAT 24 |||||||||||||| Sbjct 18197067 CACATTCACATGAT 18197080 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 1/21 (5%) Strand=Plus/Minus Query 7 AGTACACA-TTCACATGATGG 26 ||| |||| |||||||||||| Sbjct 18359225 AGTGCACATTTCACATGATGG 18359205 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Minus Query 9 TACACATTCACATGATGG 26 ||||||||||||| |||| Sbjct 23669174 TACACATTCACAT-ATGG 23669158 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 2/21 (10%) Strand=Plus/Plus Query 1 CCAAAT--AGTACACATTCAC 19 |||||| ||||||||||||| Sbjct 50459660 CCAAATCAAGTACACATTCAC 50459680 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACACA 14 |||||||||||||| Sbjct 51230368 CCAAATAGTACACA 51230381 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGA 23 |||||||||||||| Sbjct 51290391 ACACATTCACATGA 51290404 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 885325 TAGTACACATTCA 885313 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 4965793 AAATAGTACACAT 4965805 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 7414705 AAATAGTACACAT 7414717 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 7465338 AAATAGTACACAT 7465350 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 7631289 AAATAGTACACAT 7631301 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 14 ATTCACATGATGG 26 ||||||||||||| Sbjct 7942434 ATTCACATGATGG 7942422 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACATTC 17 ||||||||||| |||| Sbjct 9025472 CAAATAGTACAAATTC 9025487 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Minus Query 4 AATAGTACACATTCACATGA 23 |||||||||||| |||||| Sbjct 9336588 AATAGTACACATG-ACATGA 9336570 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 5 ATAGTACACATTCACAT 21 |||| |||||||||||| Sbjct 12330328 ATAG-ACACATTCACAT 12330343 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 13370079 AAATAGTACACAT 13370091 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Minus Query 3 AAAT-AGTACACATTCACAT 21 |||| ||||||||||| ||| Sbjct 16061758 AAATCAGTACACATTCTCAT 16061739 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 16674631 ACACATTCACATG 16674643 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 17532954 TACACATTCACAT 17532966 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 23683764 AAATAGTACACAT 23683752 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 25890706 ACATTCACATGAT 25890718 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 28340225 AAATAGTACACAT 28340237 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 30499201 AAATAGTACACAT 30499189 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 5 ATAGTACACATTCACAT 21 |||||||||||| |||| Sbjct 31326515 ATAGTACACATT-ACAT 31326500 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 34520297 CAAATAGTACACA 34520309 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 35075994 CACATTCACATGA 35076006 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 35435900 TACACATTCACAT 35435888 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 37465686 TACACATTCACAT 37465698 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 38859154 TACACATTCACAT 38859142 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATG 25 ||| |||||||||||| Sbjct 39221249 ACATATTCACATGATG 39221264 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 1 CCAAATAGTACACATT 16 ||| |||||||||||| Sbjct 44145776 CCACATAGTACACATT 44145761 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 50455856 ACATTCACATGAT 50455868 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AGTACACATTCAC 19 ||||||||||||| Sbjct 50460043 AGTACACATTCAC 50460055 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 50462566 AATAGTACACATT 50462554 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 52956589 CAAATAGTACACA 52956577 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 53268158 CACATTCACATGA 53268170 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACATTCACA 20 ||||| |||||||||||| Sbjct 53488670 CAAATTATACACATTCACA 53488652 Score = 23.3 bits (12), Expect = 307 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 7 AGTACACATTCACAT 21 || |||||||||||| Sbjct 55000 AGAACACATTCACAT 55014 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 12 ACATTCACATGA 23 |||||||||||| Sbjct 479724 ACATTCACATGA 479735 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 12 ACATTCACATGA 23 |||||||||||| Sbjct 983360 ACATTCACATGA 983349 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 12 ACATTCACATGA 23 |||||||||||| Sbjct 997047 ACATTCACATGA 997036 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 14 ATTCACATGATG 25 |||||||||||| Sbjct 1006578 ATTCACATGATG 1006567 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 3 AAATAGTACACA 14 |||||||||||| Sbjct 1860446 AAATAGTACACA 1860457 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 9 TACACATTCACA 20 |||||||||||| Sbjct 2189902 TACACATTCACA 2189913 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AGTACACATTCA 18 |||||||||||| Sbjct 2392588 AGTACACATTCA 2392599 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 3 AAATAGTACACA 14 |||||||||||| Sbjct 2439713 AAATAGTACACA 2439724 >SL4.0ch10 Length=64792705 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 12 ACATTCACATGATGG 26 ||||||||||||||| Sbjct 36117338 ACATTCACATGATGG 36117324 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 8 GTACACATTCACATG 22 ||||||||||||||| Sbjct 60243403 GTACACATTCACATG 60243389 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 4 AATAGTACACATTCACA 20 ||||||||||| ||||| Sbjct 6228363 AATAGTACACAATCACA 6228347 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 4 AATAGTACACATTCACA 20 ||||||||||| ||||| Sbjct 6265645 AATAGTACACAATCACA 6265629 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACACA 14 |||||||||||||| Sbjct 11491735 CCAAATAGTACACA 11491748 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 9 TACACATTCACATG 22 |||||||||||||| Sbjct 12267283 TACACATTCACATG 12267296 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 8 GTACACATTCACATGAT 24 ||| ||||||||||||| Sbjct 13265117 GTATACATTCACATGAT 13265133 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Minus Query 5 ATAGT-ACACATTCACAT 21 ||||| |||||||||||| Sbjct 16318522 ATAGTCACACATTCACAT 16318505 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 12 ACATTCACATGATG 25 |||||||||||||| Sbjct 24548002 ACATTCACATGATG 24547989 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTCA 18 |||||||||||||| Sbjct 63092431 ATAGTACACATTCA 63092444 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Plus Query 6 TAGTACACATTCACATGA 23 ||||| |||||||||||| Sbjct 63996400 TAGTA-ACATTCACATGA 63996416 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 12 ACATTCACATGATG 25 |||||||||||||| Sbjct 64236021 ACATTCACATGATG 64236034 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 64485890 AAATAGTACACATT 64485877 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATG 25 ||||||||||| |||| Sbjct 1298603 ACACATTCACAAGATG 1298618 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 2029332 CAAATAGTACACA 2029320 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 5 ATAGTACACATTCACAT 21 |||||||||||| |||| Sbjct 4889356 ATAGTACACATT-ACAT 4889341 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 9813520 ACATTCACATGAT 9813532 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 10929697 TACACATTCACAT 10929685 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 11043879 TACACATTCACAT 11043891 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 5 ATAGTACACATTCACAT 21 ||| ||||||||||||| Sbjct 19293705 ATA-TACACATTCACAT 19293720 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 19502674 CACATTCACATGA 19502686 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 20867862 ACACATTCACATG 20867874 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 22661651 ACATTCACATGAT 22661663 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 26366052 TACACATTCACAT 26366064 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 13 CATTCACATGATG 25 ||||||||||||| Sbjct 27496097 CATTCACATGATG 27496085 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 27847211 ACACATTCACATG 27847199 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 30153772 AAATAGTACACAT 30153760 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTC 17 ||||||||||||| Sbjct 30988320 ATAGTACACATTC 30988332 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 33391651 ACATTCACATGAT 33391639 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 6 TAGTACACATTCACATG 22 ||||||||||||| ||| Sbjct 33916607 TAGTACACATTCA-ATG 33916592 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 34409421 ACACATTCACATG 34409433 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACACATT 16 |||| ||||||||||| Sbjct 35500121 CCAATTAGTACACATT 35500136 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 39578388 AAATAGTACACAT 39578376 Score = 25.1 bits (13), Expect = 85 Identities = 20/23 (87%), Gaps = 2/23 (9%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACATGATG 25 ||| ||| ||| ||||||||||| Sbjct 39741418 AAA-AGT-CACTTTCACATGATG 39741438 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 3 AAA-TAGTACACATTCA 18 ||| ||||||||||||| Sbjct 41199573 AAACTAGTACACATTCA 41199589 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 44549092 AAATAGTACACAT 44549104 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 46694048 ACATTCACATGAT 46694060 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 2/20 (10%) Strand=Plus/Minus Query 3 AAATAGT-ACACATTCACAT 21 |||| || |||||||||||| Sbjct 47070011 AAAT-GTCACACATTCACAT 47069993 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 48958533 ACATTCACATGAT 48958545 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATTCA 18 ||||||||||| |||| Sbjct 52867851 AAATAGTACACCTTCA 52867866 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 53286789 AATAGTACACATT 53286777 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 55107881 CACATTCACATGA 55107869 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 55113111 CACATTCACATGA 55113099 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 55912067 TACACATTCACAT 55912079 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 55977807 TACACATTCACAT 55977795 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 56411133 AAATAGTACACAT 56411145 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGATG 25 ||||||||||| |||| Sbjct 57311457 ACACATTCACACGATG 57311442 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACAT 21 ||||| | ||||||||||| Sbjct 59626880 AAATATTTCACATTCACAT 59626898 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 3 AAATAGTACACA 14 |||||||||||| Sbjct 25382 AAATAGTACACA 25393 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 13 CATTCACATGAT 24 |||||||||||| Sbjct 95781 CATTCACATGAT 95792 >SL4.0ch07 Length=67883646 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 11 CACATTCACATGATG 25 ||||||||||||||| Sbjct 2926634 CACATTCACATGATG 2926620 Score = 28.8 bits (15), Expect = 6.6 Identities = 17/18 (94%), Gaps = 0/18 (0%) Strand=Plus/Minus Query 1 CCAAATAGTACACATTCA 18 |||||| ||||||||||| Sbjct 33053215 CCAAATTGTACACATTCA 33053198 Score = 28.8 bits (15), Expect = 6.6 Identities = 17/18 (94%), Gaps = 0/18 (0%) Strand=Plus/Plus Query 4 AATAGTACACATTCACAT 21 |||||| ||||||||||| Sbjct 47589387 AATAGTTCACATTCACAT 47589404 Score = 28.8 bits (15), Expect = 6.6 Identities = 17/18 (94%), Gaps = 0/18 (0%) Strand=Plus/Minus Query 8 GTACACATTCACATGATG 25 ||| |||||||||||||| Sbjct 66219257 GTATACATTCACATGATG 66219240 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 7 AGTACACATTCACATGA 23 ||| ||||||||||||| Sbjct 7457444 AGTGCACATTCACATGA 7457460 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACACA 14 |||||||||||||| Sbjct 7983367 CCAAATAGTACACA 7983380 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGA 23 |||||||||||||| Sbjct 20910783 ACACATTCACATGA 20910796 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGATGG 26 ||| ||||||||||||| Sbjct 22219953 ACATATTCACATGATGG 22219937 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGA 23 |||||||||||||| Sbjct 30403473 ACACATTCACATGA 30403460 Score = 27.0 bits (14), Expect = 24 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTCACATGAT 24 ||| | |||||||||||||| Sbjct 45495781 ATACTTCACATTCACATGAT 45495800 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACAT 15 |||||||||||||| Sbjct 53626954 CAAATAGTACACAT 53626941 