<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2008-03-22 16:15:53"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E352716" ref_strand="+" ref_description="SGN-E352716 [cTOS-11-H19]">
      <seq>gatctgtcccaggcttggctaacgtcacagttttagcattacaatccaagattgcaaaatttggagaaagccaagtcatacccagaattacatcaaaatcaaccatttctaagataaccaagtctacataagtattgctccccacaaaagtcaccagaccagacctatatactttttcaactatcacagactcacccaccggagtagaaacacgaataggcatgtcaagcaattcataatttaatttaagaccagtagcaaatgaggaagatacatatgaaaatgtggatccagggtcaaataatacaaaagccatgcaatcacaaaaaaa</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="-" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="2523" stop="1599"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="2223" g_stop="1895" g_length="329"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="331" r_length="331" r_score="0.909"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="-" ref_id="SGN-E352716" ref_strand="+">
        <total_alignment_score>0.909</total_alignment_score>
        <cumulative_length_of_scored_exons>329</cumulative_length_of_scored_exons>
        <coverage percentage="0.994" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-E352716" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="2223" e_stop="1895"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GATCTGTCCCAGGCTTGGCTAACGTCACAGTTTTAGCATTACAATCCAAAATTGCAAAAATTGGGGAAAACCCAATCATACCTAGAA-TACATCAAAGTCAACCATTTCTAAGAT-ACCCAGTCTACATAAGTATTGCTCTCCATAAAAGTCACAGGACAAGACCTATACACCTTCTCAACTATCACAGACTCACCCACCGGAGTAGANACACGAATAGGCATGTCAAGCAATTCACAATTTAATTTAAGACCACTAGCAAATGAGGAAGATACATATGAAAATGTGTATCCAGGGTCAAATAATACAAAGCCAATGCAATCACAAACCGA</genome_strand>
        <mrna_strand>GATCTGTCCCAGGCTTGGCTAACGTCACAGTTTTAGCATTACAATCCAAGATTGCAAAATTTGGAGAAAGCCAAGTCATACCCAGAATTACATCAAAATCAACCATTTCTAAGATAACCAAGTCTACATAAGTATTGCTCCCCACAAAAGTCACCAGACCAGACCTATATACTTTTTCAACTATCACAGACTCACCCACCGGAGTAGAAACACGAATAGGCATGTCAAGCAATTCATAATTTAATTTAAGACCAGTAGCAAATGAGGAAGATACATATGAAAATGTGGATCCAGGGTCAAATAATACAAAAGCCATGCAATCACAAAAAAA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E343544" ref_strand="+" ref_description="SGN-E343544 [cTOF-19-D13]">
      <seq>atattatataaaaaaataataaaataaaaagaccatatagaccaaaaagaaaaatattccaatgtacttgttataattgcggaaagataggacatttagctagagattgtaaactacccaaagatccgaaaatgaagcaaattgcagaagtaattatagataatcataaatatatgcaaatagaatacatagactatgaattaagtgaagacgatagtatatatgaagtatcagatatagaaactgaaaatgaagaagaaaatattaatctagataataatgaaacagatgaagaaatataatgtctgaagatgagataaaaataatatctaaagaagattatcaaaatgaagaattatcagactaaaaaattatatttgataatacaatttttgaacaaataaaaggaaaagaattagacttaagtgttgaaaaagtacttgaaatacctactctatgaaattggtttaaaagacaaaaagaagaatattatgtagttagtcaaaaagaacatattatagattgtaaatatgcaagaggaaaaacatatatacctatactaagtaaacgaataataaataaagaaatacaagatataaaagctaaaacaccaataaaatatgtacatttaggaggaacagaaatattaataaaagcttgttttagagaaggaatagatacacctattgaaatatacttagcagatgatagaattatacaccctatagaaaaaagtgtaattagtgcagtaaaaggaaactta</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="+" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="3819" stop="5179"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="4118" g_stop="4879" g_length="762"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="763" r_length="763" r_score="0.909"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="+" ref_id="SGN-E343544" ref_strand="+">
        <total_alignment_score>0.909</total_alignment_score>
        <cumulative_length_of_scored_exons>762</cumulative_length_of_scored_exons>
        <coverage percentage="0.999" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E343544" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="4118" e_stop="4879"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GTATTATGTA-AAAAATCATAAAATAAAAAGACCATACAGACCAAAAAGAAAAATATCCCAATGTACTTGTTATAATTGTGGAAAGATAGGACACATAGCTAAAGATTGTAAATTACCCAAAAATCCAAAAAGAAAACAAATAGCAGAATTAATAATAGACAATGAAAAATATATGCAAATAGAGTACATAGATTATGAATTAAGTGAAAATGATAGTATATATGAAGTATCAGACATAGAAACTGAGAATGAAGAAGAAAATATTAACATAGATAATAACGAAACAGATGAAGAAATATAATGTCTGAAAATGAAATAAAAATAATATCTAAGGAAGAATATCAAGATGAAGAATCATCAGAACAGAAAATTATATTTGATAATACGATATTTGAACAAATAAAAGGAAAAGAATTAGATTTAAGTGTTGAAAAAGTACTAGAAATACCTATTTTAAGAAATTGGTTTAAAAGACAAAAAGAAGAATACTATTTAGTTAGTAAAAAAGAACATATCATAGATTGTAAATACACAAGAGGAAAAACATATATACCTATAATAAATAAAAGAATGATAAACAAAGAAATACAAGATATAAAAGCTAAAACACCAATAAAATATGTACATTTAGGAGGAATAGAGATATTAATAAAAGCCTGCTTTAGAGAAGGAATAGATACACCTATAAAAATATATTTAGCAGATGATAGAATTGTACACCCTATAGAAAAAAGCATAATTAGTGCAGTAAAAGGAAACTTA</genome_strand>
        <mrna_strand>ATATTATATAAAAAAATAATAAAATAAAAAGACCATATAGACCAAAAAGAAAAATATTCCAATGTACTTGTTATAATTGCGGAAAGATAGGACATTTAGCTAGAGATTGTAAACTACCCAAAGATCCGAAAATGAAGCAAATTGCAGAAGTAATTATAGATAATCATAAATATATGCAAATAGAATACATAGACTATGAATTAAGTGAAGACGATAGTATATATGAAGTATCAGATATAGAAACTGAAAATGAAGAAGAAAATATTAATCTAGATAATAATGAAACAGATGAAGAAATATAATGTCTGAAGATGAGATAAAAATAATATCTAAAGAAGATTATCAAAATGAAGAATTATCAGACTAAAAAATTATATTTGATAATACAATTTTTGAACAAATAAAAGGAAAAGAATTAGACTTAAGTGTTGAAAAAGTACTTGAAATACCTACTCTATGAAATTGGTTTAAAAGACAAAAAGAAGAATATTATGTAGTTAGTCAAAAAGAACATATTATAGATTGTAAATATGCAAGAGGAAAAACATATATACCTATACTAAGTAAACGAATAATAAATAAAGAAATACAAGATATAAAAGCTAAAACACCAATAAAATATGTACATTTAGGAGGAACAGAAATATTAATAAAAGCTTGTTTTAGAGAAGGAATAGATACACCTATTGAAATATACTTAGCAGATGATAGAATTATACACCCTATAGAAAAAAGTGTAATTAGTGCAGTAAAAGGAAACTTA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E745033" ref_strand="+" ref_description="SGN-E745033 [GI|82754258]">
      <seq>tataaaaatgcggagctacgtcgttcggcagacgaaaaacagccagagctaaaagaagacgttgggaaactccttaaaacccatgacattactgatgctgcaggtacaagcaaaaaagctatggagaaacctacaccaaaaaacataaacctaaatagcatatttaccaaaccatttactccaaagatacagatagtagatgcttcaacaccacaaacatctacctatgcaactagcctgcataaagagaagaaaacatacaaccatatagcccgaacatatattgaaaacctatacaaaatacaaaactttttaaatcaaaaacccaaatctaccacaacttagaaaaaacccaagactacctaacccaaaaactacaaggctataacaagttaattgcacaaccaaaaactaatccaaacctagttaaaacttgttataactatggattattaaatacagtctatacatatacaggtgaagagataagtggaatcccagaggtccacaaagcatttttaatatataaaaagataacaaaaggaaacttatttttcataagattctacacagcaccagcagagatactctatgatgaaataaagccaatgattcagatagtcaaaattgggctaacacgagaaatgataatcccagaagatagaggccaacagccagagataacaagagttgagatacccagtttctatgccaataaaaggataattggattatcaactattatacaagagctagcaaataactatctacaaggcaacgccatat</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="-" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="10786" stop="9400"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="10486" g_stop="9700" g_length="787"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="786" r_length="786" r_score="0.987"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="-" ref_id="SGN-E745033" ref_strand="+">
        <total_alignment_score>0.987</total_alignment_score>
        <cumulative_length_of_scored_exons>787</cumulative_length_of_scored_exons>
        <coverage percentage="1.001" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-E745033" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="10486" e_stop="9700"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>TATAAAAATGCGGAGCTACGTCGTTCGGCAGACGAAAAACAGCAAGAGCTAAAAGGAGACGTTGGGAAACTCCTTAAAACCCATGACATTACTGATGCTGCAGGTACAAGCAAAAAAGCTATGGAGAAACCTACACCAAAAAACATAAACCTAAATAGCATATTTACCAAACCATTTACTCCAAAGATACAGATAGTAGATGCTTCAACACCACAAACATCTACCTATGCAACTAGCCTGCATAAAGAGAAGAAAACATACAACCATATATCCCGAACATATATTGAAAACCTATACAAAATACAAAATTTTTTAAATCAAAAACCCAAATCTACCACAACATTAGAAAAAACCCAAGACTACCTAACCCAAAAACTACAAGGCTATAACAAGTTAATTGCACAACCAAAAACTAATCCAAACCTAGTTAAAACTTGTTATAACTATGGATTATTAAATACAGTCTATACATATACAGGTGAAGAGATAAGTGGAATCCCAGAGGTCCACAAAGCATTTTTAATATATAAAAAGATAACAAAAGGAAACTTATTTTTCATAAGATTCTACACAGCACCAGCAGAGATACTCTATGATGAAATAAAGCCAATGATCCAGCTAGTCAAAATTGGGCTAACACGAGAAATGATAATCCCAGAAGATATAGGCCAACAGCCAGAGATAACAAGAGTTGAGATACCCAGTTTTTATGCCAATAAAAGGATAATTGGATTATCAACTATTATACAAGAGCTAGTAAATAACTATCTACAAGGCAACGCCATAT</genome_strand>
        <mrna_strand>TATAAAAATGCGGAGCTACGTCGTTCGGCAGACGAAAAACAGCCAGAGCTAAAAGAAGACGTTGGGAAACTCCTTAAAACCCATGACATTACTGATGCTGCAGGTACAAGCAAAAAAGCTATGGAGAAACCTACACCAAAAAACATAAACCTAAATAGCATATTTACCAAACCATTTACTCCAAAGATACAGATAGTAGATGCTTCAACACCACAAACATCTACCTATGCAACTAGCCTGCATAAAGAGAAGAAAACATACAACCATATAGCCCGAACATATATTGAAAACCTATACAAAATACAAAACTTTTTAAATCAAAAACCCAAATCTACCACAAC-TTAGAAAAAACCCAAGACTACCTAACCCAAAAACTACAAGGCTATAACAAGTTAATTGCACAACCAAAAACTAATCCAAACCTAGTTAAAACTTGTTATAACTATGGATTATTAAATACAGTCTATACATATACAGGTGAAGAGATAAGTGGAATCCCAGAGGTCCACAAAGCATTTTTAATATATAAAAAGATAACAAAAGGAAACTTATTTTTCATAAGATTCTACACAGCACCAGCAGAGATACTCTATGATGAAATAAAGCCAATGATTCAGATAGTCAAAATTGGGCTAACACGAGAAATGATAATCCCAGAAGATAGAGGCCAACAGCCAGAGATAACAAGAGTTGAGATACCCAGTTTCTATGCCAATAAAAGGATAATTGGATTATCAACTATTATACAAGAGCTAGCAAATAACTATCTACAAGGCAACGCCATAT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E351886" ref_strand="+" ref_description="SGN-E351886 [cTOS-8-D9]">
