BLASTN 2.11.0+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: SL3.0ch00-12.fasta 13 sequences; 828,076,956 total letters Query= Untitled_sequence Length=49 Score E Sequences producing significant alignments: (Bits) Value SL3.0ch04 91.6 5e-18 >SL3.0ch04 Length=66557038 Score = 91.6 bits (49), Expect = 5e-18 Identities = 49/49 (100%), Gaps = 0/49 (0%) Strand=Plus/Minus Query 1 ACAGAAATGGGAGTAAGGATTTCAGAAAGGGGAGACATAGTAAAAGGTG 49 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 39493852 ACAGAAATGGGAGTAAGGATTTCAGAAAGGGGAGACATAGTAAAAGGTG 39493804 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 20701916100 Database: SL3.0ch00-12.fasta Posted date: Feb 21, 2025 12:54 PM Number of letters in database: 828,076,956 Number of sequences in database: 13 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5