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 5 ATAGTACACATTCACAT 21 |||||||||||||| || Sbjct 56856357 ATAGTACACATTCAAAT 56856341 Score = 27.0 bits (14), Expect = 24 Identities = 21/24 (88%), Gaps = 2/24 (8%) Strand=Plus/Plus Query 3 AAATAGTA-CACATTCACATGATG 25 ||||| || || |||||||||||| Sbjct 62319951 AAATATTATCA-ATTCACATGATG 62319973 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 1267100 CAAATAGTACACA 1267112 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 1866044 CAAATAGTACACA 1866056 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 2521350 CACATTCACATGA 2521362 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 8 GTACACATTCACA 20 ||||||||||||| Sbjct 2845663 GTACACATTCACA 2845651 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 14 ATTCACATGATGG 26 ||||||||||||| Sbjct 4184003 ATTCACATGATGG 4183991 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACAT 21 ||| ||| ||||||||||| Sbjct 7315656 AAAAAGTTCACATTCACAT 7315674 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 10777732 TACACATTCACAT 10777744 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 14978015 TACACATTCACAT 14978003 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATTCA 18 ||| |||||||||||| Sbjct 16512321 AAAGAGTACACATTCA 16512306 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 11 CACATTCACATGATGG 26 ||||||||||| |||| Sbjct 18985524 CACATTCACATAATGG 18985509 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGATG 25 ||||||||||||| || Sbjct 19803967 ACACATTCACATGTTG 19803952 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 21100396 TACACATTCACAT 21100408 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 21751037 TACACATTCACAT 21751025 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 26172739 AATAGTACACATT 26172751 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGAT 24 ||||||||||||| || Sbjct 26195982 TACACATTCACATCAT 26195967 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 27243147 AATAGTACACATT 27243159 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATTCA 18 ||||||||||| |||| Sbjct 31892595 AAATAGTACACGTTCA 31892610 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 32560017 TACACATTCACAT 32560005 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 10 ACACATTCACATGATGG 26 |||||||||||| |||| Sbjct 33422575 ACACATTCACAT-ATGG 33422560 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Minus Query 5 ATAGTACACATTCACATGAT 24 |||||||||||| |||| || Sbjct 35977196 ATAGTACACATT-ACATAAT 35977178 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 10 ACACATTCACATGATGG 26 |||||||||||| |||| Sbjct 36578275 ACACATTCACAT-ATGG 36578260 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 37103807 ACACATTCACATG 37103819 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTC 17 ||||||||||||| Sbjct 37405545 ATAGTACACATTC 37405557 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 38555126 AAATAGTACACAT 38555138 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 39701222 TACACATTCACAT 39701210 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 44753896 TACACATTCACAT 44753908 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 46168099 ACATTCACATGAT 46168087 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATG 25 ||| |||||||||||| Sbjct 46171235 ACATATTCACATGATG 46171250 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 46548347 ACACATTCACATG 46548335 Score = 25.1 bits (13), Expect = 85 Identities = 20/23 (87%), Gaps = 2/23 (9%) Strand=Plus/Plus Query 2 CAAATAGTACACATTCACATGAT 24 |||| | |||| ||||||||||| Sbjct 49110100 CAAA-A-TACAAATTCACATGAT 49110120 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 50987388 AATAGTACACATT 50987376 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Plus Query 8 GTAC-ACATTCACATGATGG 26 |||| ||| ||||||||||| Sbjct 51719543 GTACGACACTCACATGATGG 51719562 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 52876603 TACACATTCACAT 52876615 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 54951778 ACATTCACATGAT 54951766 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATG 25 ||| |||||||||||| Sbjct 58830045 ACAAATTCACATGATG 58830060 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACA 14 ||||||||||||| Sbjct 60636287 CAAATAGTACACA 60636299 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 3 AAAT-AGTACACATTCA 18 |||| |||||||||||| Sbjct 65188785 AAATAAGTACACATTCA 65188801 >SL4.0ch04 Length=64459972 Score = 28.8 bits (15), Expect = 6.6 Identities = 18/19 (95%), Gaps = 1/19 (5%) Strand=Plus/Plus Query 2 CAAATAGTACACATTCACA 20 ||||| ||||||||||||| Sbjct 16220536 CAAAT-GTACACATTCACA 16220553 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 12 ACATTCACATGATGG 26 ||||||||||||||| Sbjct 21826056 ACATTCACATGATGG 21826042 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 2 CAAATAGTACACATT 16 ||||||||||||||| Sbjct 40244066 CAAATAGTACACATT 40244052 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 8 GTACACATTCACATG 22 ||||||||||||||| Sbjct 51906770 GTACACATTCACATG 51906756 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 9 TACACATTCACATG 22 |||||||||||||| Sbjct 9404880 TACACATTCACATG 9404867 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 11 CACATTCACATGAT 24 |||||||||||||| Sbjct 9796063 CACATTCACATGAT 9796050 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 10383140 AAATAGTACACATT 10383127 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGA 23 |||||||||||||| Sbjct 10900844 ACACATTCACATGA 10900831 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 4 AATAGTACACATTC 17 |||||||||||||| Sbjct 16877821 AATAGTACACATTC 16877834 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTCA 18 |||||||||||||| Sbjct 24965821 ATAGTACACATTCA 24965834 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 12 ACATTCACATGATG 25 |||||||||||||| Sbjct 30759305 ACATTCACATGATG 30759292 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 10 ACACATTCACATGA 23 |||||||||||||| Sbjct 34828125 ACACATTCACATGA 34828112 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 12 ACATTCACATGATG 25 |||||||||||||| Sbjct 48114787 ACATTCACATGATG 48114774 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTCA 18 |||||||||||||| Sbjct 49835925 ATAGTACACATTCA 49835938 Score = 27.0 bits (14), Expect = 24 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTCACATGAT 24 ||| ||| |||||||||||| Sbjct 52653902 ATATTACTCATTCACATGAT 52653921 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CCAAATAGTACACA 14 |||||||||||||| Sbjct 57380911 CCAAATAGTACACA 57380898 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 12 ACATTCACATGATG 25 |||||||||||||| Sbjct 61584933 ACATTCACATGATG 61584946 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 7 AGTACACATTCACATG 22 |||||||||||| ||| Sbjct 289637 AGTACACATTCAGATG 289652 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 867173 AAATAGTACACAT 867161 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 2304144 ACACATTCACATG 2304132 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 2 CAAATAGTACACATTCACA 20 || |||| ||||||||||| Sbjct 2383698 CACATAGAACACATTCACA 2383716 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 10 ACACATTCACATGATG 25 ||||||||||| |||| Sbjct 2531898 ACACATTCACACGATG 2531913 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 3528898 TACACATTCACAT 3528910 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 6 TAGTACACATTCACATG 22 ||||||||||||| ||| Sbjct 4867093 TAGTACACATTCA-ATG 4867108 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 6883706 ACATTCACATGAT 6883694 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 5 ATAGTACACATTCACAT 21 |||||||||||| |||| Sbjct 7126507 ATAGTACACATT-ACAT 7126492 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 7922018 ACACATTCACATG 7922030 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 8304891 AATAGTACACATT 8304903 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 2/20 (10%) Strand=Plus/Plus Query 3 AAAT-AGTACACATTCACAT 21 |||| || |||||||||||| Sbjct 9005710 AAATCAG-ACACATTCACAT 9005728 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 9747380 TACACATTCACAT 9747368 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 8 GTACACATTCACATGA 23 || ||||||||||||| Sbjct 9775384 GTTCACATTCACATGA 9775399 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 11456679 TACACATTCACAT 11456691 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 11762891 ACATTCACATGAT 11762903 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Plus Query 4 AATAGTACACATTCACATGA 23 |||||||||||| |||||| Sbjct 11910577 AATAGTACACATG-ACATGA 11910595 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 2 CAAATAGTACAC-ATTC 17 |||||||||||| |||| Sbjct 14881665 CAAATAGTACACCATTC 14881649 Score = 25.1 bits (13), Expect = 85 Identities = 22/26 (85%), Gaps = 2/26 (8%) Strand=Plus/Plus Query 2 CAAATA-GTACACATTCACATG-ATG 25 || ||| ||| ||||||||||| ||| Sbjct 15338276 CATATATGTATACATTCACATGTATG 15338301 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 10 ACACATTCACATGATGG 26 |||||||||||| |||| Sbjct 17397668 ACACATTCACAT-ATGG 17397653 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 14 ATTCACATGATGG 26 ||||||||||||| Sbjct 18980441 ATTCACATGATGG 18980429 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 21053282 ACATTCACATGAT 21053294 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTCACATGA 23 ||||| |||||||||||| Sbjct 21228896 ATAGTGTACATTCACATGA 21228914 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 21799189 ACACATTCACATG 21799177 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 7 AGTACACATTCACATGA 23 ||| ||||||||||||| Sbjct 21806241 AGT-CACATTCACATGA 21806226 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 25441525 ACACATTCACATG 25441537 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 27617234 TAGTACACATTCA 27617246 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Minus Query 3 AAAT-AGTACACATTCACAT 21 |||| ||| ||||||||||| Sbjct 28843294 AAATAAGTCCACATTCACAT 28843275 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 29175184 ACATTCACATGAT 29175172 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 31095052 ACACATTCACATG 31095064 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 10 ACACATTCACATG-ATG 25 ||||||||||||| ||| Sbjct 32310465 ACACATTCACATGCATG 32310481 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 34032519 TACACATTCACAT 34032531 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 35058458 TACACATTCACAT 35058470 >SL4.0ch02 Length=53473368 Score = 28.8 bits (15), Expect = 6.6 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 7 AGTACACATTCACAT 21 ||||||||||||||| Sbjct 15602937 AGTACACATTCACAT 15602923 Score = 28.8 bits (15), Expect = 6.6 Identities = 17/18 (94%), Gaps = 0/18 (0%) Strand=Plus/Minus Query 1 CCAAATAGTACACATTCA 18 ||||||||||||| |||| Sbjct 45188243 CCAAATAGTACACTTTCA 45188226 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 2685885 TACACATTCACATCATG 2685901 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Minus Query 9 TACACATTCACATGATGG 26 ||||| |||||||||||| Sbjct 3919262 TACAC-TTCACATGATGG 3919246 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 5964775 TACACATTCACATCATG 5964759 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 8337675 TACACATTCACATCATG 8337691 Score = 27.0 bits (14), Expect = 24 Identities = 21/24 (88%), Gaps = 1/24 (4%) Strand=Plus/Minus Query 3 AAATAGTACA-CATTCACATGATG 25 ||| || ||| ||||||||||||| Sbjct 10823531 AAAAAGAACATCATTCACATGATG 10823508 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 ATAGTACACATTCA 18 |||||||||||||| Sbjct 11531719 ATAGTACACATTCA 11531732 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 12778800 TACACATTCACATCATG 12778816 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 13406890 TACACATTCACATCATG 13406906 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 14880574 TACACATTCACATCATG 14880558 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 9 TACACATTCACATGATG 25 ||||||||||||| ||| Sbjct 17626717 TACACATTCACATCATG 17626701 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 25598090 AAATAGTACACATT 25598103 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 AAATAGTACACATT 16 |||||||||||||| Sbjct 37001361 AAATAGTACACATT 37001348 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 11 CACATTCACATGAT 24 |||||||||||||| Sbjct 40576630 CACATTCACATGAT 40576617 Score = 27.0 bits (14), Expect = 24 Identities = 