BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: N.benthamiana Genome v1.0.1 predicted cDNA 57,140 sequences; 82,582,885 total letters Query= Untitled_sequence Length=2208 Score E Sequences producing significant alignments: (Bits) Value Niben101Scf06909g04005.1sp|Q9LIG2|RLK6_ARATH *-** Receptor-like p... 97.1 1e-18 >Niben101Scf06909g04005.1 sp|Q9LIG2|RLK6_ARATH *-** Receptor-like protein kinase IPR000742 (Epidermal growth factor-like domain), IPR011009 (Protein kinase-like domain) GO:0004672 (protein kinase activity), GO:0005509 (calcium ion binding), GO:0005515 (protein binding), GO:0005524 (ATP binding), GO:0006468 (protein phosphorylation), GO:0016772 (transferase activity, transferring phosphorus-containing groups) Length=1899 Score = 97.1 bits (52), Expect = 1e-18 Identities = 104/130 (80%), Gaps = 0/130 (0%) Strand=Plus/Plus Query 1342 GAGCAGTTCATCAATGAAGTGCTCGTGCTTTCACAAATCAACCATAGGAACGTAGTCAAG 1401 ||||| ||||| || ||||| | || || ||||||||||| ||||| || || || ||| Sbjct 1078 GAGCAATTCATAAACGAAGTCATTGTCCTCTCACAAATCAATCATAGAAATGTGGTTAAG 1137 Query 1402 CTCTTGGGCTGCTGTCTAGAGACTGAAGTTCCCTTGTTGGTCTATGAGTTCATCACCAAT 1461 ||||| || || || |||||||| |||||||| || ||||| ||||| |||||| |||| Sbjct 1138 CTCTTAGGTTGTTGCCTAGAGACAGAAGTTCCATTATTGGTGTATGAATTCATCGACAAT 1197 Query 1462 GGCACCCTTT 1471 || || |||| Sbjct 1198 GGAACACTTT 1207 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 176748469005 Database: N.benthamiana Genome v1.0.1 predicted cDNA Posted date: Mar 21, 2024 4:04 PM Number of letters in database: 82,582,885 Number of sequences in database: 57,140 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5