      <seq>ggaaatgtgtggtttttctttgaaaaagaatataccaaccacaatgtacgaagataatgctgcatgtatagctcaattgaaaggaggatacatcaaaggagaccggacaaagcatatctcaccaaagttctttttcacgcatgatcttcaacaaaatggtgagatagaagttcaacaaattcgttcaagtgataatcttgctgatttattcacaaaggcattgccaacatcaacgtttgagaagttgagatacaagattggaatgcgccgtctccaagatatcaagtaaagttttcatcagggggagtgaaatacgcgttgtactcttttccttaactatgggtttgtcccaagttgggttttcctggtaagggttttaat</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="+" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="28817" stop="29759"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="29117" g_stop="29500" g_length="384"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="381" r_length="381" r_score="0.909"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="+" ref_id="SGN-E351886" ref_strand="+">
        <total_alignment_score>0.909</total_alignment_score>
        <cumulative_length_of_scored_exons>384</cumulative_length_of_scored_exons>
        <coverage percentage="1.008" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E351886" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="29117" e_stop="29500"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GGAAATGTGTGGTTTTTCTTTGGAAAAAGAATATATCAACCACAATATACGAAGATAATGTCGCATGTATAGCCCAATTGAAAGGAGGATACATCAAAGGAGACTGGACAAAACATATTTCACCAAAATTCTTTTTCACTCATGATCTTCAACAAAATGGTGAGATGGAAGTTCAACAAATCCGTTCAAGTGATAATCTTGCTGATTTATTCACTTAGGCATTGCCAACATCAACGTTTGAGAAGTTGAGATACAAGATTGGAATGTGCACCGTCTTCGAGATATCAAGTGAAGCTTTCATCAGGGTGAGTGAAATACGTGTTGTGCTGTTTTTCTTCACTATAATTTTTTCCCAAGTTGAGTTTTCCTGGTAAGAATTTTAAT</genome_strand>
        <mrna_strand>GGAAATGTGTGGTTTTTCTTT-GAAAAAGAATATACCAACCACAATGTACGAAGATAATGCTGCATGTATAGCTCAATTGAAAGGAGGATACATCAAAGGAGACCGGACAAAGCATATCTCACCAAAGTTCTTTTTCACGCATGATCTTCAACAAAATGGTGAGATAGAAGTTCAACAAATTCGTTCAAGTGATAATCTTGCTGATTTATTCACAAAGGCATTGCCAACATCAACGTTTGAGAAGTTGAGATACAAGATTGGAA--TGCGCCGTCTCCAAGATATCAAGTAAAGTTTTCATCAGGGGGAGTGAAATACGCGTTGTACTCTTTTCCTTAACTATGGGTTTGTCCCAAGTTGGGTTTTCCTGGTAAGGGTTTTAAT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E577887" ref_strand="+" ref_description="SGN-E577887 [LE08AH11]">
      <seq>ttgggtcggagcaccctctctagtacgagagtcatgtggtgtggtagtcgcaccaccaccctgataaaagccctctagaacacttaacaccctaaaaagtgtatcctgaagcaaaggtgtgactacaggatctggaggaacctggtcacctctgccatcaatttgaggttttgtagagacctctctagcacgacctctcactggtgctgctccacgtccacgacctctagctactatcgtactactagaacgacatctagctcgagacctacccctacccataactggggcctcaacaactgc</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="-" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="35329" stop="34429"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="35029" g_stop="34729" g_length="301"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="303" r_length="303" r_score="0.900"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="-" ref_id="SGN-E577887" ref_strand="+">
        <total_alignment_score>0.900</total_alignment_score>
        <cumulative_length_of_scored_exons>301</cumulative_length_of_scored_exons>
        <coverage percentage="0.993" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-E577887" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="35029" e_stop="34729"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>TTGGGTCTGAGCCCCCTCTCTAGTACGAGAGTCATGTGGTGTGGTAGTCGCACCACCACCCTGAGAAAA-TCC-CTATCACACTTAACACCCTCAATAGTGTATCCTGAAGCAAAGGTGTGACTACAGGATATGGAGGAACCTGGTCCTCCCTGCTATCAATCTAAGGTTCTGCAGAGACCTCTTTAGCAGGACCTCTCACTGGTGCTGCTCCACGTCCACGACCTCTGGCTACTGTCGTACTACTAGCACGACCTCTAGCTCGAGATCTACCCCTACCCCTAGCTGGGGCCTCAACAACTGC</genome_strand>
        <mrna_strand>TTGGGTCGGAGCACCCTCTCTAGTACGAGAGTCATGTGGTGTGGTAGTCGCACCACCACCCTGATAAAAGCCCTCTAGAACACTTAACACCCTAAAAAGTGTATCCTGAAGCAAAGGTGTGACTACAGGATCTGGAGGAACCTGGTCACCTCTGCCATCAATTTGAGGTTTTGTAGAGACCTCTCTAGCACGACCTCTCACTGGTGCTGCTCCACGTCCACGACCTCTAGCTACTATCGTACTACTAGAACGACATCTAGCTCGAGACCTACCCCTACCCATAACTGGGGCCTCAACAACTGC</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E279140" ref_strand="+" ref_description="SGN-E279140 [cLEL-4-H21]">
      <seq>gcacgagttgagagtctgagacaggatggtttatcggttacagagtgtaaggcgcgtttttgccagttgtctaggcatgcgttggccattattccaaatgaaacagagaggatccgtagatttgtgaggggattgactttctctatcaggtcagctgtgtttcggacatctaggggggacttctttccagtctattgtgagcgccgccaaagaggcagaattgatggagagagaggagtttggggaccctaaaagagctcgtatatcaggtcaatttcagggtgcctcatctggaggtaggggatcacagagagtgagtggttcttttcagcagcggggacctattcatgcatctatgccgacatttgagggtggccagacatctaagggttcttatggcccgggtcatggctcgtacggttcac</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="+" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="35148" stop="36176"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="35448" g_stop="35876" g_length="429"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="425" r_length="425" r_score="0.932"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="+" ref_id="SGN-E279140" ref_strand="+">
        <total_alignment_score>0.932</total_alignment_score>
        <cumulative_length_of_scored_exons>429</cumulative_length_of_scored_exons>
        <coverage percentage="1.009" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E279140" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="35448" e_stop="35876"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>GCTTGAGGTTTGAGAGTCTGAGACAGGATGGTTTATCGGTTATAGAGTATGAGGCGCATTTTTGCCAGTTGACTAGGCATGCGTTAGCCATTATTCCAAATGAGACAGAGAGGATCCACAGATTTGTGAGGGGATTGACTTTCTTTATTAGGTCAGCTGTGTTTCGAACATCTAGGGAGGGGACTTCTTTCCAGTCCATTGTGAGCGCCGCCAAAGAGGCGGAATTGATGGAGAGAGAGGAGTTTGGGAACCCTAAAAAAGCTCGTATATCAGGTCAGTTTCAGGGTGCCTCATCTGGAGGTAGGGGATCACAAAGAGTGAGTGGTTCTTTTCAGCAGCTGGGACCTATTCATGCATCTATGCCGACATTTGAGGGTGGCCAGACATCTAGGGGTTCTTACGGCCCAGGTCAGGGCTCGTACGGTTCAC</genome_strand>
        <mrna_strand>GCACGAG-T-TGAGAGTCTGAGACAGGATGGTTTATCGGTTACAGAGTGTAAGGCGCGTTTTTGCCAGTTGTCTAGGCATGCGTTGGCCATTATTCCAAATGAAACAGAGAGGATCCGTAGATTTGTGAGGGGATTGACTTTCTCTATCAGGTCAGCTGTGTTTCGGACATCTA-GG-GGGGACTTCTTTCCAGTCTATTGTGAGCGCCGCCAAAGAGGCAGAATTGATGGAGAGAGAGGAGTTTGGGGACCCTAAAAGAGCTCGTATATCAGGTCAATTTCAGGGTGCCTCATCTGGAGGTAGGGGATCACAGAGAGTGAGTGGTTCTTTTCAGCAGCGGGGACCTATTCATGCATCTATGCCGACATTTGAGGGTGGCCAGACATCTAAGGGTTCTTATGGCCCGGGTCATGGCTCGTACGGTTCAC</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E330288" ref_strand="+" ref_description="SGN-E330288 [cTOD-4-J5]">
      <seq>ttttgtatcatccggggaaggccaatgttgtggccgatgctttgagtaggaagactcatagcatggggagtcttgcatctcttagtgttgaggaaagaccattggctagagatgttcaattgttagctaacagtcttgtccgattacagatctcagaggagagtgatgggatgattgcttttattgaggctcgatcttctttagtcaagcagattcgtgcacaccagtttgatgacgaaaaattatgtctcattcgagacaaagtattgagaggggaagctaaggaggttgtccttgattctgatggtgtcttgaggatcggaggcaggatttgtgtgcccaagacaggcgatttgattagattgatccttgaggaggcccattgttctcgatattctatgcatccgggagaggcgaaaatgtatcatgatctgagtcagcattactggtggtgtgggatgaagagagatattacagactttgttttgaggtgtttgacttgccagttggtcaagtgtgagcaccagtggcctgggggtgtatctcaaaggatgcctattcttacttggacgtgggagtggattacta</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="+" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="37707" stop="38894"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="38007" g_stop="38594" g_length="588"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="588" r_length="588" r_score="0.998"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="+" ref_id="SGN-E330288" ref_strand="+">
        <total_alignment_score>0.998</total_alignment_score>
        <cumulative_length_of_scored_exons>588</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E330288" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="38007" e_stop="38594"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>TTTTGTATCATCCGGGGAAGGCCAATGTTGTGGCCGATGCTTTGAGTAGGAAGACTCATAGCATGGGGAGTCTTGCATCTCTTAGTGTTGAGGAAAGACCATTGGCTAGAGATGTTCAATTGTTAGCTAACAGTCTTGTCCGATTACAGATCTCAGAGGAGAGTGATGGGATGATTGCTTTTATTGAGGCTCGATCTTCTTTAGTCAAGCAGATTCGTGCACACCAGTTTGATGACGAAAAATTATGTCTCATTCGAGACAAAGTATTGAGAGGGGAAGCTAAGGAGGTTGTCCTTGATTCTGATGGTGTCTTGAGGATCGGAGGCAGGATTTGTGTGCCCAAGACAGGCGATTTGATTAGATTGATCCTTGAGGAGGCCCATTGTTCTCGATATTCTATTCATCCGGGAGAGGCGAAAATGTATCATGATCTGAGTCAGCATTACTGGTGGTGTGGGATGAAGAGAGATATTACAGACTTTGTTTTGAGGTGTTTGACTTGCCAGTTGGTCAAGTGTGAGCACCAGTGGCCTGGGGGTGTATCTCAAAGGATGCCTATTCTTACTTGGACGTGGGAGTGGATTACTA</genome_strand>
        <mrna_strand>TTTTGTATCATCCGGGGAAGGCCAATGTTGTGGCCGATGCTTTGAGTAGGAAGACTCATAGCATGGGGAGTCTTGCATCTCTTAGTGTTGAGGAAAGACCATTGGCTAGAGATGTTCAATTGTTAGCTAACAGTCTTGTCCGATTACAGATCTCAGAGGAGAGTGATGGGATGATTGCTTTTATTGAGGCTCGATCTTCTTTAGTCAAGCAGATTCGTGCACACCAGTTTGATGACGAAAAATTATGTCTCATTCGAGACAAAGTATTGAGAGGGGAAGCTAAGGAGGTTGTCCTTGATTCTGATGGTGTCTTGAGGATCGGAGGCAGGATTTGTGTGCCCAAGACAGGCGATTTGATTAGATTGATCCTTGAGGAGGCCCATTGTTCTCGATATTCTATGCATCCGGGAGAGGCGAAAATGTATCATGATCTGAGTCAGCATTACTGGTGGTGTGGGATGAAGAGAGATATTACAGACTTTGTTTTGAGGTGTTTGACTTGCCAGTTGGTCAAGTGTGAGCACCAGTGGCCTGGGGGTGTATCTCAAAGGATGCCTATTCTTACTTGGACGTGGGAGTGGATTACTA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E241790" ref_strand="+" ref_description="SGN-E241790 [cLEE-10-M7]">
