<?xml version="1.0" encoding="ISO-8859-1"?>
<GTH_output xmlns="http://www.genomethreader.org/GTH_output/" GTH_XML_version="1.1">
  <header xmlns="http://www.genomethreader.org/GTH_output/header/">
    <source program="GenomeThreader" version="0.9.54" build_date="2006-07-28 11:55:15" run_date="2009-02-23 14:51:04"/>
    <gDNA_template_files>
      <temp_name>/tmp/bac-submission-temp-C09HBa0317H24-PvB4U/GenomeThreader_SGN_markers/un_xed_seqs</temp_name>
    </gDNA_template_files>
    <reference_files>
      <file ref_name="/tmp/bac-submission-temp-C09HBa0317H24-PvB4U/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" type="ESTcDNA"/>
    </reference_files>
    <splice_site_parameters parameter_type="Bayesian" species="arabidopsis"/>
    <parameters>
      <parameter name="bssmfile" value="arabidopsis"/>
      <parameter name="scorematrixfile" value="BLOSUM62"/>
      <parameter name="searchmode" value="forward=True,reverse=True)"/>
      <parameter name="translationtable" value="1"/>
      <parameter name="frompos" value="0"/>
      <parameter name="topos" value="0"/>
      <parameter name="width" value="0"/>
      <parameter name="verbose" value="False"/>
      <parameter name="skipalignmentout" value="False"/>
      <parameter name="showintronmaxlen" value="120"/>
      <parameter name="minorflen" value="64"/>
      <parameter name="showseqnums" value="False"/>
      <parameter name="gs2out" value="False"/>
      <parameter name="maskpolyatails" value="False"/>
      <parameter name="noautoindex" value="False"/>
      <parameter name="minmatchlen" value="20"/>
      <parameter name="seedlength" value="16"/>
      <parameter name="exdrop" value="2"/>
      <parameter name="online" value="False"/>
      <parameter name="inverse" value="False"/>
      <parameter name="exact" value="False"/>
      <parameter name="chainwf" value="0.500000"/>
      <parameter name="gcmaxgapwidth" value="1000000"/>
      <parameter name="gcmincoverage" value="50"/>
      <parameter name="introncutout" value="False"/>
      <parameter name="autointroncutout" value="0"/>
      <parameter name="icinitialdelta" value="50"/>
      <parameter name="iciterations" value="2"/>
      <parameter name="icdeltaincrease" value="50"/>
      <parameter name="icminremintronlen" value="10"/>
      <parameter name="nou12intronmodel" value="False"/>
      <parameter name="u12donorprob" value="0.990000"/>
      <parameter name="u12donorprob1mism" value="0.900000"/>
      <parameter name="probies" value="0.500000"/>
      <parameter name="probdelgen" value="0.030000"/>
      <parameter name="identityweight" value="2.000000"/>
      <parameter name="mismatchweight" value="-2.000000"/>
      <parameter name="undetcharweight" value="0.000000"/>
      <parameter name="deletionweight" value="-4.000000"/>
      <parameter name="dpminexonlen" value="5"/>
      <parameter name="dpminintronlen" value="50"/>
      <parameter name="shortexonpenal" value="100"/>
      <parameter name="shortintronpenal" value="100"/>
      <parameter name="wzerotransition" value="80"/>
      <parameter name="wdecreasedoutput" value="80"/>