19/21 (90%), Gaps = 1/21 (5%) Strand=Plus/Minus Query 3 AAATAGTACACATTCACATGA 23 ||||||||||||| |||||| Sbjct 41577501 AAATAGTACACATG-ACATGA 41577482 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 4 AATAGTACACATTCACA 20 |||||||||||||| || Sbjct 43588636 AATAGTACACATTCTCA 43588620 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACA 20 ||||| |||||||||||| Sbjct 46642736 AAATA-TACACATTCACA 46642752 Score = 27.0 bits (14), Expect = 24 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Plus Query 5 ATAGTACACATTCACATG 22 ||| |||||||||||||| Sbjct 48767889 ATA-TACACATTCACATG 48767905 Score = 27.0 bits (14), Expect = 24 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CCAAATAGTACACA 14 |||||||||||||| Sbjct 52727254 CCAAATAGTACACA 52727241 Score = 27.0 bits (14), Expect = 24 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 4 AATAGTACACATTCACA 20 |||| |||||||||||| Sbjct 53123075 AATAATACACATTCACA 53123091 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 2250434 AAATAGTACACAT 2250422 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 2682588 TACACATTCACAT 2682576 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 1 CCAAATAGTACACATT 16 || ||||||||||||| Sbjct 2771025 CCTAATAGTACACATT 2771040 Score = 25.1 bits (13), Expect = 85 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 11 CACATTCACATGATGG 26 ||||||||||| |||| Sbjct 4076426 CACATTCACATAATGG 4076411 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 5098790 ACATTCACATGAT 5098778 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 14 ATTCACATGATGG 26 ||||||||||||| Sbjct 5626578 ATTCACATGATGG 5626590 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 6960560 TAGTACACATTCA 6960572 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 10321824 ACATTCACATGAT 10321812 Score = 25.1 bits (13), Expect = 85 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Plus Query 2 CAAATAGTACACATTCACAT 21 |||| ||| ||||||||||| Sbjct 11214568 CAAA-AGTTCACATTCACAT 11214586 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 13066037 TACACATTCACAT 13066049 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 14872494 TACACATTCACAT 14872482 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 3 AAATAGTACACATTCACAT 21 ||||| | ||||||||||| Sbjct 21446592 AAATACTTCACATTCACAT 21446610 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 24238292 TACACATTCACAT 24238304 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 24256899 TACACATTCACAT 24256911 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TACACATTCACAT 21 ||||||||||||| Sbjct 24353076 TACACATTCACAT 24353088 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 26191341 AATAGTACACATT 26191329 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 AATAGTACACATT 16 ||||||||||||| Sbjct 26808817 AATAGTACACATT 26808805 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 30253648 AAATAGTACACAT 30253660 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Minus Query 4 AATAGTACACATTCACATG 22 |||||||||||| || ||| Sbjct 34393297 AATAGTACACATGCAAATG 34393279 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 35544607 ACATTCACATGAT 35544619 Score = 25.1 bits (13), Expect = 85 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 2 CAA-ATAGTACACATTC 17 ||| ||||||||||||| Sbjct 38333665 CAATATAGTACACATTC 38333649 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 12 ACATTCACATGAT 24 ||||||||||||| Sbjct 41942691 ACATTCACATGAT 41942679 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 11 CACATTCACATGA 23 ||||||||||||| Sbjct 42700770 CACATTCACATGA 42700758 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 43345723 AAATAGTACACAT 43345735 Score = 25.1 bits (13), Expect = 85 Identities = 20/23 (87%), Gaps = 1/23 (4%) Strand=Plus/Plus Query 3 AAAT-AGTACACATTCACATGAT 24 |||| | |||||||||||| ||| Sbjct 43766221 AAATGATTACACATTCACAAGAT 43766243 Score = 25.1 bits (13), Expect = 85 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 7 AGTACACATTCACATGATG 25 |||||| ||||||||||| Sbjct 44227552 AGTACAACTTCACATGATG 44227570 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 ACACATTCACATG 22 ||||||||||||| Sbjct 44681846 ACACATTCACATG 44681858 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 14 ATTCACATGATGG 26 ||||||||||||| Sbjct 50488645 ATTCACATGATGG 50488633 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAGTACACATTCA 18 ||||||||||||| Sbjct 51096977 TAGTACACATTCA 51096965 >SL4.0ch00 Length=9643250 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 6569205 AAATAGTACACAT 6569217 Score = 25.1 bits (13), Expect = 85 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 AAATAGTACACAT 15 ||||||||||||| Sbjct 8774806 AAATAGTACACAT 8774818 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 10 ACACATTCACAT 21 |||||||||||| Sbjct 287419 ACACATTCACAT 287408 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 5 ATAGTACACATT 16 |||||||||||| Sbjct 773316 ATAGTACACATT 773305 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 5 ATAGTACACATT 16 |||||||||||| Sbjct 1049093 ATAGTACACATT 1049104 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 10 ACACATTCACAT 21 |||||||||||| Sbjct 4342175 ACACATTCACAT 4342164 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 5 ATAGTACACATT 16 |||||||||||| Sbjct 5173317 ATAGTACACATT 5173306 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 5 ATAGTACACATT 16 |||||||||||| Sbjct 5229920 ATAGTACACATT 5229909 Score = 23.3 bits (12), Expect = 307 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 13 CATTCACATGAT 24 |||||||||||| Sbjct 6467288 CATTCACATGAT 6467299 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 3130078988 Query= Length=22 Score E Sequences producing significant alignments: (Bits) Value SL4.0ch09 41.7 6e-04 SL4.0ch08 30.7 1.4 SL4.0ch02 30.7 1.4 SL4.0ch01 30.7 1.4 SL4.0ch11 28.8 5.0 SL4.0ch07 28.8 5.0 SL4.0ch05 28.8 5.0 SL4.0ch03 28.8 5.0 SL4.0ch12 27.0 18 SL4.0ch10 27.0 18 SL4.0ch06 27.0 18 SL4.0ch04 27.0 18 SL4.0ch00 27.0 18 >SL4.0ch09 Length=68513564 Score = 41.7 bits (22), Expect = 6e-04 Identities = 22/22 (100%), Gaps = 0/22 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGAGTAGCTC 22 |||||||||||||||||||||| Sbjct 68091991 TGTGCTAATGTTGGAGTAGCTC 68091970 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGA 15 ||||||||||||||| Sbjct 2345893 TGTGCTAATGTTGGA 2345879 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAGCTC 22 ||||||||||||||| Sbjct 34683753 ATGTTGGAGTAGCTC 34683739 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGGA 15 |||||||||||||| Sbjct 5384468 GTGCTAATGTTGGA 5384481 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGTA 18 |||||||||||||| Sbjct 12548884 CTAATGTTGGAGTA 12548871 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGG 14 |||||||||||||| Sbjct 18922179 TGTGCTAATGTTGG 18922166 Score = 27.0 bits (14), Expect = 18 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTAG 19 |||| |||||||||||| Sbjct 22634942 TGCTGATGTTGGAGTAG 22634958 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGTA 18 |||||||||||||| Sbjct 28724323 CTAATGTTGGAGTA 28724336 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAG 16 |||||||||||||| Sbjct 34625972 TGCTAATGTTGGAG 34625985 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGTA 18 |||||||||||||| Sbjct 37048643 CTAATGTTGGAGTA 37048656 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAG 19 |||||||||||||| Sbjct 38083683 TAATGTTGGAGTAG 38083696 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAG 16 |||||||||||||| Sbjct 53348245 TGCTAATGTTGGAG 53348232 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 2353225 TGCTAATGTTGGA 2353213 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 5828888 TAATGTTGGAGTA 5828900 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 11595478 CTAATGTTGGAGT 11595490 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 15122154 TGTGCTAATGTTG 15122166 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 16890084 TGTTGGAGTAGCT 16890096 Score = 25.1 bits (13), Expect = 64 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTAGCTC 22 ||||||||||| | |||||| Sbjct 17305262 TGCTAATGTTG-ACTAGCTC 17305280 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 19045362 TGTGCTAATGTTG 19045374 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 22885570 TGTTGGAGTAGCT 22885582 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 22992653 TGTTGGAGTAGCT 22992641 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 23756805 TGTGCTAATGTTG 23756817 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 26856507 TGTGCTAATGTTG 26856519 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 26861915 TGTGCTAATGTTG 26861927 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 28462370 CTAATGTTGGAGT 28462382 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 32703984 TGTGCTAATGTTG 32703996 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 32738616 AATGTTGGAGTAG 32738628 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 35166514 TGTGCTAATGTTG 35166502 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 35768418 TGTGCTAATGTTG 35768406 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 37626533 TGCTAATGTTGGA 37626521 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 38592997 TGTGCTAATGTTG 38593009 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 39043670 TGTTGGAGTAGCT 39043682 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 41181981 TGTGCTAATGTTG 41181969 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 41187984 TGTGCTAATGTTG 41187972 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 41734221 AATGTTGGAGTAG 41734233 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 41851991 CTAATGTTGGAGT 41852003 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 42217334 TGTGCTAATGTTG 42217346 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 44113268 CTAATGTTGGAGT 44113256 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 45839556 CTAATGTTGGAGT 45839544 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 49416925 TGTGCTAATGTTG 49416937 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 53406599 CTAATGTTGGAGT 53406611 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 61119070 TGTGCTAATGTTG 61119058 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 64916496 AATGTTGGAGTAG 64916508 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTAGCT 21 |||| ||||||||||| Sbjct 67327548 TAATTTTGGAGTAGCT 67327533 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 611748 TGCTAATGTTGG 611759 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 1749520 TGTGCTAATGTT 1749531 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 1749987 TGTGCTAATGTT 1749998 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 1750220 TGTGCTAATGTT 1750231 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 8 ATGTTGGAGTAGCTC 22 ||| ||||||||||| Sbjct 2170142 ATGCTGGAGTAGCTC 2170156 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 3984467 TGCTAATGTTGG 3984478 >SL4.0ch08 Length=63995357 Score = 30.7 bits (16), Expect = 1.4 Identities = 18/19 (95%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGGAGTAGC 20 ||||||| ||||||||||| Sbjct 16072572 GTGCTAAGGTTGGAGTAGC 16072590 Score = 30.7 bits (16), Expect = 1.4 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGTAGC 20 |||||||||||||||| Sbjct 19493202 CTAATGTTGGAGTAGC 19493187 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAGCT 21 ||||||||||||||| Sbjct 61289254 AATGTTGGAGTAGCT 61289268 Score = 28.8 bits (15), Expect = 5.0 Identities = 17/18 (94%), Gaps = 0/18 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGGAGTA 18 |||| ||||||||||||| Sbjct 62359296 TGTGTTAATGTTGGAGTA 62359313 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 4 GCTAATGTTGGAGT 17 |||||||||||||| Sbjct 5331770 GCTAATGTTGGAGT 5331783 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGTA 18 |||||||||||||| Sbjct 44573233 CTAATGTTGGAGTA 44573246 Score = 27.0 bits (14), Expect = 18 Identities = 19/21 (90%), Gaps = 2/21 (10%) Strand=Plus/Plus Query 3 TGCTAATGT-TGGAGTAGCTC 22 ||| ||||| ||||||||||| Sbjct 55185771 TGC-AATGTATGGAGTAGCTC 55185790 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTA 18 ||||||||||| |||| Sbjct 270767 TGCTAATGTTGAAGTA 270782 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 1711061 AATGTTGGAGTAG 1711073 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 2237664 TAATGTTGGAGTA 2237652 