      <seq>ataccctccttaaggcttgctatttaagaagggttcactgaggaagaaaatgctttatttcttcttgcggagttagaagcacttgatcaaaagaggttataagcccaacaaaaccttgaatgttatcaagctcgtctatcttgtgcttttaataagaaggtttgcttgaggtgctttcaagttggagatcaagttctctcggtaagaagacccatcattacttcgcacaagtctgggggcaaatttatctcaaagtgggatggaccatatgttgtacaagaagcatattcaaatggtgcttacaagcttgttgatgctgatggcttaaggatcggtcctattaatgccaaattcctaaagagatgctattgttgaagtgagatgatgctccttaaggtacgagcctaaa</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="+" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="51915" stop="52923"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="52215" g_stop="52623" g_length="409"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="409" r_length="409" r_score="0.905"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="+" ref_id="SGN-E241790" ref_strand="+">
        <total_alignment_score>0.905</total_alignment_score>
        <cumulative_length_of_scored_exons>409</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E241790" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="52215" e_stop="52623"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>ATACCTTCCTTAAGACTTGCTACTCAAGAAGGGCTCATTGAGGAAGAAAATGCTCGACTGTGTCTTGCTGAGTTAGAAGCACTTGATGAAAAGAGGCTAGAAGCCCAACAAAACCTTGAATGTTATCAAGCTCGTCTATCTCATGCTTTGAATAAGAAGGTTCGCTTGAGGTGTTTTCAAGTTGGAGACCAAGTTCTCACGGTAAGAAGACCCATCATTACTTCGCACAAGTCTGGGGGCAAATTTACCTCAACGTGGGATGGAGCATATGTCTTACAAGAAGCATACTCAAATGGTGCTTACAAGCTTTTTGATTCTGATGGCTTAAGGATCGGTCCTATTAATGTCAAATTCCTAAAGAGGTACTACCCATGAAGTAAGATGATGCTCCTTAAGGTACGAGCCTAAA</genome_strand>
        <mrna_strand>ATACCCTCCTTAAGGCTTGCTATTTAAGAAGGGTTCACTGAGGAAGAAAATGCTTTATTTCTTCTTGCGGAGTTAGAAGCACTTGATCAAAAGAGGTTATAAGCCCAACAAAACCTTGAATGTTATCAAGCTCGTCTATCTTGTGCTTTTAATAAGAAGGTTTGCTTGAGGTGCTTTCAAGTTGGAGATCAAGTTCTCTCGGTAAGAAGACCCATCATTACTTCGCACAAGTCTGGGGGCAAATTTATCTCAAAGTGGGATGGACCATATGTTGTACAAGAAGCATATTCAAATGGTGCTTACAAGCTTGTTGATGCTGATGGCTTAAGGATCGGTCCTATTAATGCCAAATTCCTAAAGAGATGCTATTGTTGAAGTGAGATGATGCTCCTTAAGGTACGAGCCTAAA</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E745040" ref_strand="+" ref_description="SGN-E745040 [GI|83833846]">
      <seq>aaaatctcttgttaattataatttttaatcatgtttgaataatgttataataaccatctttagaaagtttgctacagaaatattcttcgaataagtatgtccagactatgccatcctaaggttgaaaccggtaggcagagaagg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="+" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="63284" stop="64027"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="63584" g_stop="63727" g_length="144"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="144" r_length="144" r_score="0.972"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="+" ref_id="SGN-E745040" ref_strand="+">
        <total_alignment_score>0.972</total_alignment_score>
        <cumulative_length_of_scored_exons>144</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E745040" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="63584" e_stop="63727"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAAATCTCTTGTTAATTATAATTGTTTATCATGTTTGAACAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGCCCAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</genome_strand>
        <mrna_strand>AAAATCTCTTGTTAATTATAATTTTTAATCATGTTTGAATAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGTCCAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E745037" ref_strand="+" ref_description="SGN-E745037 [GI|83833849]">
      <seq>aaaatctcttgttaattataattgtttatcatgtttgaataatgttataataaccatctttagaaagtttgctacagaaatattcttcgaataagtatgcctagactatgccatcctaaggttgaaaccggtaggcagagaagg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="+" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="63284" stop="64027"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="63584" g_stop="63727" g_length="144"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="144" r_length="144" r_score="0.986"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="+" ref_id="SGN-E745037" ref_strand="+">
        <total_alignment_score>0.986</total_alignment_score>
        <cumulative_length_of_scored_exons>144</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E745037" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="63584" e_stop="63727"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAAATCTCTTGTTAATTATAATTGTTTATCATGTTTGAACAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGCCCAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</genome_strand>
        <mrna_strand>AAAATCTCTTGTTAATTATAATTGTTTATCATGTTTGAATAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGCCTAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E745038" ref_strand="+" ref_description="SGN-E745038 [GI|83833848]">
      <seq>aaaatctcttgttaattataattgtttatcatgtttgaataatgttataataaccatctttagaaagtttgctacagaaatattcttcgaataagtatgcccagactatgccatcctaaggttgaaaccggtaggcagagaagg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="+" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="63284" stop="64027"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="63584" g_stop="63727" g_length="144"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="144" r_length="144" r_score="0.993"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="+" ref_id="SGN-E745038" ref_strand="+">
        <total_alignment_score>0.993</total_alignment_score>
        <cumulative_length_of_scored_exons>144</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E745038" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="63584" e_stop="63727"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAAATCTCTTGTTAATTATAATTGTTTATCATGTTTGAACAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGCCCAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</genome_strand>
        <mrna_strand>AAAATCTCTTGTTAATTATAATTGTTTATCATGTTTGAATAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGCCCAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E745039" ref_strand="+" ref_description="SGN-E745039 [GI|83833847]">
      <seq>aaaatctcttgttaattataattgtttatcatgtttgaataatgttataataaccatctttagaaagtttgctacagaaatattcttcgaataagtatgcccagactatgccatcctaaggttgaaaccggtaggcagagaagg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="+" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="63284" stop="64027"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="63584" g_stop="63727" g_length="144"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="144" r_length="144" r_score="0.993"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="+" ref_id="SGN-E745039" ref_strand="+">
        <total_alignment_score>0.993</total_alignment_score>
        <cumulative_length_of_scored_exons>144</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E745039" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="63584" e_stop="63727"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAAATCTCTTGTTAATTATAATTGTTTATCATGTTTGAACAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGCCCAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</genome_strand>
        <mrna_strand>AAAATCTCTTGTTAATTATAATTGTTTATCATGTTTGAATAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGCCCAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E745041" ref_strand="+" ref_description="SGN-E745041 [GI|83833845]">
      <seq>aaaatctcttgttaattataattgtttatcatgtttgaataatgttataataaccatctttagaaagtttgctacagaaatattcttcgaataagtatgcccagactatgccatcctaaggttgaaaccggtaggcagagaagg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="+" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="63284" stop="64027"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="63584" g_stop="63727" g_length="144"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="144" r_length="144" r_score="0.993"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="+" ref_id="SGN-E745041" ref_strand="+">
        <total_alignment_score>0.993</total_alignment_score>
        <cumulative_length_of_scored_exons>144</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-E745041" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="63584" e_stop="63727"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAAATCTCTTGTTAATTATAATTGTTTATCATGTTTGAACAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGCCCAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</genome_strand>
        <mrna_strand>AAAATCTCTTGTTAATTATAATTGTTTATCATGTTTGAATAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGCCCAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E355122" ref_strand="+" ref_description="SGN-E355122 [cTOS-18-H18]">