      <parameter name="leadcutoffsmode" value="RELAXED"/>
      <parameter name="termcutoffsmode" value="STRICT"/>
      <parameter name="cutoffsminexonlen" value="5"/>
      <parameter name="scoreminexonlen" value="50"/>
      <parameter name="minaveragessp" value="0.500000"/>
      <parameter name="minalignmentscore" value="0.900000"/>
      <parameter name="maxalignmentscore" value="1.000000"/>
      <parameter name="mincoverage" value="0.900000"/>
      <parameter name="maxcoverage" value="100.000000"/>
      <parameter name="intermediate" value="False"/>
      <parameter name="sortags" value="False"/>
      <parameter name="sortagswf" value="1.000000"/>
      <parameter name="first" value="0"/>
      <parameter name="exondistri" value="False"/>
      <parameter name="introndistri" value="False"/>
      <parameter name="refseqcovdistri" value="False"/>
    </parameters>
    <overall_reference_type>ESTcDNA</overall_reference_type>
  </header>
  <alignment_module>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C09HBa0317H24-PvB4U/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M1405" ref_strand="+" ref_description="SGN-M1405 T0312 [cos_markers]">
      <seq>aagaacttgaggctggttgctcaagaaaaagaaattgatgagaagaaacagactgatggggacagatggaagggacttgttaacgatgtgtccgatgatcaacaagacattgcaaggggtaaaggtttggttgattcgcttttccaggctccaacgggtactggtactcaccacgccatcatgaattcctatgaatacctcagccaaggtcttcgccaatataacttggacaacaagttggacggattctacatcgctcctgctttcatggacaagcttgttgttcacatcaccaagaacttcttaacgttgtccaacatcaaggttccacttattttgggtgtttggggaggaaaaggtcaaggtaaatcattccaatgtgagc</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C09HBa0317H24-PvB4U/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C09HBa0317H24.1" temp_strand="+" temp_description="C09HBa0317H24.1  AC234696.1 htgs_phase:1 submitted_to_sgn_as:gnl|gbrgsp|C09HBa0317H24 upload_account_name:spain (1 - 113452)">
        <position start="42106" stop="43318"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="42406" g_stop="42623" g_length="218"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="218" r_length="218" r_score="1.000"/>
        </exon>
        <intron i_serial="1">
          <gDNA_intron_boundary i_start="42624" i_stop="42762" i_length="139">
            <donor d_prob="0.998" d_score="1.00"/>
            <acceptor a_prob="0.989" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="2">
          <gDNA_exon_boundary g_start="42763" g_stop="42868" g_length="106"/>
          <reference_exon_boundary r_type="cDNA" r_start="219" r_stop="324" r_length="106" r_score="0.991"/>
        </exon>
        <intron i_serial="2">
          <gDNA_intron_boundary i_start="42869" i_stop="42957" i_length="89">
            <donor d_prob="0.983" d_score="0.98"/>
            <acceptor a_prob="0.999" a_score="1.00"/>
          </gDNA_intron_boundary>
        </intron>
        <exon e_serial="3">
          <gDNA_exon_boundary g_start="42958" g_stop="43018" g_length="61"/>
          <reference_exon_boundary r_type="cDNA" r_start="325" r_stop="385" r_length="61" r_score="1.000"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C09HBa0317H24.1" gen_strand="+" ref_id="SGN-M1405" ref_strand="+">