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 2258157 TAATGTTGGAGTA 2258145 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 1 TGTGCTAATGT-TGGAG 16 ||||||||||| ||||| Sbjct 2745236 TGTGCTAATGTGTGGAG 2745252 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 4798635 AATGTTGGAGTAG 4798647 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 8726851 CTAATGTTGGAGT 8726863 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 14927764 TGTTGGAGTAGCT 14927776 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 15848347 TGTTGGAGTAGCT 15848359 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 16344707 AATGTTGGAGTAG 16344695 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 17080639 TGTGCTAATGTTG 17080627 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 18827585 TAATGTTGGAGTA 18827573 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 18914339 TAATGTTGGAGTA 18914327 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGGAGT 17 ||||||||||||| ||| Sbjct 19493648 TGTGCTAATGTTG-AGT 19493663 Score = 25.1 bits (13), Expect = 64 Identities = 18/20 (90%), Gaps = 2/20 (10%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAGTA-GCT 21 |||||||||||| ||| ||| Sbjct 19540634 TGCTAATGTTGG-GTAAGCT 19540616 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 20075044 TGTTGGAGTAGCT 20075056 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 20876848 TGTGCTAATGTTG 20876836 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 21701570 TGTGCTAATGTTG 21701582 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTA 18 ||| |||||||||||| Sbjct 22326634 TGCAAATGTTGGAGTA 22326649 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 23463434 TGTGCTAATGTTG 23463422 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 27906058 TGTGCTAATGTTG 27906046 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 30369594 TGTGCTAATGTTG 30369606 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 32277828 TGTGCTAATGTTG 32277840 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 GCTAATGTTGGAG 16 ||||||||||||| Sbjct 32339838 GCTAATGTTGGAG 32339850 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 32675994 TGTTGGAGTAGCT 32676006 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 35555311 TGTGCTAATGTTG 35555299 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 3 TGCTAATGTTG-GAGTA 18 ||||||||||| ||||| Sbjct 41280404 TGCTAATGTTGTGAGTA 41280388 Score = 25.1 bits (13), Expect = 64 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAGTAGCT 21 |||||||||||| ||||| Sbjct 49119048 TGCTAATGTTGGGTTAGCT 49119030 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTA 18 |||| ||||||||||| Sbjct 49804373 TGCTGATGTTGGAGTA 49804388 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTAG 19 ||||||||||||| ||| Sbjct 53673464 TGCTAATGTTGGA-TAG 53673479 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 53953388 TGCTAATGTTGGA 53953376 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 55005305 AATGTTGGAGTAG 55005293 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAG 19 |||||||||||| Sbjct 919961 ATGTTGGAGTAG 919950 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 10 GTTGGAGTAGCT 21 |||||||||||| Sbjct 1911410 GTTGGAGTAGCT 1911399 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 3711130 TGCTAATGTTGG 3711141 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 4 GCTAATGTTGGA 15 |||||||||||| Sbjct 4410219 GCTAATGTTGGA 4410230 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 5662320 TGTGCTAATGTT 5662309 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6254365 TGTGCTAATGTT 6254354 Score = 23.3 bits (12), Expect = 230 Identities = 17/19 (89%), Gaps = 1/19 (5%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGAGTAG 19 ||| |||||||||||| || Sbjct 6275084 TGT-CTAATGTTGGAGAAG 6275067 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAG 19 |||||||||||| Sbjct 6313785 ATGTTGGAGTAG 6313774 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6326329 TGTGCTAATGTT 6326318 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 7427119 TGTGCTAATGTT 7427130 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 8067254 TGTGCTAATGTT 8067265 >SL4.0ch02 Length=53473368 Score = 30.7 bits (16), Expect = 1.4 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGAG 16 |||||||||||||||| Sbjct 42022874 TGTGCTAATGTTGGAG 42022859 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAGC 20 ||||||||||||||| Sbjct 170136 TAATGTTGGAGTAGC 170150 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAG 16 |||||||||||||| Sbjct 8063289 TGCTAATGTTGGAG 8063302 Score = 27.0 bits (14), Expect = 18 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTAGCTC 22 ||| ||||||||||||| Sbjct 11383975 TAAAGTTGGAGTAGCTC 11383959 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAG 19 |||||||||||||| Sbjct 34150926 TAATGTTGGAGTAG 34150939 Score = 27.0 bits (14), Expect = 18 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGGAGT 17 |||| |||||||||||| Sbjct 43133700 TGTGGTAATGTTGGAGT 43133716 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 1353381 TGTGCTAATGTTG 1353393 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 1358736 TGTGCTAATGTTG 1358748 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 3761470 TAATGTTGGAGTA 3761482 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGG 14 ||||||||||||| Sbjct 3807486 GTGCTAATGTTGG 3807474 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 7620659 AATGTTGGAGTAG 7620671 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 9835730 TGTGCTAATGTTG 9835718 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 11872962 TGTGCTAATGTTG 11872974 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 16944734 TGCTAATGTTGGA 16944722 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 18369947 AATGTTGGAGTAG 18369935 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGG 14 ||||||||||||| Sbjct 20261571 GTGCTAATGTTGG 20261559 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 21364791 TGTTGGAGTAGCT 21364779 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 21365727 TGTTGGAGTAGCT 21365739 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 22797289 TGTTGGAGTAGCT 22797277 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 24668270 TGCTAATGTTGGA 24668258 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGGAGT 17 |||||||||||| ||| Sbjct 28780233 GTGCTAATGTTGAAGT 28780218 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 29488842 TGCTAATGTTGGA 29488854 Score = 25.1 bits (13), Expect = 64 Identities = 18/20 (90%), Gaps = 1/20 (5%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTAGCTC 22 |||| ||| ||||||||||| Sbjct 32581252 TGCTGATG-TGGAGTAGCTC 32581270 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 36415803 TAATGTTGGAGTA 36415815 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 8 ATGTTGGAGTAGC 20 ||||||||||||| Sbjct 37204861 ATGTTGGAGTAGC 37204873 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 39534892 CTAATGTTGGAGT 39534904 Score = 25.1 bits (13), Expect = 64 Identities = 17/19 (89%), Gaps = 0/19 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAGTAGCT 21 ||||||||||| ||| ||| Sbjct 44154103 TGCTAATGTTGCAGTTGCT 44154085 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 45241167 AATGTTGGAGTAG 45241155 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 3 TGCTA-ATGTTGGAGTA 18 ||||| ||||||||||| Sbjct 48024516 TGCTATATGTTGGAGTA 48024532 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAG 16 ||||||||||||| Sbjct 48359916 GCTAATGTTGGAG 48359904 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAGC 20 ||||||||||||| Sbjct 50150792 ATGTTGGAGTAGC 50150780 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 185525 TGTGCTAATGTT 185536 Score = 23.3 bits (12), Expect = 230 Identities = 17/19 (89%), Gaps = 1/19 (5%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGAGTAG 19 ||| |||||||||||| || Sbjct 436658 TGT-CTAATGTTGGAGAAG 436641 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAG 16 |||||||||||| Sbjct 615589 CTAATGTTGGAG 615600 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 920867 TGTGCTAATGTT 920878 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 1069078 TGTGCTAATGTT 1069089 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 1078768 TGTGCTAATGTT 1078779 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAGC 20 ||||||||||| ||| Sbjct 1933292 TAATGTTGGAGGAGC 1933306 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 2334149 TGTGCTAATGTT 2334138 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 2719016 TGTGCTAATGTT 2719005 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGT 17 |||||||||||| Sbjct 2786344 TAATGTTGGAGT 2786355 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 4175328 AATGTTGGAGTA 4175339 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 4858716 TGTGCTAATGTT 4858705 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 5297396 AATGTTGGAGTA 5297407 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 5540797 TGTGCTAATGTT 5540808 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 6598957 AATGTTGGAGTA 6598946 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAG 16 |||||||||||| Sbjct 6631924 CTAATGTTGGAG 6631935 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 6803723 AATGTTGGAGTA 6803712 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 7286026 TGTGCTAATGTT 7286015 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGT 17 |||||||||||| Sbjct 8279980 TAATGTTGGAGT 8279969 >SL4.0ch01 Length=90863682 Score = 30.7 bits (16), Expect = 1.4 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 4 GCTAATGTTGGAGTAG 19 |||||||||||||||| Sbjct 46006971 GCTAATGTTGGAGTAG 46006986 Score = 30.7 bits (16), Expect = 1.4 Identities = 16/16 (100%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTA 18 |||||||||||||||| Sbjct 71120723 TGCTAATGTTGGAGTA 71120738 Score = 28.8 bits (15), Expect = 5.0 Identities = 17/18 (94%), Gaps = 0/18 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGTAGCTC 22 |||||||||||| ||||| Sbjct 36404271 CTAATGTTGGAGAAGCTC 36404254 Score = 28.8 bits (15), Expect = 5.0 Identities = 19/21 (90%), Gaps = 0/21 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGGAGTAGCTC 22 |||| | |||||||||||||| Sbjct 58667768 GTGCCATTGTTGGAGTAGCTC 58667788 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAGCT 21 ||||||||||||||| Sbjct 67786993 AATGTTGGAGTAGCT 67787007 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGTA 18 |||||||||||||| Sbjct 40201445 CTAATGTTGGAGTA 40201458 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGG 14 |||||||||||||| Sbjct 56973418 TGTGCTAATGTTGG 56973431 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGG 14 |||||||||||||| Sbjct 66635373 TGTGCTAATGTTGG 66635360 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCTC 22 |||||||||||||| Sbjct 77351199 TGTTGGAGTAGCTC 77351186 Score = 27.0 bits (14), Expect = 18 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTAGCTC 22 |||| |||||||||||| Sbjct 78090244 TAATTTTGGAGTAGCTC 78090228 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTAG 19 |||||||||||||| Sbjct 90625331 TAATGTTGGAGTAG 90625318 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 2537220 AATGTTGGAGTAG 2537208 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 5857890 TAATGTTGGAGTA 5857902 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGGAGT 17 |||||||||||| ||| Sbjct 6262723 GTGCTAATGTTGTAGT 6262708 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 18347467 AATGTTGGAGTAG 18347479 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 21547759 TGTTGGAGTAGCT 21547747 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 21891214 TGTGCTAATGTTG 21891226 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 36159711 TGTGCTAATGTTG 36159723 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 36320240 TGTGCTAATGTTG 36320228 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 36375174 TGTGCTAATGTTG 36375186 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 36380679 TGTGCTAATGTTG 36380691 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 GCTAATGTTGGAG 16 ||||||||||||| Sbjct 36538909 GCTAATGTTGGAG 36538921 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 40491068 TGTTGGAGTAGCT 40491056 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 40503957 TGTTGGAGTAGCT 40503945 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 46514657 TGTGCTAATGTTG 46514669 