      <seq>aaaagtgggaaatggatgtcattggtcctatagagccaaccgcttctaatggacacagattcattttggttgccactgattattttaccaagtgggttgaagcagcctcttacaagtcggtagccaagaaagtggtagccaattttgtccgcaacaatctgatatgcagatttggagttccagaatccatcattactgataacggtgcaaatctcaacagtcatctgatgaaagagatatgtgatcaattcaagattattcaccggaggtcaactgcttatcgccctcaaatgaacggagttgtagaggccgccaacaagaatatcaagaaaattttgaggaaaatgattgacaagcagcgaggttggcatgaaatattgtcgtatgctctactaggttatcgaacgacggtcagaacatcgactggggctactccatacttgctagtatacggaacagaagcagtcgtacctattgaagtcgacatgccgtcactaaggatcatccaagaagctgaattaagtaacgctgagtgggttagcaaacggattgatcaactaactttgattgatgagaagaggatggtcgctgtttgccattgccagttgtatagacaaagaatgactcgcgcttttcacaaaagagtaagagccagaattttgaagttggccagttggttcttaagcgtatttttcctcatcaagatgagtacaaaggaaagttcgcaccaaactg</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="-" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="79467" stop="78133"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="79167" g_stop="78433" g_length="735"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="735" r_length="735" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="-" ref_id="SGN-E355122" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>735</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-E355122" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="79167" e_stop="78433"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAAAGTGGGAAATGGATGTCATTGGTCCTATAGAGCCAACCGCTTCTAATGGACACAGATTCATTTTGGTTGCCACTGATTATTTTACCAAGTGGGTTGAAGCAGCCTCTTACAAGTCGGTAGCCAAGAAAGTGGTAGCCAATTTTGTCCGCAACAATCTGATATGCAGATTTGGAGTTCCAGAATCCATCATTACTGATAACGGTGCAAATCTCAACAGTCATCTGATGAAAGAGATATGTGATCAATTCAAGATTATTCACCGGAGGTCAACTGCTTATCGCCCTCAAATGAACGGAGTTGTAGAGGCCGCCAACAAGAATATCAAGAAAATTTTGAGGAAAATGATTGACAAGCAGCGAGGTTGGCATGAAATATTGTCGTATGCTCTACTAGGTTATCGAACGACGGTCAGAACATCGACTGGGGCTACTCCATACTTGCTAGTATACGGAACAGAAGCAGTCGTACCTATTGAAGTCGACATGCCGTCACTAAGGATCATCCAAGAAGCTGAATTAAGTAACGCTGAGTGGGTTAGCAAACGGATTGATCAACTAACTTTGATTGATGAGAAGAGGATGGTCGCTGTTTGCCATTGCCAGTTGTATAGACAAAGAATGACTCGCGCTTTTCACAAAAGAGTAAGAGCCAGAATTTTGAAGTTGGCCAGTTGGTTCTTAAGCGTATTTTTCCTCATCAAGATGAGTACAAAGGAAAGTTCGCACCAAACTG</genome_strand>
        <mrna_strand>AAAAGTGGGAAATGGATGTCATTGGTCCTATAGAGCCAACCGCTTCTAATGGACACAGATTCATTTTGGTTGCCACTGATTATTTTACCAAGTGGGTTGAAGCAGCCTCTTACAAGTCGGTAGCCAAGAAAGTGGTAGCCAATTTTGTCCGCAACAATCTGATATGCAGATTTGGAGTTCCAGAATCCATCATTACTGATAACGGTGCAAATCTCAACAGTCATCTGATGAAAGAGATATGTGATCAATTCAAGATTATTCACCGGAGGTCAACTGCTTATCGCCCTCAAATGAACGGAGTTGTAGAGGCCGCCAACAAGAATATCAAGAAAATTTTGAGGAAAATGATTGACAAGCAGCGAGGTTGGCATGAAATATTGTCGTATGCTCTACTAGGTTATCGAACGACGGTCAGAACATCGACTGGGGCTACTCCATACTTGCTAGTATACGGAACAGAAGCAGTCGTACCTATTGAAGTCGACATGCCGTCACTAAGGATCATCCAAGAAGCTGAATTAAGTAACGCTGAGTGGGTTAGCAAACGGATTGATCAACTAACTTTGATTGATGAGAAGAGGATGGTCGCTGTTTGCCATTGCCAGTTGTATAGACAAAGAATGACTCGCGCTTTTCACAAAAGAGTAAGAGCCAGAATTTTGAAGTTGGCCAGTTGGTTCTTAAGCGTATTTTTCCTCATCAAGATGAGTACAAAGGAAAGTTCGCACCAAACTG</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E350936" ref_strand="+" ref_description="SGN-E350936 [cTOS-7-D2]">
      <seq>aaaagtgggaaatggatgtcattggtcctatagagccaaccgcttctaatggacacagattcattttggttgccactgattattttaccaagtgggttgaagcagcctcttacaagtcggtagccaagaaagtggtagccaattttgtccgcaacaatctgatatgcagatttggagttccagaatccatcattactgataacggtgcaaatctcaacagtcatctgatgaaagagatatgtgatcaattcaagattattcaccggaggtcaactgcttatcgccctcaaatgaacggagttgtagaggccgccaacaagaatatcaagaaaattttgaggaaaatgattgacaagcagcgaggttggcatgaaatattgtcgtatgctctactaggttatcgaacgacggtcagaacatcgactggggctactccatacttgctagtatacggaacagaagcagtcgtacctattgaagtcgacatgccgtcactaaggatcatccaagaagctgaattaagtaacgctgagtgggttagcaaacggattgatcaactaactttgattgatgagaagaggatggtcgctgtttgccattgccagttgtatagacaaagaatgactcgcgcttttcancaaagagtaagagccagaattttgaaagtggccagttggttcttaagcgtatttttc</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="-" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="79467" stop="78173"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="79167" g_stop="78473" g_length="695"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="695" r_length="695" r_score="0.994"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="-" ref_id="SGN-E350936" ref_strand="+">
        <total_alignment_score>0.994</total_alignment_score>
        <cumulative_length_of_scored_exons>695</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-E350936" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="79167" e_stop="78473"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAAAGTGGGAAATGGATGTCATTGGTCCTATAGAGCCAACCGCTTCTAATGGACACAGATTCATTTTGGTTGCCACTGATTATTTTACCAAGTGGGTTGAAGCAGCCTCTTACAAGTCGGTAGCCAAGAAAGTGGTAGCCAATTTTGTCCGCAACAATCTGATATGCAGATTTGGAGTTCCAGAATCCATCATTACTGATAACGGTGCAAATCTCAACAGTCATCTGATGAAAGAGATATGTGATCAATTCAAGATTATTCACCGGAGGTCAACTGCTTATCGCCCTCAAATGAACGGAGTTGTAGAGGCCGCCAACAAGAATATCAAGAAAATTTTGAGGAAAATGATTGACAAGCAGCGAGGTTGGCATGAAATATTGTCGTATGCTCTACTAGGTTATCGAACGACGGTCAGAACATCGACTGGGGCTACTCCATACTTGCTAGTATACGGAACAGAAGCAGTCGTACCTATTGAAGTCGACATGCCGTCACTAAGGATCATCCAAGAAGCTGAATTAAGTAACGCTGAGTGGGTTAGCAAACGGATTGATCAACTAACTTTGATTGATGAGAAGAGGATGGTCGCTGTTTGCCATTGCCAGTTGTATAGACAAAGAATGACTCGCGCTTTTCACAAAAGAGTAAGAGCCAGAATTTTGAAGTTGGCCAGTTGGTTCTTAAGCGTATTTTTC</genome_strand>
        <mrna_strand>AAAAGTGGGAAATGGATGTCATTGGTCCTATAGAGCCAACCGCTTCTAATGGACACAGATTCATTTTGGTTGCCACTGATTATTTTACCAAGTGGGTTGAAGCAGCCTCTTACAAGTCGGTAGCCAAGAAAGTGGTAGCCAATTTTGTCCGCAACAATCTGATATGCAGATTTGGAGTTCCAGAATCCATCATTACTGATAACGGTGCAAATCTCAACAGTCATCTGATGAAAGAGATATGTGATCAATTCAAGATTATTCACCGGAGGTCAACTGCTTATCGCCCTCAAATGAACGGAGTTGTAGAGGCCGCCAACAAGAATATCAAGAAAATTTTGAGGAAAATGATTGACAAGCAGCGAGGTTGGCATGAAATATTGTCGTATGCTCTACTAGGTTATCGAACGACGGTCAGAACATCGACTGGGGCTACTCCATACTTGCTAGTATACGGAACAGAAGCAGTCGTACCTATTGAAGTCGACATGCCGTCACTAAGGATCATCCAAGAAGCTGAATTAAGTAACGCTGAGTGGGTTAGCAAACGGATTGATCAACTAACTTTGATTGATGAGAAGAGGATGGTCGCTGTTTGCCATTGCCAGTTGTATAGACAAAGAATGACTCGCGCTTTTCANCAAAGAGTAAGAGCCAGAATTTTGAAAGTGGCCAGTTGGTTCTTAAGCGTATTTTTC</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/cxgn-bacpublish-resources-cOrPKM/sgn_ests_tomato_potato" ref_id="SGN-E353644" ref_strand="+" ref_description="SGN-E353644 [cTOS-10-I24]">
      <seq>aaaagtgggaaatggatgtcattggtcctatagagccaaccgcttctaatggacacagattcattttggttgccactgattattttaccaagtgggttgaagcagcctcttacaagtcggtagccaagaaagtggtagccaattttgtccgcaacaatctgatatgcagatttggagttccagaatccatcattactgataacggtgcaaatctcaacagtcatctgatgaaagagatatgtgatcaattcaagattattcaccggaggtcaactgcttatcgccctcaaatgaacggagttgtagaggccgccaacaagaatatcaagaaaattttgaggaaaatgattgacaagcagcgaggttggcatgaaatattgtcgtatgctctactaggttatcgaacgacggtcagaacatcgactggggctactccatacttgctagtatacggaacagaagcagtcgtacctattgaagtcgacatgccgtcactaaggatcatccaagaagctgaattaagtaacgctgagtgggttagcaaacggattgatcaactaactttgattgatgagaagaggatggtcgctgtttgccattgccagttgtatagacaaagaatgactcgcgcttttcacaaaagagtaagagccagaattttgaagttggccagttggttcttaagcgtattttt</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C07HBa0012A22-y8FVV/GenomeThreader_SGN_E_tomato_potato/un_xed_seqs" temp_id="C07HBa0012A22.1" temp_strand="-" temp_description="C07HBa0012A22.1  AC212607.1 htgs_phase:1 submitted_to_sgn_as:gi|158262103|gb|AC212607.1| upload_account_name:france Solanum lycopersicum chromosome 7 clone C07HBa0012A22, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces">
        <position start="79467" stop="78174"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="79167" g_stop="78474" g_length="694"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="694" r_length="694" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C07HBa0012A22.1" gen_strand="-" ref_id="SGN-E353644" ref_strand="+">
        <total_alignment_score>1.000</total_alignment_score>
        <cumulative_length_of_scored_exons>694</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C07HBa0012A22.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-E353644" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="79167" e_stop="78474"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAAAGTGGGAAATGGATGTCATTGGTCCTATAGAGCCAACCGCTTCTAATGGACACAGATTCATTTTGGTTGCCACTGATTATTTTACCAAGTGGGTTGAAGCAGCCTCTTACAAGTCGGTAGCCAAGAAAGTGGTAGCCAATTTTGTCCGCAACAATCTGATATGCAGATTTGGAGTTCCAGAATCCATCATTACTGATAACGGTGCAAATCTCAACAGTCATCTGATGAAAGAGATATGTGATCAATTCAAGATTATTCACCGGAGGTCAACTGCTTATCGCCCTCAAATGAACGGAGTTGTAGAGGCCGCCAACAAGAATATCAAGAAAATTTTGAGGAAAATGATTGACAAGCAGCGAGGTTGGCATGAAATATTGTCGTATGCTCTACTAGGTTATCGAACGACGGTCAGAACATCGACTGGGGCTACTCCATACTTGCTAGTATACGGAACAGAAGCAGTCGTACCTATTGAAGTCGACATGCCGTCACTAAGGATCATCCAAGAAGCTGAATTAAGTAACGCTGAGTGGGTTAGCAAACGGATTGATCAACTAACTTTGATTGATGAGAAGAGGATGGTCGCTGTTTGCCATTGCCAGTTGTATAGACAAAGAATGACTCGCGCTTTTCACAAAAGAGTAAGAGCCAGAATTTTGAAGTTGGCCAGTTGGTTCTTAAGCGTATTTTT</genome_strand>