        <total_alignment_score>0.997</total_alignment_score>
        <cumulative_length_of_scored_exons>385</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C09HBa0317H24.1" gen_strand="+"/>
        <rDNA rDNA_id="SGN-M1405" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="42406" e_stop="42623"/>
          <exon e_start="42763" e_stop="42868"/>
          <exon e_start="42958" e_stop="43018"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAGAACTTGAGGCTGGTTGCTCAAGAAAAAGAAATTGATGAGAAGAAACAGACTGATGGGGACAGATGGAAGGGACTTGTTAACGATGTGTCCGATGATCAACAAGACATTGCAAGGGGTAAAGGTTTGGTTGATTCGCTTTTCCAGGCTCCAACGGGTACTGGTACTCACCACGCCATCATGAATTCCTATGAATACCTCAGCCAAGGTCTTCGCCAGTAAGTTGAACTGTGTGATCATCTTATCTAAAAGTTTATACTGCTGTTACAACTTGTATGATCATATTGTCTAAATGGTTAAGTTGTTAGAGAGAACACACTTTTATTTACTTGATTATATGTTTTGACATTCGATTAGATATAACTTGGACAACAAGTTGGACGGATTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTTCACATCACCAAGAACTTCTTAACGTTGCCCAACATCAAGGTCTGTTAAAGAGATGTTTGTTAAAAAATTCTGGCTTAAGTAGTGTTTTGTGTAAAAGAAGATTTGAACTTTGTTTATGTTTCTTACAGGTTCCACTTATTTTGGGTGTTTGGGGAGGAAAAGGTCAAGGTAAATCATTCCAATGTGAGC</genome_strand>
        <mrna_strand>AAGAACTTGAGGCTGGTTGCTCAAGAAAAAGAAATTGATGAGAAGAAACAGACTGATGGGGACAGATGGAAGGGACTTGTTAACGATGTGTCCGATGATCAACAAGACATTGCAAGGGGTAAAGGTTTGGTTGATTCGCTTTTCCAGGCTCCAACGGGTACTGGTACTCACCACGCCATCATGAATTCCTATGAATACCTCAGCCAAGGTCTTCGCCA...........................................................................................................................................ATATAACTTGGACAACAAGTTGGACGGATTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTTCACATCACCAAGAACTTCTTAACGTTGTCCAACATCAAG.........................................................................................GTTCCACTTATTTTGGGTGTTTGGGGAGGAAAAGGTCAAGGTAAATCATTCCAATGTGAGC</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
  <spliced_alignment xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
    <reference ref_file="/tmp/bac-submission-temp-C09HBa0317H24-PvB4U/gth_cdna_fileCXGN::BACSubmission::Analysis::GenomeThreader_SGN_markers" ref_id="SGN-M3167" ref_strand="+" ref_description="SGN-M3167 cTOB-1-K3 [est_clones]">
      <seq>aaaatttcagattccttcacacatcctctctctctgtccccaaaactcaaacactttcaattcacaatggaattacttctcttcttcttcctcacaccatttctcttctttattaactgctcttccattactcaaatttcttcaccattgttgattttacccctaaaaactcaacaaatctcatctgggttttcatctccaaataaactcccatttactcacaatgttactcttactgtttccctttcagttggtacacctccacagaatgtaacaatggtgctcgatactgctagtgaactttcatggctacattcaaattcaacccgaatcaaacaacccattttcaaccccaaccgttcactctcctacagacccgtttcttgctccgaacccatttgcacgacccgaacccaagatttttccataccagcttcttgtgattcgaagaatttctgtcatgctgtgctttcttacgcagatgcttcgtcttcagaagggaatttagctatggatacgtttacgattggcgggtcgaattttacgggtacgatattcgggtcaatggattcgggtttcagtagtgattcggatgaagatgaaaagacaaccgggttaatgggtatgaacccgggatctctatctt</seq>
    </reference>
    <gDNA_segment>
      <template temp_file="/tmp/bac-submission-temp-C09HBa0317H24-PvB4U/GenomeThreader_SGN_markers/un_xed_seqs" temp_id="C09HBa0317H24.1" temp_strand="-" temp_description="C09HBa0317H24.1  AC234696.1 htgs_phase:1 submitted_to_sgn_as:gnl|gbrgsp|C09HBa0317H24 upload_account_name:spain (1 - 113452)">