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAG 16 ||||||||||||| Sbjct 50281111 GCTAATGTTGGAG 50281099 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 51825905 CTAATGTTGGAGT 51825917 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 56962250 TAATGTTGGAGTA 56962238 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 59717660 AATGTTGGAGTAG 59717648 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 60720665 TGTGCTAATGTTG 60720677 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 60726126 TGTGCTAATGTTG 60726138 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 63020454 TGTTGGAGTAGCT 63020442 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 64630413 TGTGCTAATGTTG 64630401 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 67316913 TGTTGGAGTAGCT 67316901 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGG 14 ||||||||||||| Sbjct 72616139 GTGCTAATGTTGG 72616127 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 72684562 AATGTTGGAGTAG 72684574 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAGTAG 19 |||| |||||||||||| Sbjct 77088325 TGCT-ATGTTGGAGTAG 77088310 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 77991778 TGTGCTAATGTTG 77991790 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGG 14 ||||||||||||| Sbjct 81355971 GTGCTAATGTTGG 81355983 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 10 GTTGGAGTAGCTC 22 ||||||||||||| Sbjct 81905125 GTTGGAGTAGCTC 81905113 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 82391494 AATGTTGGAGTAG 82391506 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 84824471 AATGTTGGAGTAG 84824459 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 665534 TGTGCTAATGTT 665545 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 762991 TGTGCTAATGTT 762980 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 11 TTGGAGTAGCTC 22 |||||||||||| Sbjct 2085569 TTGGAGTAGCTC 2085558 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 3927242 TGCTAATGTTGG 3927231 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAG 19 |||||||||||| Sbjct 4408767 ATGTTGGAGTAG 4408756 Score = 23.3 bits (12), Expect = 230 Identities = 15/16 (94%), Gaps = 1/16 (6%) Strand=Plus/Minus Query 6 TAATGTTGGAGTAGCT 21 ||||||||||| |||| Sbjct 4469018 TAATGTTGGAG-AGCT 4469004 Score = 23.3 bits (12), Expect = 230 Identities = 15/16 (94%), Gaps = 1/16 (6%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGGAG 16 |||| ||||||||||| Sbjct 5070041 TGTG-TAATGTTGGAG 5070055 Score = 23.3 bits (12), Expect = 230 Identities = 15/16 (94%), Gaps = 1/16 (6%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGGAG 16 |||| ||||||||||| Sbjct 5077851 TGTG-TAATGTTGGAG 5077865 >SL4.0ch11 Length=54379777 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGT 17 ||||||||||||||| Sbjct 25355267 TGCTAATGTTGGAGT 25355281 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAG 16 |||||||||||||| Sbjct 44817184 TGCTAATGTTGGAG 44817197 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 1988084 TGTTGGAGTAGCT 1988096 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGGAGT 17 ||||||||||||| || Sbjct 2474695 GTGCTAATGTTGGTGT 2474680 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGG 14 ||||||||||||| Sbjct 9998651 GTGCTAATGTTGG 9998663 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 19648972 TGTTGGAGTAGCT 19648960 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 19968018 TGTTGGAGTAGCT 19968030 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 24496946 CTAATGTTGGAGT 24496958 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 26273347 TGTTGGAGTAGCT 26273335 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 27785691 TGTTGGAGTAGCT 27785703 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 27903271 CTAATGTTGGAGT 27903283 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGGAGT 17 |||||||||||| ||| Sbjct 28361037 GTGCTAATGTTGTAGT 28361022 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 29168380 AATGTTGGAGTAG 29168368 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 29365479 TAATGTTGGAGTA 29365491 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 32934204 CTAATGTTGGAGT 32934216 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 33651576 TAATGTTGGAGTA 33651588 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 34057077 TAATGTTGGAGTA 34057089 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 34316540 TGTTGGAGTAGCT 34316528 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 34317357 TGTTGGAGTAGCT 34317369 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 36341969 TAATGTTGGAGTA 36341981 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 36767868 TGTGCTAATGTTG 36767880 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 37245270 TGTGCTAATGTTG 37245258 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTA 18 ||| |||||||||||| Sbjct 43901472 TGCCAATGTTGGAGTA 43901487 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 48753819 AATGTTGGAGTAG 48753831 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGG 14 ||||||||||||| Sbjct 50107461 GTGCTAATGTTGG 50107473 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 2176670 AATGTTGGAGTA 2176681 Score = 23.3 bits (12), Expect = 230 Identities = 15/16 (94%), Gaps = 1/16 (6%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTA 18 ||||||||||| |||| Sbjct 5960023 TGCTAATGTTG-AGTA 5960037 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 6934083 TGCTAATGTTGG 6934072 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 6985656 TGCTAATGTTGG 6985645 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 7045608 TGCTAATGTTGG 7045597 Score = 23.3 bits (12), Expect = 230 Identities = 17/19 (89%), Gaps = 1/19 (5%) Strand=Plus/Plus Query 1 TGTGCTA-ATGTTGGAGTA 18 |||| || ||||||||||| Sbjct 7203115 TGTGGTATATGTTGGAGTA 7203133 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 11 TTGGAGTAGCTC 22 |||||||||||| Sbjct 8239388 TTGGAGTAGCTC 8239377 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGT 17 || |||||||||||| Sbjct 8864657 TGGTAATGTTGGAGT 8864671 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 8906418 TGTGCTAATGTT 8906407 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 9373402 TGTGCTAATGTT 9373391 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 10169893 AATGTTGGAGTA 10169904 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 11714803 TGTGCTAATGTT 11714792 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 11724504 TGTGCTAATGTT 11724493 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 13899697 TGTGCTAATGTT 13899708 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAGT 17 |||||||||||| || Sbjct 14174804 TGCTAATGTTGGTGT 14174790 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 16113891 TGTGCTAATGTT 16113902 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTG 13 |||||||||||| Sbjct 16766077 GTGCTAATGTTG 16766088 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 16812221 TGTGCTAATGTT 16812232 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 16985718 TGTGCTAATGTT 16985707 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 17006417 TGTGCTAATGTT 17006406 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 17304019 AATGTTGGAGTA 17304008 Score = 23.3 bits (12), Expect = 230 Identities = 15/16 (94%), Gaps = 1/16 (6%) Strand=Plus/Minus Query 5 CTAATGTTGGAGTAGC 20 |||| ||||||||||| Sbjct 17953316 CTAA-GTTGGAGTAGC 17953302 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 11 TTGGAGTAGCTC 22 |||||||||||| Sbjct 18459421 TTGGAGTAGCTC 18459410 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 18593993 TGTGCTAATGTT 18593982 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 19696073 TGTGCTAATGTT 19696062 >SL4.0ch07 Length=67883646 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAGCT 21 ||||||||||||||| Sbjct 38776418 AATGTTGGAGTAGCT 38776432 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAGCT 21 ||||||||||||||| Sbjct 61732505 AATGTTGGAGTAGCT 61732519 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAGCT 21 |||||||||||||| Sbjct 159333 ATGTTGGAGTAGCT 159320 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCTC 22 |||||||||||||| Sbjct 9322783 TGTTGGAGTAGCTC 9322796 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAG 16 |||||||||||||| Sbjct 63114718 TGCTAATGTTGGAG 63114731 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 757204 TGCTAATGTTGGA 757216 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 6649309 TAATGTTGGAGTA 6649321 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGTAGC 20 ||||||||||| |||| Sbjct 8504606 CTAATGTTGGACTAGC 8504591 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 9314093 TGTTGGAGTAGCT 9314081 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 9638730 CTAATGTTGGAGT 9638742 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 9650991 CTAATGTTGGAGT 9651003 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 11302492 CTAATGTTGGAGT 11302480 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 12292157 TGTGCTAATGTTG 12292145 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 18576826 TGCTAATGTTGGA 18576814 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 20236344 TGTGCTAATGTTG 20236332 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 22935399 CTAATGTTGGAGT 22935387 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 27538757 TGTGCTAATGTTG 27538769 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 29886981 TGTGCTAATGTTG 29886969 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAGCT 21 ||||||||||| |||| Sbjct 31301425 TAATGTTGGAGAAGCT 31301440 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAGCT 21 |||||||||||| ||| Sbjct 32202008 TAATGTTGGAGTTGCT 32202023 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 36972690 TGTGCTAATGTTG 36972702 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 36978089 TGTGCTAATGTTG 36978101 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 37662151 TGTTGGAGTAGCT 37662163 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 40393170 TGTGCTAATGTTG 40393182 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 40709043 AATGTTGGAGTAG 40709031 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 42864625 TGTGCTAATGTTG 42864637 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 42907919 TGTGCTAATGTTG 42907931 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 48433353 TGTGCTAATGTTG 48433365 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 50291166 CTAATGTTGGAGT 50291178 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 7 AATGT-TGGAGTAGCTC 22 ||||| ||||||||||| Sbjct 51008409 AATGTGTGGAGTAGCTC 51008425 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 53761035 TGTGCTAATGTTG 53761047 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTA 18 |||||||||||| ||| Sbjct 55001558 TGCTAATGTTGGTGTA 55001573 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 57845801 AATGTTGGAGTAG 57845813 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 61894445 TAATGTTGGAGTA 61894457 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 65055912 TAATGTTGGAGTA 65055900 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 65851421 TGCTAATGTTGGA 65851409 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 10 GTTGGAGTAGCT 21 |||||||||||| Sbjct 151267 GTTGGAGTAGCT 151256 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 4 GCTAATGTTGGA 15 |||||||||||| Sbjct 757867 GCTAATGTTGGA 757878 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAGCT 21 ||| ||||||||||| Sbjct 1308173 AATCTTGGAGTAGCT 1308187 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 2062347 TGTGCTAATGTT 2062358 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 2254796 TGTGCTAATGTT 2254785 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGT 17 || |||||||||||| Sbjct 2650463 TGATAATGTTGGAGT 2650477 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAGCTC 22 |||||||||||| || Sbjct 2740422 ATGTTGGAGTAGATC 2740408 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGC 20 |||||||||||| Sbjct 3194453 TGTTGGAGTAGC 3194442 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 3377369 TGCTAATGTTGG 3377358 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 3644437 AATGTTGGAGTA 3644426 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAGTA 18 |||||||||||| || Sbjct 5122996 GCTAATGTTGGAATA 5122982 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGT 17 |||||||||||| Sbjct 