        <mrna_strand>AAAAGTGGGAAATGGATGTCATTGGTCCTATAGAGCCAACCGCTTCTAATGGACACAGATTCATTTTGGTTGCCACTGATTATTTTACCAAGTGGGTTGAAGCAGCCTCTTACAAGTCGGTAGCCAAGAAAGTGGTAGCCAATTTTGTCCGCAACAATCTGATATGCAGATTTGGAGTTCCAGAATCCATCATTACTGATAACGGTGCAAATCTCAACAGTCATCTGATGAAAGAGATATGTGATCAATTCAAGATTATTCACCGGAGGTCAACTGCTTATCGCCCTCAAATGAACGGAGTTGTAGAGGCCGCCAACAAGAATATCAAGAAAATTTTGAGGAAAATGATTGACAAGCAGCGAGGTTGGCATGAAATATTGTCGTATGCTCTACTAGGTTATCGAACGACGGTCAGAACATCGACTGGGGCTACTCCATACTTGCTAGTATACGGAACAGAAGCAGTCGTACCTATTGAAGTCGACATGCCGTCACTAAGGATCATCCAAGAAGCTGAATTAAGTAACGCTGAGTGGGTTAGCAAACGGATTGATCAACTAACTTTGATTGATGAGAAGAGGATGGTCGCTGTTTGCCATTGCCAGTTGTATAGACAAAGAATGACTCGCGCTTTTCACAAAAGAGTAAGAGCCAGAATTTTGAAGTTGGCCAGTTGGTTCTTAAGCGTATTTTT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>16</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="-" PGL_start="2223" PGL_stop="1895"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="2223" e_stop="1895"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.909"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.909">
            <gDNA_exon_boundary e_start="2223" e_stop="1895" e_length="329"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="2223" stop="1895"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E352716" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>GATCTGTCCCAGGCTTGGCTAACGTCACAGTTTTAGCATTACAATCCAAAATTGCAAAAATTGGGGAAAACCCAATCATACCTAGAATACATCAAAGTCAACCATTTCTAAGATACCCAGTCTACATAAGTATTGCTCTCCATAAAAGTCACAGGACAAGACCTATACACCTTCTCAACTATCACAGACTCACCCACCGGAGTAGANACACGAATAGGCATGTCAAGCAATTCACAATTTAATTTAAGACCACTAGCAAATGAGGAAGATACATATGAAAATGTGTATCCAGGGTCAAATAATACAAAGCCAATGCAATCACAAACCGA</gDNA_template>
            <first_frame> D  L  S  Q  A  W  L  T  S  Q  F  *  H  Y  N  P  K  L  Q  K  L  G  K  T  Q  S  Y  L  E  Y  I  K  V  N  H  F  *  D  T  Q  S  T  *  V  L  L  S  I  K  V  T  G  Q  D  L  Y  T  F  S  T  I  T  D  S  P  T  G  V  D  T  R  I  G  M  S  S  N  S  Q  F  N  L  R  P  L  A  N  E  E  D  T  Y  E  N  V  Y  P  G  S  N  N  T  K  P  M  Q  S  Q  T   </first_frame>
            <second_frame>  I  C  P  R  L  G  *  R  H  S  F  S  I  T  I  Q  N  C  K  N  W  G  K  P  N  H  T  *  N  T  S  K  S  T  I  S  K  I  P  S  L  H  K  Y  C  S  P  *  K  S  Q  D  K  T  Y  T  P  S  Q  L  S  Q  T  H  P  P  E  *  I  H  E  *  A  C  Q  A  I  H  N  L  I  *  D  H  *  Q  M  R  K  I  H  M  K  M  C  I  Q  G  Q  I  I  Q  S  Q  C  N  H  K  P  </second_frame>
            <third_frame>   S  V  P  G  L  A  N  V  T  V  L  A  L  Q  S  K  I  A  K  I  G  E  N  P  I  I  P  R  I  H  Q  S  Q  P  F  L  R  Y  P  V  Y  I  S  I  A  L  H  K  S  H  R  T  R  P  I  H  L  L  N  Y  H  R  L  T  H  R  S  R  Y  T  N  R  H  V  K  Q  F  T  I  *  F  K  T  T  S  K  *  G  R  Y  I  *  K  C  V  S  R  V  K  *  Y  K  A  N  A  I  T  N  R </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="2221" stop="1982"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>237</number_coding_nucleotides>
                  <number_encoded_amino_acids>79</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>SVPGLANVTVLALQSKIAKIGENPIIPRIHQSQPFLRYPVYISIALHKSHRTRPIHLLNYHRLTHRSRYTNRHVKQFTI*</predicted_protein_sequence>
            </orf_entry>
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="-"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="2"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="2094" stop="1897"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>198</number_coding_nucleotides>
                  <number_encoded_amino_acids>66</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>VLLSIKVTGQDLYTFSTITDSPTGVDTRIGMSSNSQFNLRPLANEEDTYENVYPGSNNTKPMQSQT</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="2" PGL_strand="+" PGL_start="4118" PGL_stop="4879"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="4118" e_stop="4879"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.909"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.909">
            <gDNA_exon_boundary e_start="4118" e_stop="4879" e_length="762"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="4118" stop="4879"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E343544" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="2" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>GTATTATGTAAAAAATCATAAAATAAAAAGACCATACAGACCAAAAAGAAAAATATCCCAATGTACTTGTTATAATTGTGGAAAGATAGGACACATAGCTAAAGATTGTAAATTACCCAAAAATCCAAAAAGAAAACAAATAGCAGAATTAATAATAGACAATGAAAAATATATGCAAATAGAGTACATAGATTATGAATTAAGTGAAAATGATAGTATATATGAAGTATCAGACATAGAAACTGAGAATGAAGAAGAAAATATTAACATAGATAATAACGAAACAGATGAAGAAATATAATGTCTGAAAATGAAATAAAAATAATATCTAAGGAAGAATATCAAGATGAAGAATCATCAGAACAGAAAATTATATTTGATAATACGATATTTGAACAAATAAAAGGAAAAGAATTAGATTTAAGTGTTGAAAAAGTACTAGAAATACCTATTTTAAGAAATTGGTTTAAAAGACAAAAAGAAGAATACTATTTAGTTAGTAAAAAAGAACATATCATAGATTGTAAATACACAAGAGGAAAAACATATATACCTATAATAAATAAAAGAATGATAAACAAAGAAATACAAGATATAAAAGCTAAAACACCAATAAAATATGTACATTTAGGAGGAATAGAGATATTAATAAAAGCCTGCTTTAGAGAAGGAATAGATACACCTATAAAAATATATTTAGCAGATGATAGAATTGTACACCCTATAGAAAAAAGCATAATTAGTGCAGTAAAAGGAAACTTA</gDNA_template>
            <first_frame> V  L  C  K  K  S  *  N  K  K  T  I  Q  T  K  K  K  N  I  P  M  Y  L  L  *  L  W  K  D  R  T  H  S  *  R  L  *  I  T  Q  K  S  K  K  K  T  N  S  R  I  N  N  R  Q  *  K  I  Y  A  N  R  V  H  R  L  *  I  K  *  K  *  *  Y  I  *  S  I  R  H  R  N  *  E  *  R  R  K  Y  *  H  R  *  *  R  N  R  *  R  N  I  M  S  E  N  E  I  K  I  I  S  K  E  E  Y  Q  D  E  E  S  S  E  Q  K  I  I  F  D  N  T  I  F  E  Q  I  K  G  K  E  L  D  L  S  V  E  K  V  L  E  I  P  I  L  R  N  W  F  K  R  Q  K  E  E  Y  Y  L  V  S  K  K  E  H  I  I  D  C  K  Y  T  R  G  K  T  Y  I  P  I  I  N  K  R  M  I  N  K  E  I  Q  D  I  K  A  K  T  P  I  K  Y  V  H  L  G  G  I  E  I  L  I  K  A  C  F  R  E  G  I  D  T  P  I  K  I  Y  L  A  D  D  R  I  V  H  P  I  E  K  S  I  I  S  A  V  K  G  N  L </first_frame>
            <second_frame>  Y  Y  V  K  N  H  K  I  K  R  P  Y  R  P  K  R  K  I  S  Q  C  T  C  Y  N  C  G  K  I  G  H  I  A  K  D  C  K  L  P  K  N  P  K  R  K  Q  I  A  E  L  I  I  D  N  E  K  Y  M  Q  I  E  Y  I  D  Y  E  L  S  E  N  D  S  I  Y  E  V  S  D  I  E  T  E  N  E  E  E  N  I  N  I  D  N  N  E  T  D  E  E  I  *  C  L  K  M  K  *  K  *  Y  L  R  K  N  I  K  M  K  N  H  Q  N  R  K  L  Y  L  I  I  R  Y  L  N  K  *  K  E  K  N  *  I  *  V  L  K  K  Y  *  K  Y  L  F  *  E  I  G  L  K  D  K  K  K  N  T  I  *  L  V  K  K  N  I  S  *  I  V  N  T  Q  E  E  K  H  I  Y  L  *  *  I  K  E  *  *  T  K  K  Y  K  I  *  K  L  K  H  Q  *  N  M  Y  I  *  E  E  *  R  Y  *  *  K  P  A  L  E  K  E  *  I  H  L  *  K  Y  I  *  Q  M  I  E  L  Y  T  L  *  K  K  A  *  L  V  Q  *  K  E  T   </second_frame>
            <third_frame>   I  M  *  K  I  I  K  *  K  D  H  T  D  Q  K  E  K  Y  P  N  V  L  V  I  I  V  E  R  *  D  T  *  L  K  I  V  N  Y  P  K  I  Q  K  E  N  K  *  Q  N  *  *  *  T  M  K  N  I  C  K  *  S  T  *  I  M  N  *  V  K  M  I  V  Y  M  K  Y  Q  T  *  K  L  R  M  K  K  K  I  L  T  *  I  I  T  K  Q  M  K  K  Y  N  V  *  K  *  N  K  N  N  I  *  G  R  I  S  R  *  R  I  I  R  T  E  N  Y  I  *  *  Y  D  I  *  T  N  K  R  K  R  I  R  F  K  C  *  K  S  T  R  N  T  Y  F  K  K  L  V  *  K  T  K  R  R  I  L  F  S  *  *  K  R  T  Y  H  R  L  *  I  H  K  R  K  N  I  Y  T  Y  N  K  *  K  N  D  K  Q  R  N  T  R  Y  K  S  *  N  T  N  K  I  C  T  F  R  R  N  R  D  I  N  K  S  L  L  *  R  R  N  R  Y  T  Y  K  N  I  F  S  R  *  *  N  C  T  P  Y  R  K  K  H  N  *  C  S  K  R  K  L  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="+"/>
                <serials PGL_serial="2" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="4409" stop="4879"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>471</number_coding_nucleotides>
                  <number_encoded_amino_acids>157</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>RNIMSENEIKIISKEEYQDEESSEQKIIFDNTIFEQIKGKELDLSVEKVLEIPILRNWFKRQKEEYYLVSKKEHIIDCKYTRGKTYIPIINKRMINKEIQDIKAKTPIKYVHLGGIEILIKACFREGIDTPIKIYLADDRIVHPIEKSIISAVKGNL</predicted_protein_sequence>
            </orf_entry>
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="+"/>
                <serials PGL_serial="2" AGS_serial="1" PPS_serial="2"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="4119" stop="4418"/>
                  </exon_boundaries>
                  <frame>1</frame>
                  <number_coding_nucleotides>297</number_coding_nucleotides>
                  <number_encoded_amino_acids>99</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>YYVKNHKIKRPYRPKRKISQCTCYNCGKIGHIAKDCKLPKNPKRKQIAELIIDNEKYMQIEYIDYELSENDSIYEVSDIETENEEENINIDNNETDEEI*</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="3" PGL_strand="-" PGL_start="10486" PGL_stop="9700"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="10486" e_stop="9700"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.987"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.987">
