BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Tomato Genome cDNA (ITAG release 2.40) 34,725 sequences; 41,981,568 total letters Query= Untitled_sequence Length=70 Score E Sequences producing significant alignments: (Bits) Value Solyc06g008590.2auxin-regulated IAA10 iaa10 130 1e-30 >Solyc06g008590.2 auxin-regulated IAA10 iaa10 Length=966 Score = 130 bits (70), Expect = 1e-30 Identities = 70/70 (100%), Gaps = 0/70 (0%) Strand=Plus/Plus Query 1 ATGAGTAGTAATAAGTTGGATTTTGAGGAGACAGAATTAAGGCTAGGGTTGCCTGGTGGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 100 ATGAGTAGTAATAAGTTGGATTTTGAGGAGACAGAATTAAGGCTAGGGTTGCCTGGTGGA 159 Query 61 GCAAGAAAAA 70 |||||||||| Sbjct 160 GCAAGAAAAA 169 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 1978445664 Database: Tomato Genome cDNA (ITAG release 2.40) Posted date: Mar 21, 2024 3:33 PM Number of letters in database: 41,981,568 Number of sequences in database: 34,725 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5