6612166 TAATGTTGGAGT 6612155 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 7408630 TGTGCTAATGTT 7408641 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 7416381 TGTGCTAATGTT 7416392 >SL4.0ch05 Length=65269487 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGT 17 ||||||||||||||| Sbjct 62571508 TGCTAATGTTGGAGT 62571522 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAGCT 21 ||||||||||||||| Sbjct 63756735 AATGTTGGAGTAGCT 63756721 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAG 19 |||||||||||||| Sbjct 7406405 TAATGTTGGAGTAG 7406418 Score = 27.0 bits (14), Expect = 18 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Minus Query 5 CTAATGTTGGAGTAGCTC 22 ||||||||||||| |||| Sbjct 37286585 CTAATGTTGGAGT-GCTC 37286569 Score = 27.0 bits (14), Expect = 18 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGAGT 17 |||| |||||||||||| Sbjct 50610058 TGTGATAATGTTGGAGT 50610042 Score = 27.0 bits (14), Expect = 18 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTAG 19 || |||||||||||||| Sbjct 58464804 TGATAATGTTGGAGTAG 58464820 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 685335 TAATGTTGGAGTA 685323 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 12793601 TGTGCTAATGTTG 12793589 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 22026349 CTAATGTTGGAGT 22026337 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 27589994 TGTGCTAATGTTG 27589982 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 33683231 TGTGCTAATGTTG 33683243 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGG 14 ||||||||||||| Sbjct 35071034 GTGCTAATGTTGG 35071022 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 35371526 TGTTGGAGTAGCT 35371538 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 GCTAATGTTGGAG 16 ||||||||||||| Sbjct 43417060 GCTAATGTTGGAG 43417072 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 43750476 TGTGCTAATGTTG 43750464 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 43755999 TGTGCTAATGTTG 43755987 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 45259297 TGTGCTAATGTTG 45259285 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 45868503 TGTGCTAATGTTG 45868491 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGG 14 ||||||||||||| Sbjct 49030037 GTGCTAATGTTGG 49030049 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 51372793 TGTGCTAATGTTG 51372781 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 51895321 TAATGTTGGAGTA 51895309 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 52076502 TAATGTTGGAGTA 52076490 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 52344228 TAATGTTGGAGTA 52344216 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 53621306 TAATGTTGGAGTA 53621294 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 56718405 TGTGCTAATGTTG 56718393 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 58694126 AATGTTGGAGTAG 58694114 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 58764403 AATGTTGGAGTAG 58764391 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGG 14 ||||||||||||| Sbjct 61808536 GTGCTAATGTTGG 61808524 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGCTC 22 ||||||||||||| Sbjct 62196688 GTTGGAGTAGCTC 62196700 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 63501592 TAATGTTGGAGTA 63501580 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGC 20 |||||||||||| Sbjct 187165 TGTTGGAGTAGC 187176 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAGCT 21 || |||||||||||| Sbjct 704623 AAAGTTGGAGTAGCT 704637 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAGCT 21 |||||||||||| || Sbjct 733463 AATGTTGGAGTACCT 733449 Score = 23.3 bits (12), Expect = 230 Identities = 17/19 (89%), Gaps = 2/19 (11%) Strand=Plus/Plus Query 3 TGC-TA-ATGTTGGAGTAG 19 ||| || |||||||||||| Sbjct 1167312 TGCTTAGATGTTGGAGTAG 1167330 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 1349155 AATGTTGGAGTA 1349166 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 1381955 TGCTAATGTTGG 1381966 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 11 TTGGAGTAGCTC 22 |||||||||||| Sbjct 1382121 TTGGAGTAGCTC 1382132 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGA 15 ||| ||||||||||| Sbjct 1969497 TGTCCTAATGTTGGA 1969483 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 2683142 AATGTTGGAGTA 2683131 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTG 13 |||||||||||| Sbjct 3013280 GTGCTAATGTTG 3013291 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGT 17 |||||||||||| Sbjct 3156767 TAATGTTGGAGT 3156778 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 3730618 AATGTTGGAGTA 3730629 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 4172703 TGCTAATGTTGG 4172714 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 4613366 TGTGCTAATGTT 4613377 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 4634664 TGTGCTAATGTT 4634675 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAG 19 |||||||||||| Sbjct 4941120 ATGTTGGAGTAG 4941109 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGC 20 |||||||||||| Sbjct 4977391 TGTTGGAGTAGC 4977380 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAG 16 |||||||||||| Sbjct 6967000 CTAATGTTGGAG 6966989 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 7601202 TGTGCTAATGTT 7601213 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 7619561 TGTGCTAATGTT 7619572 >SL4.0ch03 Length=65298490 Score = 28.8 bits (15), Expect = 5.0 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAGCT 21 ||||||||||||||| Sbjct 51199382 AATGTTGGAGTAGCT 51199368 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 8 ATGTTGGAGTAGCT 21 |||||||||||||| Sbjct 6380468 ATGTTGGAGTAGCT 6380481 Score = 27.0 bits (14), Expect = 18 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGAGT 17 |||| |||||||||||| Sbjct 15564498 TGTGTTAATGTTGGAGT 15564482 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAG 16 |||||||||||||| Sbjct 25603075 TGCTAATGTTGGAG 25603062 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAG 16 |||||||||||||| Sbjct 26169982 TGCTAATGTTGGAG 26169995 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAGC 20 |||||||||||||| Sbjct 46311766 AATGTTGGAGTAGC 46311753 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 736417 AATGTTGGAGTAG 736429 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 752263 AATGTTGGAGTAG 752275 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAGCT 21 ||||||||||| |||| Sbjct 2622558 TAATGTTGGAGAAGCT 2622573 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 7 AAT-GTTGGAGTAGCTC 22 ||| ||||||||||||| Sbjct 2669363 AATAGTTGGAGTAGCTC 2669379 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 9206062 TGTGCTAATGTTG 9206050 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGGAG 16 |||| ||||||||||| Sbjct 13179865 TGTGGTAATGTTGGAG 13179880 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 14891413 AATGTTGGAGTAG 14891425 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 20903532 TAATGTTGGAGTA 20903544 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 20916458 TGTGCTAATGTTG 20916446 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 22227081 TGTTGGAGTAGCT 22227069 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 25460409 TGTTGGAGTAGCT 25460421 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 27041263 TGTGCTAATGTTG 27041275 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 29889066 TGTTGGAGTAGCT 29889054 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 30153252 TGCTAATGTTGGA 30153264 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 33342081 TGTGCTAATGTTG 33342069 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTAGCT 21 ||||||||||| |||| Sbjct 37246255 TAATGTTGGAGAAGCT 37246240 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 37562719 TGTGCTAATGTTG 37562731 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 39499345 TGTGCTAATGTTG 39499333 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAGTA 18 |||||||||||| ||| Sbjct 45337061 TGCTAATGTTGGTGTA 45337046 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 48856806 TGCTAATGTTGGA 48856794 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 49977675 TGTTGGAGTAGCT 49977663 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 53579352 AATGTTGGAGTAG 53579364 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAG 16 ||||||||||||| Sbjct 56850496 GCTAATGTTGGAG 56850484 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 57913278 TGTGCTAATGTTG 57913266 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 63852455 TGCTAATGTTGGA 63852443 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 447101 TGCTAATGTTGG 447090 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAG 16 |||||||||||| Sbjct 897888 CTAATGTTGGAG 897877 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 1593989 TGCTAATGTTGG 1593978 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 2422564 TGTGCTAATGTT 2422553 Score = 23.3 bits (12), Expect = 230 Identities = 16/18 (89%), Gaps = 0/18 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGGAGTA 18 |||| | ||||||||||| Sbjct 2700298 TGTGTTCATGTTGGAGTA 2700315 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGT 17 |||||||||||| Sbjct 2779150 TAATGTTGGAGT 2779139 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGT 17 |||||||||||| Sbjct 2821981 TAATGTTGGAGT 2821992 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTG 13 |||||||||||| Sbjct 3389768 GTGCTAATGTTG 3389779 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTG 13 |||||||||||| Sbjct 4368805 GTGCTAATGTTG 4368816 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 6003426 AATGTTGGAGTA 6003415 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGCT 21 |||||||||||| Sbjct 6359468 GTTGGAGTAGCT 6359479 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAG 16 |||||||||||| Sbjct 6393310 CTAATGTTGGAG 6393321 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 8414748 TGTGCTAATGTT 8414737 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 10496718 AATGTTGGAGTA 10496707 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAG 16 |||||||||||| Sbjct 11471300 CTAATGTTGGAG 11471289 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 12211217 TGTGCTAATGTT 12211228 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 12217602 TGTGCTAATGTT 12217613 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGCT 21 |||||||||||| Sbjct 12240228 GTTGGAGTAGCT 12240239 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGT 17 ||| ||||||||||| Sbjct 13029077 TGCAAATGTTGGAGT 13029091 >SL4.0ch12 Length=66688036 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGG 14 |||||||||||||| Sbjct 2112371 TGTGCTAATGTTGG 2112384 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAG 16 |||||||||||||| Sbjct 18422462 TGCTAATGTTGGAG 18422449 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAGCT 21 |||||||||||||| Sbjct 41328114 ATGTTGGAGTAGCT 41328101 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAG 19 |||||||||||||| Sbjct 41756562 TAATGTTGGAGTAG 41756575 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAG 19 |||||||||||||| Sbjct 57554429 TAATGTTGGAGTAG 57554442 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAG 16 |||||||||||||| Sbjct 57992749 TGCTAATGTTGGAG 57992736 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 8 ATGTTGGAGTAGC 20 ||||||||||||| Sbjct 5618078 ATGTTGGAGTAGC 5618090 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 6915531 TGCTAATGTTGGA 6915519 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 7025663 TGTTGGAGTAGCT 7025651 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 7029481 TGTTGGAGTAGCT 7029493 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 7238753 TGTGCTAATGTTG 7238741 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 8251718 AATGTTGGAGTAG 8251706 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 11335953 TGTGCTAATGTTG 11335941 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 13001319 TAATGTTGGAGTA 13001307 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 13965192 CTAATGTTGGAGT 13965180 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 16983415 CTAATGTTGGAGT 16983403 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 17052011 TGTGCTAATGTTG 17052023 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 19107613 AATGTTGGAGTAG 19107601 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAG 16 ||||||||||||| Sbjct 25355921 GCTAATGTTGGAG 