            <gDNA_exon_boundary e_start="10486" e_stop="9700" e_length="787"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="10486" stop="9700"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E745033" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="3" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>TATAAAAATGCGGAGCTACGTCGTTCGGCAGACGAAAAACAGCAAGAGCTAAAAGGAGACGTTGGGAAACTCCTTAAAACCCATGACATTACTGATGCTGCAGGTACAAGCAAAAAAGCTATGGAGAAACCTACACCAAAAAACATAAACCTAAATAGCATATTTACCAAACCATTTACTCCAAAGATACAGATAGTAGATGCTTCAACACCACAAACATCTACCTATGCAACTAGCCTGCATAAAGAGAAGAAAACATACAACCATATATCCCGAACATATATTGAAAACCTATACAAAATACAAAATTTTTTAAATCAAAAACCCAAATCTACCACAACATTAGAAAAAACCCAAGACTACCTAACCCAAAAACTACAAGGCTATAACAAGTTAATTGCACAACCAAAAACTAATCCAAACCTAGTTAAAACTTGTTATAACTATGGATTATTAAATACAGTCTATACATATACAGGTGAAGAGATAAGTGGAATCCCAGAGGTCCACAAAGCATTTTTAATATATAAAAAGATAACAAAAGGAAACTTATTTTTCATAAGATTCTACACAGCACCAGCAGAGATACTCTATGATGAAATAAAGCCAATGATCCAGCTAGTCAAAATTGGGCTAACACGAGAAATGATAATCCCAGAAGATATAGGCCAACAGCCAGAGATAACAAGAGTTGAGATACCCAGTTTTTATGCCAATAAAAGGATAATTGGATTATCAACTATTATACAAGAGCTAGTAAATAACTATCTACAAGGCAACGCCATAT</gDNA_template>
            <first_frame> Y  K  N  A  E  L  R  R  S  A  D  E  K  Q  Q  E  L  K  G  D  V  G  K  L  L  K  T  H  D  I  T  D  A  A  G  T  S  K  K  A  M  E  K  P  T  P  K  N  I  N  L  N  S  I  F  T  K  P  F  T  P  K  I  Q  I  V  D  A  S  T  P  Q  T  S  T  Y  A  T  S  L  H  K  E  K  K  T  Y  N  H  I  S  R  T  Y  I  E  N  L  Y  K  I  Q  N  F  L  N  Q  K  P  K  S  T  T  T  L  E  K  T  Q  D  Y  L  T  Q  K  L  Q  G  Y  N  K  L  I  A  Q  P  K  T  N  P  N  L  V  K  T  C  Y  N  Y  G  L  L  N  T  V  Y  T  Y  T  G  E  E  I  S  G  I  P  E  V  H  K  A  F  L  I  Y  K  K  I  T  K  G  N  L  F  F  I  R  F  Y  T  A  P  A  E  I  L  Y  D  E  I  K  P  M  I  Q  L  V  K  I  G  L  T  R  E  M  I  I  P  E  D  I  G  Q  Q  P  E  I  T  R  V  E  I  P  S  F  Y  A  N  K  R  I  I  G  L  S  T  I  I  Q  E  L  V  N  N  Y  L  Q  G  N  A  I  </first_frame>
            <second_frame>  I  K  M  R  S  Y  V  V  R  Q  T  K  N  S  K  S  *  K  E  T  L  G  N  S  L  K  P  M  T  L  L  M  L  Q  V  Q  A  K  K  L  W  R  N  L  H  Q  K  T  *  T  *  I  A  Y  L  P  N  H  L  L  Q  R  Y  R  *  *  M  L  Q  H  H  K  H  L  P  M  Q  L  A  C  I  K  R  R  K  H  T  T  I  Y  P  E  H  I  L  K  T  Y  T  K  Y  K  I  F  *  I  K  N  P  N  L  P  Q  H  *  K  K  P  K  T  T  *  P  K  N  Y  K  A  I  T  S  *  L  H  N  Q  K  L  I  Q  T  *  L  K  L  V  I  T  M  D  Y  *  I  Q  S  I  H  I  Q  V  K  R  *  V  E  S  Q  R  S  T  K  H  F  *  Y  I  K  R  *  Q  K  E  T  Y  F  S  *  D  S  T  Q  H  Q  Q  R  Y  S  M  M  K  *  S  Q  *  S  S  *  S  K  L  G  *  H  E  K  *  *  S  Q  K  I  *  A  N  S  Q  R  *  Q  E  L  R  Y  P  V  F  M  P  I  K  G  *  L  D  Y  Q  L  L  Y  K  S  *  *  I  T  I  Y  K  A  T  P  Y </second_frame>
            <third_frame>   *  K  C  G  A  T  S  F  G  R  R  K  T  A  R  A  K  R  R  R  W  E  T  P  *  N  P  *  H  Y  *  C  C  R  Y  K  Q  K  S  Y  G  E  T  Y  T  K  K  H  K  P  K  *  H  I  Y  Q  T  I  Y  S  K  D  T  D  S  R  C  F  N  T  T  N  I  Y  L  C  N  *  P  A  *  R  E  E  N  I  Q  P  Y  I  P  N  I  Y  *  K  P  I  Q  N  T  K  F  F  K  S  K  T  Q  I  Y  H  N  I  R  K  N  P  R  L  P  N  P  K  T  T  R  L  *  Q  V  N  C  T  T  K  N  *  S  K  P  S  *  N  L  L  *  L  W  I  I  K  Y  S  L  Y  I  Y  R  *  R  D  K  W  N  P  R  G  P  Q  S  I  F  N  I  *  K  D  N  K  R  K  L  I  F  H  K  I  L  H  S  T  S  R  D  T  L  *  *  N  K  A  N  D  P  A  S  Q  N  W  A  N  T  R  N  D  N  P  R  R  Y  R  P  T  A  R  D  N  K  S  *  D  T  Q  F  L  C  Q  *  K  D  N  W  I  I  N  Y  Y  T  R  A  S  K  *  L  S  T  R  Q  R  H   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="-"/>
                <serials PGL_serial="3" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="10486" stop="9701"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>786</number_coding_nucleotides>
                  <number_encoded_amino_acids>262</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>YKNAELRRSADEKQQELKGDVGKLLKTHDITDAAGTSKKAMEKPTPKNINLNSIFTKPFTPKIQIVDASTPQTSTYATSLHKEKKTYNHISRTYIENLYKIQNFLNQKPKSTTTLEKTQDYLTQKLQGYNKLIAQPKTNPNLVKTCYNYGLLNTVYTYTGEEISGIPEVHKAFLIYKKITKGNLFFIRFYTAPAEILYDEIKPMIQLVKIGLTREMIIPEDIGQQPEITRVEIPSFYANKRIIGLSTIIQELVNNYLQGNAI</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="4" PGL_strand="+" PGL_start="29117" PGL_stop="29500"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="29117" e_stop="29500"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.909"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.909">
            <gDNA_exon_boundary e_start="29117" e_stop="29500" e_length="384"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="29117" stop="29500"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E351886" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="4" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>GGAAATGTGTGGTTTTTCTTTGGAAAAAGAATATATCAACCACAATATACGAAGATAATGTCGCATGTATAGCCCAATTGAAAGGAGGATACATCAAAGGAGACTGGACAAAACATATTTCACCAAAATTCTTTTTCACTCATGATCTTCAACAAAATGGTGAGATGGAAGTTCAACAAATCCGTTCAAGTGATAATCTTGCTGATTTATTCACTTAGGCATTGCCAACATCAACGTTTGAGAAGTTGAGATACAAGATTGGAATGTGCACCGTCTTCGAGATATCAAGTGAAGCTTTCATCAGGGTGAGTGAAATACGTGTTGTGCTGTTTTTCTTCACTATAATTTTTTCCCAAGTTGAGTTTTCCTGGTAAGAATTTTAAT</gDNA_template>
            <first_frame> G  N  V  W  F  F  F  G  K  R  I  Y  Q  P  Q  Y  T  K  I  M  S  H  V  *  P  N  *  K  E  D  T  S  K  E  T  G  Q  N  I  F  H  Q  N  S  F  S  L  M  I  F  N  K  M  V  R  W  K  F  N  K  S  V  Q  V  I  I  L  L  I  Y  S  L  R  H  C  Q  H  Q  R  L  R  S  *  D  T  R  L  E  C  A  P  S  S  R  Y  Q  V  K  L  S  S  G  *  V  K  Y  V  L  C  C  F  S  S  L  *  F  F  P  K  L  S  F  P  G  K  N  F  N </first_frame>
            <second_frame>  E  M  C  G  F  S  L  E  K  E  Y  I  N  H  N  I  R  R  *  C  R  M  Y  S  P  I  E  R  R  I  H  Q  R  R  L  D  K  T  Y  F  T  K  I  L  F  H  S  *  S  S  T  K  W  *  D  G  S  S  T  N  P  F  K  *  *  S  C  *  F  I  H  L  G  I  A  N  I  N  V  *  E  V  E  I  Q  D  W  N  V  H  R  L  R  D  I  K  *  S  F  H  Q  G  E  *  N  T  C  C  A  V  F  L  H  Y  N  F  F  P  S  *  V  F  L  V  R  I  L   </second_frame>
            <third_frame>   K  C  V  V  F  L  W  K  K  N  I  S  T  T  I  Y  E  D  N  V  A  C  I  A  Q  L  K  G  G  Y  I  K  G  D  W  T  K  H  I  S  P  K  F  F  F  T  H  D  L  Q  Q  N  G  E  M  E  V  Q  Q  I  R  S  S  D  N  L  A  D  L  F  T  *  A  L  P  T  S  T  F  E  K  L  R  Y  K  I  G  M  C  T  V  F  E  I  S  S  E  A  F  I  R  V  S  E  I  R  V  V  L  F  F  F  T  I  I  F  S  Q  V  E  F  S  W  *  E  F  *  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="+"/>
                <serials PGL_serial="4" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="29119" stop="29334"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>213</number_coding_nucleotides>
                  <number_encoded_amino_acids>71</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>KCVVFLWKKNISTTIYEDNVACIAQLKGGYIKGDWTKHISPKFFFTHDLQQNGEMEVQQIRSSDNLADLFT*</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="5" PGL_strand="-" PGL_start="35029" PGL_stop="34729"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="35029" e_stop="34729"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.900"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.900">
            <gDNA_exon_boundary e_start="35029" e_stop="34729" e_length="301"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="35029" stop="34729"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E577887" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="5" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>TTGGGTCTGAGCCCCCTCTCTAGTACGAGAGTCATGTGGTGTGGTAGTCGCACCACCACCCTGAGAAAATCCCTATCACACTTAACACCCTCAATAGTGTATCCTGAAGCAAAGGTGTGACTACAGGATATGGAGGAACCTGGTCCTCCCTGCTATCAATCTAAGGTTCTGCAGAGACCTCTTTAGCAGGACCTCTCACTGGTGCTGCTCCACGTCCACGACCTCTGGCTACTGTCGTACTACTAGCACGACCTCTAGCTCGAGATCTACCCCTACCCCTAGCTGGGGCCTCAACAACTGC</gDNA_template>
            <first_frame> L  G  L  S  P  L  S  S  T  R  V  M  W  C  G  S  R  T  T  T  L  R  K  S  L  S  H  L  T  P  S  I  V  Y  P  E  A  K  V  *  L  Q  D  M  E  E  P  G  P  P  C  Y  Q  S  K  V  L  Q  R  P  L  *  Q  D  L  S  L  V  L  L  H  V  H  D  L  W  L  L  S  Y  Y  *  H  D  L  *  L  E  I  Y  P  Y  P  *  L  G  P  Q  Q  L  </first_frame>
            <second_frame>  W  V  *  A  P  S  L  V  R  E  S  C  G  V  V  V  A  P  P  P  *  E  N  P  Y  H  T  *  H  P  Q  *  C  I  L  K  Q  R  C  D  Y  R  I  W  R  N  L  V  L  P  A  I  N  L  R  F  C  R  D  L  F  S  R  T  S  H  W  C  C  S  T  S  T  T  S  G  Y  C  R  T  T  S  T  T  S  S  S  R  S  T  P  T  P  S  W  G  L  N  N  C </second_frame>
            <third_frame>   G  S  E  P  P  L  *  Y  E  S  H  V  V  W  *  S  H  H  H  P  E  K  I  P  I  T  L  N  T  L  N  S  V  S  *  S  K  G  V  T  T  G  Y  G  G  T  W  S  S  L  L  S  I  *  G  S  A  E  T  S  L  A  G  P  L  T  G  A  A  P  R  P  R  P  L  A  T  V  V  L  L  A  R  P  L  A  R  D  L  P  L  P  L  A  G  A  S  T  T   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="-"/>
