<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-01-16 08:30:02"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C04SLm0125H12-qKt3L/GenomeThreader_SGN_U_tomato/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C04SLm0125H12-qKt3L/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_U_tomato" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C04SLm0125H12-qKt3L/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_U_tomato" ref_id="SGN-U335937" ref_strand="+" ref_description="SGN-U335937        Tomato 200607 #1 [1 ESTs aligned] genbank/nr: beta-galactosidase(evalue: 3e-30, score=135)">
      <seq>gatctgtcccaggcttggctaacgtcacagttttagcattacaatccaagattgcaaaatttggagaaagccaagtcatacccagaattacatcaaaatcaaccatttctaagataaccaagtctacataagtattgctccccacaaaagtcaccagaccagacctatatactttttcaactatcacagactcacccaccggagtagaaacacgaataggcatgtcaagcaattcataatttaatttaagaccagtagcaaatgaggaagatacatatgaaaatgtggatccagggtcaaataatacaaaagccatgcaatcacaaaaaaa</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C04SLm0125H12-qKt3L/GenomeThreader_SGN_U_tomato/un_xed_seqs" temp_id="C04SLm0125H12.1" temp_strand="-" temp_description="C04SLm0125H12.1  CU222540.11 htgs_phase:3 submitted_to_sgn_as:C04SLm0125H12 sequenced_by:sanger upload_account_name:uk">
        <position start="84916" stop="84002"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="84615" g_stop="84302" g_length="314"/>
          <reference_exon_boundary r_type="cDNA" r_start="18" r_stop="331" r_length="314" r_score="0.927"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C04SLm0125H12.1" gen_strand="-" ref_id="SGN-U335937" ref_strand="+">
        <total_alignment_score>0.927</total_alignment_score>
        <cumulative_length_of_scored_exons>314</cumulative_length_of_scored_exons>
        <coverage percentage="0.949" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C04SLm0125H12.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-U335937" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="84615" e_stop="84302"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GCCAACGTTATAATTTTAGCATTACAATCTAAGATTGCAAAATTTGGAGACAGCCAAGTCATACCCAGAATTACATCAAAGTCAACCATTTCTAAGATAACCAAGTCTACTTGAGTATTGCTCCCCAAAAAAGTCACAAGACAAGACCTATACACCTTTTCGACTATCACAGACTCACCCACCGTAGTAGAAACACGAATAGGCATGTCAAGCAATTCACAATGTAAATTAAGACCAGTAGCAAATGAGGAAGATACATATGAAAATGTGGATCCAGGGTCAAACAATACAAAAGCCATACAATCACAAACCAA</genome_strand>
        <mrna_strand>GCTAACGTCACAGTTTTAGCATTACAATCCAAGATTGCAAAATTTGGAGAAAGCCAAGTCATACCCAGAATTACATCAAAATCAACCATTTCTAAGATAACCAAGTCTACATAAGTATTGCTCCCCACAAAAGTCACCAGACCAGACCTATATACTTTTTCAACTATCACAGACTCACCCACCGGAGTAGAAACACGAATAGGCATGTCAAGCAATTCATAATTTAATTTAAGACCAGTAGCAAATGAGGAAGATACATATGAAAATGTGGATCCAGGGTCAAATAATACAAAAGCCATGCAATCACAAAAAAA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>1</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="84615" PGL_stop="84302"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="84615" e_stop="84302"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.927"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.927">
            <gDNA_exon_boundary e_start="84615" e_stop="84302" e_length="314"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="84615" stop="84302"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-U335937" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>GCCAACGTTATAATTTTAGCATTACAATCTAAGATTGCAAAATTTGGAGACAGCCAAGTCATACCCAGAATTACATCAAAGTCAACCATTTCTAAGATAACCAAGTCTACTTGAGTATTGCTCCCCAAAAAAGTCACAAGACAAGACCTATACACCTTTTCGACTATCACAGACTCACCCACCGTAGTAGAAACACGAATAGGCATGTCAAGCAATTCACAATGTAAATTAAGACCAGTAGCAAATGAGGAAGATACATATGAAAATGTGGATCCAGGGTCAAACAATACAAAAGCCATACAATCACAAACCAA</gDNA_template>
            <first_frame> A  N  V  I  I  L  A  L  Q  S  K  I  A  K  F  G  D  S  Q  V  I  P  R  I  T  S  K  S  T  I  S  K  I  T  K  S  T  *  V  L  L  P  K  K  V  T  R  Q  D  L  Y  T  F  S  T  I  T  D  S  P  T  V  V  E  T  R  I  G  M  S  S  N  S  Q  C  K  L  R  P  V  A  N  E  E  D  T  Y  E  N  V  D  P  G  S  N  N  T  K  A  I  Q  S  Q  T   </first_frame>
            <second_frame>  P  T  L  *  F  *  H  Y  N  L  R  L  Q  N  L  E  T  A  K  S  Y  P  E  L  H  Q  S  Q  P  F  L  R  *  P  S  L  L  E  Y  C  S  P  K  K  S  Q  D  K  T  Y  T  P  F  R  L  S  Q  T  H  P  P  *  *  K  H  E  *  A  C  Q  A  I  H  N  V  N  *  D  Q  *  Q  M  R  K  I  H  M  K  M  W  I  Q  G  Q  T  I  Q  K  P  Y  N  H  K  P  </second_frame>
            <third_frame>   Q  R  Y  N  F  S  I  T  I  *  D  C  K  I  W  R  Q  P  S  H  T  Q  N  Y  I  K  V  N  H  F  *  D  N  Q  V  Y  L  S  I  A  P  Q  K  S  H  K  T  R  P  I  H  L  F  D  Y  H  R  L  T  H  R  S  R  N  T  N  R  H  V  K  Q  F  T  M  *  I  K  T  S  S  K  *  G  R  Y  I  *  K  C  G  S  R  V  K  Q  Y  K  S  H  T  I  T  N  Q </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C04SLm0125H12.1" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="84501" stop="84304"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>198</number_coding_nucleotides>
                  <number_encoded_amino_acids>66</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>VLLPKKVTRQDLYTFSTITDSPTVVETRIGMSSNSQCKLRPVANEEDTYENVDPGSNNTKAIQSQT</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 60 chains have been computed
$ 
$ memory statistics:
$ 1528 bytes spliced alignments in total
$ 1 spliced alignments have been stored
$ 1528 bytes was the average size of a spliced alignment
$ 5528 bytes predicted gene locations in total
$ 1 predicted gene locations have been stored
$ 5528 bytes was the average size of a predicted gene location
$ 2 megabytes was the average size of the backtrace matrix
$ 79 backtrace matrices have been allocated
$ 
$ date finished: 2009-01-16 08:31:00
-->