25355909 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 26584784 TGTGCTAATGTTG 26584772 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 26800169 TGTTGGAGTAGCT 26800157 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 27846232 CTAATGTTGGAGT 27846220 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 30590295 TGTTGGAGTAGCT 30590283 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 30596573 TGTTGGAGTAGCT 30596561 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 31797712 TGTTGGAGTAGCT 31797700 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 34492840 TGTGCTAATGTTG 34492828 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 37902096 TGCTAATGTTGGA 37902108 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 39753966 TGTTGGAGTAGCT 39753954 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 42390388 TGTTGGAGTAGCT 42390376 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 45075650 TGTTGGAGTAGCT 45075638 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGGAGT 17 |||| |||||||||||| Sbjct 45456815 TGTG-TAATGTTGGAGT 45456830 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 52444108 TGTTGGAGTAGCT 52444120 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 52444782 TGTTGGAGTAGCT 52444794 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 52488735 TGTTGGAGTAGCT 52488723 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 52496386 TGTTGGAGTAGCT 52496374 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 52502005 TGTTGGAGTAGCT 52502017 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 52512257 TGTTGGAGTAGCT 52512245 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 52513208 TGTTGGAGTAGCT 52513220 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAGTA 18 ||||||||||| |||| Sbjct 52742843 TGCTAATGTTGCAGTA 52742828 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTA 18 |||| ||||||||||| Sbjct 53036190 TGCTCATGTTGGAGTA 53036205 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 1 TGTG-CTAATGTTGGAG 16 |||| |||||||||||| Sbjct 57790377 TGTGCCTAATGTTGGAG 57790361 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAGCTC 22 |||||||||||| ||| Sbjct 60881148 AATGTTGGAGTAACTC 60881133 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAGTAG 19 ||| |||||||||||| Sbjct 64645363 GCTTATGTTGGAGTAG 64645348 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAGCTC 22 |||||||||||| ||| Sbjct 66530350 AATGTTGGAGTACCTC 66530365 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 66547749 TGTTGGAGTAGCT 66547761 Score = 23.3 bits (12), Expect = 230 Identities = 17/19 (89%), Gaps = 2/19 (11%) Strand=Plus/Minus Query 4 GCTAATGTTGGAGTAGCTC 22 ||| ||| ||||||||||| Sbjct 1889313 GCT-ATG-TGGAGTAGCTC 1889297 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 2225897 TGTGCTAATGTT 2225886 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 11 TTGGAGTAGCTC 22 |||||||||||| Sbjct 3668070 TTGGAGTAGCTC 3668081 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGT 17 ||| ||||||||||| Sbjct 4539007 TGCCAATGTTGGAGT 4539021 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGC 20 |||||||||||| Sbjct 5554021 TGTTGGAGTAGC 5554032 >SL4.0ch10 Length=64792705 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGGA 15 |||||||||||||| Sbjct 6748128 GTGCTAATGTTGGA 6748141 Score = 27.0 bits (14), Expect = 18 Identities = 17/18 (94%), Gaps = 1/18 (6%) Strand=Plus/Plus Query 1 TGTGC-TAATGTTGGAGT 17 ||||| |||||||||||| Sbjct 14705412 TGTGCATAATGTTGGAGT 14705429 Score = 27.0 bits (14), Expect = 18 Identities = 19/21 (90%), Gaps = 1/21 (5%) Strand=Plus/Plus Query 3 TGCTAA-TGTTGGAGTAGCTC 22 |||||| | |||||||||||| Sbjct 34530092 TGCTAACTCTTGGAGTAGCTC 34530112 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGTA 18 |||||||||||||| Sbjct 52158062 CTAATGTTGGAGTA 52158049 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAGT 17 |||||||||||||| Sbjct 61921610 GCTAATGTTGGAGT 61921597 Score = 27.0 bits (14), Expect = 18 Identities = 19/21 (90%), Gaps = 1/21 (5%) Strand=Plus/Plus Query 1 TGTG-CTAATGTTGGAGTAGC 20 |||| |||||||||||| ||| Sbjct 63820929 TGTGACTAATGTTGGAGAAGC 63820949 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 2595625 CTAATGTTGGAGT 2595613 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAGCT 21 |||||||||||| ||| Sbjct 5149941 TAATGTTGGAGTGGCT 5149956 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 5872929 AATGTTGGAGTAG 5872941 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 6380612 TGCTAATGTTGGA 6380600 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 6390822 TGCTAATGTTGGA 6390810 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 9724626 TGTGCTAATGTTG 9724638 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 14884583 TGTTGGAGTAGCT 14884571 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 14930978 TGTTGGAGTAGCT 14930966 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 14972591 TGTGCTAATGTTG 14972579 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 23260632 TGTTGGAGTAGCT 23260620 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTA 18 ||||||||||||| Sbjct 23397162 TAATGTTGGAGTA 23397150 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 24336615 TGTGCTAATGTTG 24336627 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 24418822 TGTGCTAATGTTG 24418810 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 25835373 CTAATGTTGGAGT 25835385 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 25844823 CTAATGTTGGAGT 25844835 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 26893569 TGTGCTAATGTTG 26893581 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGAG 16 ||| |||||||||||| Sbjct 27244780 TGTTCTAATGTTGGAG 27244765 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 29244715 CTAATGTTGGAGT 29244703 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAGCTC 22 |||||||||||| ||| Sbjct 30153024 AATGTTGGAGTAACTC 30153039 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 32284255 AATGTTGGAGTAG 32284243 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 32673063 TGTTGGAGTAGCT 32673051 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 32677789 TGTTGGAGTAGCT 32677777 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 34015953 CTAATGTTGGAGT 34015941 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 34218435 TGTGCTAATGTTG 34218423 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 35718901 TGTGCTAATGTTG 35718913 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 40795780 TGTGCTAATGTTG 40795768 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 41508199 TGTGCTAATGTTG 41508187 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 41866293 TGCTAATGTTGGA 41866305 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 46386527 TGTGCTAATGTTG 46386539 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 48739065 TGTTGGAGTAGCT 48739053 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 52249812 TGCTAATGTTGGA 52249800 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAGT 17 ||||||||||||| Sbjct 54403342 CTAATGTTGGAGT 54403354 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGG 14 ||||||||||||| Sbjct 58769208 GTGCTAATGTTGG 58769196 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTG 13 |||||||||||| Sbjct 57329 GTGCTAATGTTG 57318 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGGAG 16 ||| ||||||||||| Sbjct 210050 GTGTTAATGTTGGAG 210036 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGT 17 |||||||||||| Sbjct 2173682 TAATGTTGGAGT 2173693 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 3283591 AATGTTGGAGTA 3283602 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGC 20 |||||||||||| Sbjct 4574837 TGTTGGAGTAGC 4574848 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 4584944 TGTGCTAATGTT 4584955 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGC 20 |||||||||||| Sbjct 4686168 TGTTGGAGTAGC 4686179 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 4698340 TGTGCTAATGTT 4698351 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGTAG 19 ||||||||||| ||| Sbjct 6478752 CTAATGTTGGACTAG 6478738 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGT 17 |||||||||||| Sbjct 7376756 TAATGTTGGAGT 7376767 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 7442277 AATGTTGGAGTA 7442266 >SL4.0ch06 Length=47258699 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAGT 17 |||||||||||||| Sbjct 8310761 GCTAATGTTGGAGT 8310748 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 8 ATGTTGGAGTAGCT 21 |||||||||||||| Sbjct 29584713 ATGTTGGAGTAGCT 29584726 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAG 16 |||||||||||||| Sbjct 37949982 TGCTAATGTTGGAG 37949969 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 1851655 AATGTTGGAGTAG 1851643 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 4244450 TGTGCTAATGTTG 4244438 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGGAGT 17 ||| |||||||||||| Sbjct 6352205 GTGATAATGTTGGAGT 6352220 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAGTAGCT 21 ||||||||||| |||| Sbjct 8562852 TAATGTTGGAGGAGCT 8562837 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGAGTA 18 || ||||||||||||| Sbjct 8589718 TGTTAATGTTGGAGTA 8589733 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 9319040 TGTGCTAATGTTG 9319052 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 13485223 TGTTGGAGTAGCT 13485235 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 13552407 TGCTAATGTTGGA 13552419 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 20576956 TGTTGGAGTAGCT 20576944 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 25652911 TGCTAATGTTGGA 25652899 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 27204371 TGCTAATGTTGGA 27204383 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 27850659 TGTGCTAATGTTG 27850671 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 27854713 TGTTGGAGTAGCT 27854725 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 28068160 TGTTGGAGTAGCT 28068148 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 32618680 AATGTTGGAGTAG 32618692 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 32618724 AATGTTGGAGTAG 32618736 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 41239786 TGTTGGAGTAGCT 41239798 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTGGA 15 ||||||||||||| Sbjct 46227635 TGCTAATGTTGGA 46227647 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 2049530 TGTGCTAATGTT 2049541 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGC 20 |||||||||||| Sbjct 2085044 TGTTGGAGTAGC 2085055 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 4 GCTAATGTTGGAGTA 18 ||| ||||||||||| Sbjct 2751380 GCTCATGTTGGAGTA 2751394 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 3883128 TGTGCTAATGTT 3883117 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 3974255 TGTGCTAATGTT 3974266 Score = 23.3 bits (12), Expect = 230 Identities = 19/22 (86%), Gaps = 2/22 (9%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGAGT-AGCT 21 ||||||||||| ||| | |||| Sbjct 4141158 TGTGCTAATGT-GGAATCAGCT 4141138 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 5149615 AATGTTGGAGTA 5149604 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 5164266 TGTGCTAATGTT 5164277 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 5185910 TGTGCTAATGTT 5185921 Score = 23.3 bits (12), Expect = 230 Identities = 17/19 (89%), Gaps = 1/19 (5%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGAGTAG 19 ||| |||||||||||| || Sbjct 5498881 TGT-CTAATGTTGGAGAAG 5498864 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 5625233 TGTGCTAATGTT 5625244 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 5652590 TGTGCTAATGTT 5652601 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6091184 TGTGCTAATGTT 6091173 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6111444 TGTGCTAATGTT 6111433 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6355015 TGTGCTAATGTT 6355026 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6967669 TGTGCTAATGTT 6967658 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 7161524 TGTGCTAATGTT 7161535 Score = 23.3 bits (12), Expect = 230 Identities = 15/16 (94%), Gaps = 1/16 (6%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGGAG 16 ||| |||||||||||| Sbjct 7578669 TGT-CTAATGTTGGAG 7578683 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 7814824 AATGTTGGAGTA 7814835 Score = 23.3 bits (12), Expect = 230 Identities = 17/19 (89%), Gaps = 1/19 (5%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGGAGTAG 19 ||| |||||||||||| || Sbjct 8373413 TGT-CTAATGTTGGAGAAG 8373396 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 8764250 TGTGCTAATGTT 8764239 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAGCTC 22 ||||||||||| ||| Sbjct 9195820 ATGTTGGAGTATCTC 9195806 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 5 CTAATGTTGGAG 16 |||||||||||| Sbjct 9461362 CTAATGTTGGAG 9461373 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 9675613 TGTGCTAATGTT 9675602 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 11871976 TGTGCTAATGTT 11871965 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 11961792 TGTGCTAATGTT 11961803 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTG 13 |||||||||||| Sbjct 11974942 GTGCTAATGTTG 11974953 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 12869981 TGTGCTAATGTT 12869970 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 13449978 TGTGCTAATGTT 13449967 >SL4.0ch04 Length=64459972 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGG 14 |||||||||||||| Sbjct 4467204 TGTGCTAATGTTGG 4467217 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTGG 14 |||||||||||||| Sbjct 7150289 TGTGCTAATGTTGG 7150276 Score = 27.0 bits (14), Expect = 18 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGGAGTAGCTC 22 |||| |||||||||||| || Sbjct 44504754 TGCTGATGTTGGAGTAGATC 44504735 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAG 16 ||||||||||||| Sbjct 2285922 GCTAATGTTGGAG 2285910 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 7129630 TGTTGGAGTAGCT 7129618 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 7943799 TGTTGGAGTAGCT 7943811 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 10266775 TGTGCTAATGTTG 10266763 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 13639483 TGTGCTAATGTTG 13639471 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 13910203 TGTGCTAATGTTG 13910191 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 18048605 TGTGCTAATGTTG 18048617 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 23949992 TGTGCTAATGTTG 23950004 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 23981306 TGTGCTAATGTTG 23981318 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 25802146 TGTGCTAATGTTG 25802134 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAGTAG 19 ||||||||||| |||| Sbjct 29283912 GCTAATGTTGGTGTAG 29283897 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 30470032 TGTGCTAATGTTG 30470020 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Minus Query 5 CTAATGTTGGAGTAGC 20 ||| |||||||||||| Sbjct 31481501 CTATTGTTGGAGTAGC 31481486 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 35651580 TGTGCTAATGTTG 35651592 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 3 TGCTAATGTTG-GAGTA 18 ||||||||||| ||||| Sbjct 36131732 TGCTAATGTTGAGAGTA 36131748 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Plus Query 3 TGCTAATGTTG-GAGTA 18 ||||||||||| ||||| Sbjct 36159962 TGCTAATGTTGTGAGTA 36159978 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 38727868 TGTGCTAATGTTG 38727880 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 GCTAATGTTGGAG 16 ||||||||||||| Sbjct 38742560 GCTAATGTTGGAG 38742548 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 40800403 TGTGCTAATGTTG 40800391 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 45510640 AATGTTGGAGTAG 45510652 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 47159611 TGTTGGAGTAGCT 47159623 Score = 25.1 bits (13), Expect = 64 Identities = 16/17 (94%), Gaps = 1/17 (6%) Strand=Plus/Minus Query 6 TAA-TGTTGGAGTAGCT 21 ||| ||||||||||||| Sbjct 49300010 TAATTGTTGGAGTAGCT 49299994 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 50312275 AATGTTGGAGTAG 50312287 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 50312319 AATGTTGGAGTAG 50312331 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 51079488 TGTGCTAATGTTG 51079476 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTAG 19 ||||||||||||| Sbjct 54096301 AATGTTGGAGTAG 54096313 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 56866413 TGTGCTAATGTTG 56866401 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 61723315 TGTGCTAATGTTG 61723327 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTG 13 |||||||||||| Sbjct 778363 GTGCTAATGTTG 778352 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTGG 14 |||||||||||| Sbjct 927192 TGCTAATGTTGG 927181 Score = 23.3 bits (12), Expect = 230 Identities = 15/16 (94%), Gaps = 1/16 (6%) Strand=Plus/Minus Query 7 AATGTTGGAGTAGCTC 22 |||||||||||| ||| Sbjct 1028985 AATGTTGGAGTA-CTC 1028971 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTG 13 |||||||||||| Sbjct 2328044 GTGCTAATGTTG 2328055 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAG 19 |||||||||||| Sbjct 2420728 ATGTTGGAGTAG 2420717 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AATGTTGGAGTA 18 |||||||||||| Sbjct 2464073 AATGTTGGAGTA 2464084 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGCT 21 |||||||||||| Sbjct 3622980 GTTGGAGTAGCT 3622991 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 8 ATGTTGGAGTAG 19 |||||||||||| Sbjct 4111135 ATGTTGGAGTAG 4111146 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 8 ATGTTGGAGTAG 19 |||||||||||| Sbjct 4412174 ATGTTGGAGTAG 4412185 Score = 23.3 bits (12), Expect = 230 Identities = 16/18 (89%), Gaps = 0/18 (0%) Strand=Plus/Minus Query 2 GTGCTAATGTTGGAGTAG 19 ||||| ||||||||||| Sbjct 4947890 GTGCTGGTGTTGGAGTAG 4947873 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTG 13 |||||||||||| Sbjct 5999504 GTGCTAATGTTG 5999515 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6296644 TGTGCTAATGTT 6296633 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6299199 TGTGCTAATGTT 6299188 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6322956 TGTGCTAATGTT 6322945 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6346093 TGTGCTAATGTT 6346082 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6358615 TGTGCTAATGTT 6358604 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6382710 TGTGCTAATGTT 6382699 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6384980 TGTGCTAATGTT 6384969 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 6410846 TGTGCTAATGTT 6410835 >SL4.0ch00 Length=9643250 Score = 27.0 bits (14), Expect = 18 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTAGCT 21 |||||||||||||| Sbjct 2147779 ATGTTGGAGTAGCT 2147766 Score = 27.0 bits (14), Expect = 18 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGGAGTA 18 ||| ||||||||||||| Sbjct 3605847 GTGATAATGTTGGAGTA 3605863 Score = 27.0 bits (14), Expect = 18 Identities = 18/20 (90%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 2 GTGCTAATGTTGGAGTAGCT 21 || || |||||||||||||| Sbjct 3619178 GTACTGATGTTGGAGTAGCT 3619197 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTTG 13 ||||||||||||| Sbjct 1282704 TGTGCTAATGTTG 1282716 Score = 25.1 bits (13), Expect = 64 Identities = 15/16 (94%), Gaps = 0/16 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAGTAGCT 21 || ||||||||||||| Sbjct 3626743 TATTGTTGGAGTAGCT 3626758 Score = 25.1 bits (13), Expect = 64 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 9 TGTTGGAGTAGCT 21 ||||||||||||| Sbjct 8618316 TGTTGGAGTAGCT 8618328 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 252574 TGTGCTAATGTT 252585 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 10 GTTGGAGTAGCT 21 |||||||||||| Sbjct 1802444 GTTGGAGTAGCT 1802433 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 10 GTTGGAGTAGCT 21 |||||||||||| Sbjct 1922330 GTTGGAGTAGCT 1922319 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAGCT 21 ||| ||||||||||| Sbjct 2162411 AATATTGGAGTAGCT 2162397 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAGCT 21 ||| ||||||||||| Sbjct 2195582 AATATTGGAGTAGCT 2195568 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 2847633 TGTGCTAATGTT 2847622 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGCT 21 |||||||||||| Sbjct 4032449 GTTGGAGTAGCT 4032460 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 4804153 TGTGCTAATGTT 4804164 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAGCT 21 ||| ||||||||||| Sbjct 5245456 AATATTGGAGTAGCT 5245442 Score = 23.3 bits (12), Expect = 230 Identities = 14/15 (93%), Gaps = 0/15 (0%) Strand=Plus/Minus Query 7 AATGTTGGAGTAGCT 21 ||| ||||||||||| Sbjct 8147600 AATATTGGAGTAGCT 8147586 Score = 23.3 bits (12), Expect = 230 Identities = 15/16 (94%), Gaps = 1/16 (6%) Strand=Plus/Plus Query 1 TGTGCTAATGTTGGAG 16 ||| |||||||||||| Sbjct 8994940 TGT-CTAATGTTGGAG 8994954 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 TGTGCTAATGTT 12 |||||||||||| Sbjct 9001751 TGTGCTAATGTT 9001762 Score = 23.3 bits (12), Expect = 230 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 11 TTGGAGTAGCTC 22 |||||||||||| Sbjct 9230826 TTGGAGTAGCTC 9230815 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 3799 TGCTAATGTTG 3789 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 73868 TGCTAATGTTG 73878 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 149611 TGCTAATGTTG 149601 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 235555 TGCTAATGTTG 235565 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAG 16 ||||||||||| Sbjct 320330 TAATGTTGGAG 320340 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 336230 TGCTAATGTTG 336220 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 379768 TGCTAATGTTG 379758 Score = 21.4 bits (11), Expect = 829 Identities = 14/15 (93%), Gaps = 1/15 (7%) Strand=Plus/Plus Query 7 AAT-GTTGGAGTAGC 20 ||| ||||||||||| Sbjct 427935 AATAGTTGGAGTAGC 427949 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 6 TAATGTTGGAG 16 ||||||||||| Sbjct 653096 TAATGTTGGAG 653106 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 1155886 TGCTAATGTTG 1155896 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 1186338 TGCTAATGTTG 1186348 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 1219248 TGCTAATGTTG 1219238 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 1250508 TGCTAATGTTG 1250498 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 1340628 TGCTAATGTTG 1340638 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 11 TTGGAGTAGCT 21 ||||||||||| Sbjct 1672054 TTGGAGTAGCT 1672064 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGC 20 ||||||||||| Sbjct 2623315 GTTGGAGTAGC 2623325 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 11 TTGGAGTAGCT 21 ||||||||||| Sbjct 2702503 TTGGAGTAGCT 2702513 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 2758080 TGCTAATGTTG 2758090 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 2794127 TGCTAATGTTG 2794137 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 3 TGCTAATGTTG 13 ||||||||||| Sbjct 2836445 TGCTAATGTTG 2836435 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAG 16 ||||||||||| Sbjct 2959453 TAATGTTGGAG 2959443 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTA 18 ||||||||||| Sbjct 3222643 ATGTTGGAGTA 3222633 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGC 20 ||||||||||| Sbjct 3232923 GTTGGAGTAGC 3232933 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTA 18 ||||||||||| Sbjct 3238649 ATGTTGGAGTA 3238639 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGC 20 ||||||||||| Sbjct 3251753 GTTGGAGTAGC 3251763 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTA 18 ||||||||||| Sbjct 3257314 ATGTTGGAGTA 3257304 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGC 20 ||||||||||| Sbjct 3263297 GTTGGAGTAGC 3263307 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 8 ATGTTGGAGTA 18 ||||||||||| Sbjct 3269023 ATGTTGGAGTA 3269013 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGC 20 ||||||||||| Sbjct 3279327 GTTGGAGTAGC 3279337 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Minus Query 6 TAATGTTGGAG 16 ||||||||||| Sbjct 3304355 TAATGTTGGAG 3304345 Score = 21.4 bits (11), Expect = 829 Identities = 11/11 (100%), Gaps = 0/11 (0%) Strand=Plus/Plus Query 10 GTTGGAGTAGC 20 ||||||||||| Sbjct 3309614 GTTGGAGTAGC 3309624 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 2347559358 Database: Tomato genome chromosomes (Build SL4.0) Posted date: Mar 21, 2024 4:17 PM Number of letters in database: 782,520,033 Number of sequences in database: 13 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5