                <serials PGL_serial="5" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="34932" stop="34729"/>
                  </exon_boundaries>
                  <frame>1</frame>
                  <number_coding_nucleotides>204</number_coding_nucleotides>
                  <number_encoded_amino_acids>68</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>CILKQRCDYRIWRNLVLPAINLRFCRDLFSRTSHWCCSTSTTSGYCRTTSTTSSSRSTPTPSWGLNNC</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="6" PGL_strand="+" PGL_start="35448" PGL_stop="35876"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="35448" e_stop="35876"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.932"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.932">
            <gDNA_exon_boundary e_start="35448" e_stop="35876" e_length="429"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="35448" stop="35876"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E279140" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="6" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>GCTTGAGGTTTGAGAGTCTGAGACAGGATGGTTTATCGGTTATAGAGTATGAGGCGCATTTTTGCCAGTTGACTAGGCATGCGTTAGCCATTATTCCAAATGAGACAGAGAGGATCCACAGATTTGTGAGGGGATTGACTTTCTTTATTAGGTCAGCTGTGTTTCGAACATCTAGGGAGGGGACTTCTTTCCAGTCCATTGTGAGCGCCGCCAAAGAGGCGGAATTGATGGAGAGAGAGGAGTTTGGGAACCCTAAAAAAGCTCGTATATCAGGTCAGTTTCAGGGTGCCTCATCTGGAGGTAGGGGATCACAAAGAGTGAGTGGTTCTTTTCAGCAGCTGGGACCTATTCATGCATCTATGCCGACATTTGAGGGTGGCCAGACATCTAGGGGTTCTTACGGCCCAGGTCAGGGCTCGTACGGTTCAC</gDNA_template>
            <first_frame> A  *  G  L  R  V  *  D  R  M  V  Y  R  L  *  S  M  R  R  I  F  A  S  *  L  G  M  R  *  P  L  F  Q  M  R  Q  R  G  S  T  D  L  *  G  D  *  L  S  L  L  G  Q  L  C  F  E  H  L  G  R  G  L  L  S  S  P  L  *  A  P  P  K  R  R  N  *  W  R  E  R  S  L  G  T  L  K  K  L  V  Y  Q  V  S  F  R  V  P  H  L  E  V  G  D  H  K  E  *  V  V  L  F  S  S  W  D  L  F  M  H  L  C  R  H  L  R  V  A  R  H  L  G  V  L  T  A  Q  V  R  A  R  T  V  H </first_frame>
            <second_frame>  L  E  V  *  E  S  E  T  G  W  F  I  G  Y  R  V  *  G  A  F  L  P  V  D  *  A  C  V  S  H  Y  S  K  *  D  R  E  D  P  Q  I  C  E  G  I  D  F  L  Y  *  V  S  C  V  S  N  I  *  G  G  D  F  F  P  V  H  C  E  R  R  Q  R  G  G  I  D  G  E  R  G  V  W  E  P  *  K  S  S  Y  I  R  S  V  S  G  C  L  I  W  R  *  G  I  T  K  S  E  W  F  F  S  A  A  G  T  Y  S  C  I  Y  A  D  I  *  G  W  P  D  I  *  G  F  L  R  P  R  S  G  L  V  R  F   </second_frame>
            <third_frame>   L  R  F  E  S  L  R  Q  D  G  L  S  V  I  E  Y  E  A  H  F  C  Q  L  T  R  H  A  L  A  I  I  P  N  E  T  E  R  I  H  R  F  V  R  G  L  T  F  F  I  R  S  A  V  F  R  T  S  R  E  G  T  S  F  Q  S  I  V  S  A  A  K  E  A  E  L  M  E  R  E  E  F  G  N  P  K  K  A  R  I  S  G  Q  F  Q  G  A  S  S  G  G  R  G  S  Q  R  V  S  G  S  F  Q  Q  L  G  P  I  H  A  S  M  P  T  F  E  G  G  Q  T  S  R  G  S  Y  G  P  G  Q  G  S  Y  G  S  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="+"/>
                <serials PGL_serial="6" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="35450" stop="35875"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>426</number_coding_nucleotides>
                  <number_encoded_amino_acids>142</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>LRFESLRQDGLSVIEYEAHFCQLTRHALAIIPNETERIHRFVRGLTFFIRSAVFRTSREGTSFQSIVSAAKEAELMEREEFGNPKKARISGQFQGASSGGRGSQRVSGSFQQLGPIHASMPTFEGGQTSRGSYGPGQGSYGS</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="7" PGL_strand="+" PGL_start="38007" PGL_stop="38594"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="38007" e_stop="38594"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.998"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.998">
            <gDNA_exon_boundary e_start="38007" e_stop="38594" e_length="588"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="38007" stop="38594"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E330288" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="7" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>TTTTGTATCATCCGGGGAAGGCCAATGTTGTGGCCGATGCTTTGAGTAGGAAGACTCATAGCATGGGGAGTCTTGCATCTCTTAGTGTTGAGGAAAGACCATTGGCTAGAGATGTTCAATTGTTAGCTAACAGTCTTGTCCGATTACAGATCTCAGAGGAGAGTGATGGGATGATTGCTTTTATTGAGGCTCGATCTTCTTTAGTCAAGCAGATTCGTGCACACCAGTTTGATGACGAAAAATTATGTCTCATTCGAGACAAAGTATTGAGAGGGGAAGCTAAGGAGGTTGTCCTTGATTCTGATGGTGTCTTGAGGATCGGAGGCAGGATTTGTGTGCCCAAGACAGGCGATTTGATTAGATTGATCCTTGAGGAGGCCCATTGTTCTCGATATTCTATTCATCCGGGAGAGGCGAAAATGTATCATGATCTGAGTCAGCATTACTGGTGGTGTGGGATGAAGAGAGATATTACAGACTTTGTTTTGAGGTGTTTGACTTGCCAGTTGGTCAAGTGTGAGCACCAGTGGCCTGGGGGTGTATCTCAAAGGATGCCTATTCTTACTTGGACGTGGGAGTGGATTACTA</gDNA_template>
            <first_frame> F  C  I  I  R  G  R  P  M  L  W  P  M  L  *  V  G  R  L  I  A  W  G  V  L  H  L  L  V  L  R  K  D  H  W  L  E  M  F  N  C  *  L  T  V  L  S  D  Y  R  S  Q  R  R  V  M  G  *  L  L  L  L  R  L  D  L  L  *  S  S  R  F  V  H  T  S  L  M  T  K  N  Y  V  S  F  E  T  K  Y  *  E  G  K  L  R  R  L  S  L  I  L  M  V  S  *  G  S  E  A  G  F  V  C  P  R  Q  A  I  *  L  D  *  S  L  R  R  P  I  V  L  D  I  L  F  I  R  E  R  R  K  C  I  M  I  *  V  S  I  T  G  G  V  G  *  R  E  I  L  Q  T  L  F  *  G  V  *  L  A  S  W  S  S  V  S  T  S  G  L  G  V  Y  L  K  G  C  L  F  L  L  G  R  G  S  G  L  L </first_frame>
            <second_frame>  F  V  S  S  G  E  G  Q  C  C  G  R  C  F  E  *  E  D  S  *  H  G  E  S  C  I  S  *  C  *  G  K  T  I  G  *  R  C  S  I  V  S  *  Q  S  C  P  I  T  D  L  R  G  E  *  W  D  D  C  F  Y  *  G  S  I  F  F  S  Q  A  D  S  C  T  P  V  *  *  R  K  I  M  S  H  S  R  Q  S  I  E  R  G  S  *  G  G  C  P  *  F  *  W  C  L  E  D  R  R  Q  D  L  C  A  Q  D  R  R  F  D  *  I  D  P  *  G  G  P  L  F  S  I  F  Y  S  S  G  R  G  E  N  V  S  *  S  E  S  A  L  L  V  V  W  D  E  E  R  Y  Y  R  L  C  F  E  V  F  D  L  P  V  G  Q  V  *  A  P  V  A  W  G  C  I  S  K  D  A  Y  S  Y  L  D  V  G  V  D  Y   </second_frame>
            <third_frame>   L  Y  H  P  G  K  A  N  V  V  A  D  A  L  S  R  K  T  H  S  M  G  S  L  A  S  L  S  V  E  E  R  P  L  A  R  D  V  Q  L  L  A  N  S  L  V  R  L  Q  I  S  E  E  S  D  G  M  I  A  F  I  E  A  R  S  S  L  V  K  Q  I  R  A  H  Q  F  D  D  E  K  L  C  L  I  R  D  K  V  L  R  G  E  A  K  E  V  V  L  D  S  D  G  V  L  R  I  G  G  R  I  C  V  P  K  T  G  D  L  I  R  L  I  L  E  E  A  H  C  S  R  Y  S  I  H  P  G  E  A  K  M  Y  H  D  L  S  Q  H  Y  W  W  C  G  M  K  R  D  I  T  D  F  V  L  R  C  L  T  C  Q  L  V  K  C  E  H  Q  W  P  G  G  V  S  Q  R  M  P  I  L  T  W  T  W  E  W  I  T  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="+"/>
                <serials PGL_serial="7" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="38009" stop="38593"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>585</number_coding_nucleotides>
                  <number_encoded_amino_acids>195</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>LYHPGKANVVADALSRKTHSMGSLASLSVEERPLARDVQLLANSLVRLQISEESDGMIAFIEARSSLVKQIRAHQFDDEKLCLIRDKVLRGEAKEVVLDSDGVLRIGGRICVPKTGDLIRLILEEAHCSRYSIHPGEAKMYHDLSQHYWWCGMKRDITDFVLRCLTCQLVKCEHQWPGGVSQRMPILTWTWEWIT</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="8" PGL_strand="+" PGL_start="52215" PGL_stop="52623"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="52215" e_stop="52623"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.905"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.905">
            <gDNA_exon_boundary e_start="52215" e_stop="52623" e_length="409"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="52215" stop="52623"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E241790" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="8" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>ATACCTTCCTTAAGACTTGCTACTCAAGAAGGGCTCATTGAGGAAGAAAATGCTCGACTGTGTCTTGCTGAGTTAGAAGCACTTGATGAAAAGAGGCTAGAAGCCCAACAAAACCTTGAATGTTATCAAGCTCGTCTATCTCATGCTTTGAATAAGAAGGTTCGCTTGAGGTGTTTTCAAGTTGGAGACCAAGTTCTCACGGTAAGAAGACCCATCATTACTTCGCACAAGTCTGGGGGCAAATTTACCTCAACGTGGGATGGAGCATATGTCTTACAAGAAGCATACTCAAATGGTGCTTACAAGCTTTTTGATTCTGATGGCTTAAGGATCGGTCCTATTAATGTCAAATTCCTAAAGAGGTACTACCCATGAAGTAAGATGATGCTCCTTAAGGTACGAGCCTAAA</gDNA_template>
            <first_frame> I  P  S  L  R  L  A  T  Q  E  G  L  I  E  E  E  N  A  R  L  C  L  A  E  L  E  A  L  D  E  K  R  L  E  A  Q  Q  N  L  E  C  Y  Q  A  R  L  S  H  A  L  N  K  K  V  R  L  R  C  F  Q  V  G  D  Q  V  L  T  V  R  R  P  I  I  T  S  H  K  S  G  G  K  F  T  S  T  W  D  G  A  Y  V  L  Q  E  A  Y  S  N  G  A  Y  K  L  F  D  S  D  G  L  R  I  G  P  I  N  V  K  F  L  K  R  Y  Y  P  *  S  K  M  M  L  L  K  V  R  A  *  </first_frame>
            <second_frame>  Y  L  P  *  D  L  L  L  K  K  G  S  L  R  K  K  M  L  D  C  V  L  L  S  *  K  H  L  M  K  R  G  *  K  P  N  K  T  L  N  V  I  K  L  V  Y  L  M  L  *  I  R  R  F  A  *  G  V  F  K  L  E  T  K  F  S  R  *  E  D  P  S  L  L  R  T  S  L  G  A  N  L  P  Q  R  G  M  E  H  M  S  Y  K  K  H  T  Q  M  V  L  T  S  F  L  I  L  M  A  *  G  S  V  L  L  M  S  N  S  *  R  G  T  T  H  E  V  R  *  C  S  L  R  Y  E  P  K </second_frame>
            <third_frame>   T  F  L  K  T  C  Y  S  R  R  A  H  *  G  R  K  C  S  T  V  S  C  *  V  R  S  T  *  *  K  E  A  R  S  P  T  K  P  *  M  L  S  S  S  S  I  S  C  F  E  *  E  G  S  L  E  V  F  S  S  W  R  P  S  S  H  G  K  K  T  H  H  Y  F  A  Q  V  W  G  Q  I  Y  L  N  V  G  W  S  I  C  L  T  R  S  I  L  K  W  C  L  Q  A  F  *  F  *  W  L  K  D  R  S  Y  *  C  Q  I  P  K  E  V  L  P  M  K  *  D  D  A  P  *  G  T  S  L   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="+"/>
                <serials PGL_serial="8" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="52215" stop="52589"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>372</number_coding_nucleotides>
                  <number_encoded_amino_acids>124</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>IPSLRLATQEGLIEEENARLCLAELEALDEKRLEAQQNLECYQARLSHALNKKVRLRCFQVGDQVLTVRRPIITSHKSGGKFTSTWDGAYVLQEAYSNGAYKLFDSDGLRIGPINVKFLKRYYP*</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="9" PGL_strand="+" PGL_start="63584" PGL_stop="63727"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="63584" e_stop="63727"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.972"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.972">
            <gDNA_exon_boundary e_start="63584" e_stop="63727" e_length="144"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="63584" stop="63727"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E745040" strand="+"/>
          </PGS_line>
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="63584" stop="63727"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E745037" strand="+"/>
          </PGS_line>
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="63584" stop="63727"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E745038" strand="+"/>
          </PGS_line>
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="63584" stop="63727"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E745039" strand="+"/>
          </PGS_line>
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="63584" stop="63727"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E745041" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="9" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>AAAATCTCTTGTTAATTATAATTGTTTATCATGTTTGAACAATGTTATAATAACCATCTTTAGAAAGTTTGCTACAGAAATATTCTTCGAATAAGTATGCCCAGACTATGCCATCCTAAGGTTGAAACCGGTAGGCAGAGAAGG</gDNA_template>
            <first_frame> K  I  S  C  *  L  *  L  F  I  M  F  E  Q  C  Y  N  N  H  L  *  K  V  C  Y  R  N  I  L  R  I  S  M  P  R  L  C  H  P  K  V  E  T  G  R  Q  R  R </first_frame>
            <second_frame>  K  S  L  V  N  Y  N  C  L  S  C  L  N  N  V  I  I  T  I  F  R  K  F  A  T  E  I  F  F  E  *  V  C  P  D  Y  A  I  L  R  L  K  P  V  G  R  E   </second_frame>
            <third_frame>   N  L  L  L  I  I  I  V  Y  H  V  *  T  M  L  *  *  P  S  L  E  S  L  L  Q  K  Y  S  S  N  K  Y  A  Q  T  M  P  S  *  G  *  N  R  *  A  E  K  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <none gDNA_id="C07HBa0012A22.1"/>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="10" PGL_strand="-" PGL_start="79167" PGL_stop="78433"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="79167" e_stop="78433"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="79167" e_stop="78433" e_length="735"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="79167" stop="78433"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E355122" strand="+"/>
          </PGS_line>
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="79167" stop="78473"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E350936" strand="+"/>
          </PGS_line>
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="79167" stop="78474"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-E353644" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="10" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>AAAAGTGGGAAATGGATGTCATTGGTCCTATAGAGCCAACCGCTTCTAATGGACACAGATTCATTTTGGTTGCCACTGATTATTTTACCAAGTGGGTTGAAGCAGCCTCTTACAAGTCGGTAGCCAAGAAAGTGGTAGCCAATTTTGTCCGCAACAATCTGATATGCAGATTTGGAGTTCCAGAATCCATCATTACTGATAACGGTGCAAATCTCAACAGTCATCTGATGAAAGAGATATGTGATCAATTCAAGATTATTCACCGGAGGTCAACTGCTTATCGCCCTCAAATGAACGGAGTTGTAGAGGCCGCCAACAAGAATATCAAGAAAATTTTGAGGAAAATGATTGACAAGCAGCGAGGTTGGCATGAAATATTGTCGTATGCTCTACTAGGTTATCGAACGACGGTCAGAACATCGACTGGGGCTACTCCATACTTGCTAGTATACGGAACAGAAGCAGTCGTACCTATTGAAGTCGACATGCCGTCACTAAGGATCATCCAAGAAGCTGAATTAAGTAACGCTGAGTGGGTTAGCAAACGGATTGATCAACTAACTTTGATTGATGAGAAGAGGATGGTCGCTGTTTGCCATTGCCAGTTGTATAGACAAAGAATGACTCGCGCTTTTCACAAAAGAGTAAGAGCCAGAATTTTGAAGTTGGCCAGTTGGTTCTTAAGCGTATTTTTCCTCATCAAGATGAGTACAAAGGAAAGTTCGCACCAAACTG</gDNA_template>
            <first_frame> K  S  G  K  W  M  S  L  V  L  *  S  Q  P  L  L  M  D  T  D  S  F  W  L  P  L  I  I  L  P  S  G  L  K  Q  P  L  T  S  R  *  P  R  K  W  *  P  I  L  S  A  T  I  *  Y  A  D  L  E  F  Q  N  P  S  L  L  I  T  V  Q  I  S  T  V  I  *  *  K  R  Y  V  I  N  S  R  L  F  T  G  G  Q  L  L  I  A  L  K  *  T  E  L  *  R  P  P  T  R  I  S  R  K  F  *  G  K  *  L  T  S  S  E  V  G  M  K  Y  C  R  M  L  Y  *  V  I  E  R  R  S  E  H  R  L  G  L  L  H  T  C  *  Y  T  E  Q  K  Q  S  Y  L  L  K  S  T  C  R  H  *  G  S  S  K  K  L  N  *  V  T  L  S  G  L  A  N  G  L  I  N  *  L  *  L  M  R  R  G  W  S  L  F  A  I  A  S  C  I  D  K  E  *  L  A  L  F  T  K  E  *  E  P  E  F  *  S  W  P  V  G  S  *  A  Y  F  S  S  S  R  *  V  Q  R  K  V  R  T  K  L </first_frame>
            <second_frame>  K  V  G  N  G  C  H  W  S  Y  R  A  N  R  F  *  W  T  Q  I  H  F  G  C  H  *  L  F  Y  Q  V  G  *  S  S  L  L  Q  V  G  S  Q  E  S  G  S  Q  F  C  P  Q  Q  S  D  M  Q  I  W  S  S  R  I  H  H  Y  *  *  R  C  K  S  Q  Q  S  S  D  E  R  D  M  *  S  I  Q  D  Y  S  P  E  V  N  C  L  S  P  S  N  E  R  S  C  R  G  R  Q  Q  E  Y  Q  E  N  F  E  E  N  D  *  Q  A  A  R  L  A  *  N  I  V  V  C  S  T  R  L  S  N  D  G  Q  N  I  D  W  G  Y  S  I  L  A  S  I  R  N  R  S  S  R  T  Y  *  S  R  H  A  V  T  K  D  H  P  R  S  *  I  K  *  R  *  V  G  *  Q  T  D  *  S  T  N  F  D  *  *  E  E  D  G  R  C  L  P  L  P  V  V  *  T  K  N  D  S  R  F  S  Q  K  S  K  S  Q  N  F  E  V  G  Q  L  V  L  K  R  I  F  P  H  Q  D  E  Y  K  G  K  F  A  P  N   </second_frame>
            <third_frame>   K  W  E  M  D  V  I  G  P  I  E  P  T  A  S  N  G  H  R  F  I  L  V  A  T  D  Y  F  T  K  W  V  E  A  A  S  Y  K  S  V  A  K  K  V  V  A  N  F  V  R  N  N  L  I  C  R  F  G  V  P  E  S  I  I  T  D  N  G  A  N  L  N  S  H  L  M  K  E  I  C  D  Q  F  K  I  I  H  R  R  S  T  A  Y  R  P  Q  M  N  G  V  V  E  A  A  N  K  N  I  K  K  I  L  R  K  M  I  D  K  Q  R  G  W  H  E  I  L  S  Y  A  L  L  G  Y  R  T  T  V  R  T  S  T  G  A  T  P  Y  L  L  V  Y  G  T  E  A  V  V  P  I  E  V  D  M  P  S  L  R  I  I  Q  E  A  E  L  S  N  A  E  W  V  S  K  R  I  D  Q  L  T  L  I  D  E  K  R  M  V  A  V  C  H  C  Q  L  Y  R  Q  R  M  T  R  A  F  H  K  R  V  R  A  R  I  L  K  L  A  S  W  F  L  S  V  F  F  L  I  K  M  S  T  K  E  S  S  H  Q  T  </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C07HBa0012A22.1" strand="-"/>
                <serials PGL_serial="10" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="79165" stop="78434"/>
                  </exon_boundaries>
                  <frame>2</frame>
                  <number_coding_nucleotides>732</number_coding_nucleotides>
                  <number_encoded_amino_acids>244</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>KWEMDVIGPIEPTASNGHRFILVATDYFTKWVEAASYKSVAKKVVANFVRNNLICRFGVPESIITDNGANLNSHLMKEICDQFKIIHRRSTAYRPQMNGVVEAANKNIKKILRKMIDKQRGWHEILSYALLGYRTTVRTSTGATPYLLVYGTEAVVPIEVDMPSLRIIQEAELSNAEWVSKRIDQLTLIDEKRMVAVCHCQLYRQRMTRAFHKRVRARILKLASWFLSVFFLIKMSTKESSHQT</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 258 chains have been computed
$ 
$ memory statistics:
$ 33920 bytes spliced alignments in total
$ 16 spliced alignments have been stored
$ 2120 bytes was the average size of a spliced alignment
$ 16112 bytes predicted gene locations in total
$ 10 predicted gene locations have been stored
$ 1611 bytes was the average size of a predicted gene location
$ 1 megabytes was the average size of the backtrace matrix
$ 323 backtrace matrices have been allocated
$ 
$ date finished: 2008-03-22 16:18:53
-->