        <position start="73387" stop="72142"/>
      </template>
    </gDNA_segment>
    <predicted_gene_structure xmlns="http://www.genomethreader.org/GTH_output/alignment_module/spliced_alignment/">
      <exon-intron_info>
        <exon e_serial="1">
          <gDNA_exon_boundary g_start="73087" g_stop="72442" g_length="646"/>
          <reference_exon_boundary r_type="cDNA" r_start="1" r_stop="646" r_length="646" r_score="0.994"/>
        </exon>
      </exon-intron_info>
      <MATCH_line gen_id="C09HBa0317H24.1" gen_strand="-" ref_id="SGN-M3167" ref_strand="+">
        <total_alignment_score>0.994</total_alignment_score>
        <cumulative_length_of_scored_exons>646</cumulative_length_of_scored_exons>
        <coverage percentage="1.000" high_type="C"/>
      </MATCH_line>
      <PGS_line>
        <gDNA gen_id="C09HBa0317H24.1" gen_strand="-"/>
        <rDNA rDNA_id="SGN-M3167" rDNA_strand="+"/>
        <gDNA_exon_coordinates>
          <exon e_start="73087" e_stop="72442"/>
        </gDNA_exon_coordinates>
      </PGS_line>
      <alignment>
        <genome_strand>AAAATTTCAGATTCCTTCACACATCCTCTCTCTCTGTCCCCAAAACTCAAACACTTTCAATTCACAATGGAATTACTTCTCTTCTTCTTCCTCACACCATTTCTCTTCTTTATTAACTGTTCTTCCATTACTCAAATTTCTTCACCATTGTTGATTTTACCCCTAAAAACTCAACAAATCTCATCTGGGTTTTCATCTCCAAATAAACTCCCATTTACTCACAATGTTACTCTTACTGTTTCCCTTTCAGTTGGTACACCTCCACAGAATGTAACAATGGTGCTCGATACTGGTAGTGAACTTTCATGGCTACATTCAAATTCAACCCGAATCAAACAACCCATTTTCAACCCCAACCGTTCACTCTCCTACAGACCCGTTTCTTGCTCCGAACCCATTTGCACGACCCGAACCCAAGATTTTTCCATACCAGCTTCTTGTGATTCGAAGAATTTCTGTCATGCTGTGCTTTCTTACGCAGATGCTTCGTCTTCAGAAGGGAATTTAGCTATGGATACGTTTACGATTGGCGGGTCGAATTTTACGGGTACGATATTCGGGTCAATGGATTCGGGTTTCAGTAGTGATTCGGATGAAGATGAAAAGACAACCGGGTTAATGGGTATGAACCGTGGATCTCTATCTT</genome_strand>
        <mrna_strand>AAAATTTCAGATTCCTTCACACATCCTCTCTCTCTGTCCCCAAAACTCAAACACTTTCAATTCACAATGGAATTACTTCTCTTCTTCTTCCTCACACCATTTCTCTTCTTTATTAACTGCTCTTCCATTACTCAAATTTCTTCACCATTGTTGATTTTACCCCTAAAAACTCAACAAATCTCATCTGGGTTTTCATCTCCAAATAAACTCCCATTTACTCACAATGTTACTCTTACTGTTTCCCTTTCAGTTGGTACACCTCCACAGAATGTAACAATGGTGCTCGATACTGCTAGTGAACTTTCATGGCTACATTCAAATTCAACCCGAATCAAACAACCCATTTTCAACCCCAACCGTTCACTCTCCTACAGACCCGTTTCTTGCTCCGAACCCATTTGCACGACCCGAACCCAAGATTTTTCCATACCAGCTTCTTGTGATTCGAAGAATTTCTGTCATGCTGTGCTTTCTTACGCAGATGCTTCGTCTTCAGAAGGGAATTTAGCTATGGATACGTTTACGATTGGCGGGTCGAATTTTACGGGTACGATATTCGGGTCAATGGATTCGGGTTTCAGTAGTGATTCGGATGAAGATGAAAAGACAACCGGGTTAATGGGTATGAACCCGGGATCTCTATCTT</mrna_strand>
      </alignment>
    </predicted_gene_structure>
  </spliced_alignment>
    <total_number_ESTs_reported>2</total_number_ESTs_reported>
    </alignment_module>
  <PGL_module xmlns="http://www.genomethreader.org/GTH_output/PGL_module/">
    <predicted_gene_location>
      <PGL_line PGL_serial="1" PGL_strand="+" PGL_start="42406" PGL_stop="43018"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="42406" e_stop="42623"/>
            <exon e_start="42763" e_stop="42868"/>
            <exon e_start="42958" e_stop="43018"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-intron don_prob="0.998" acc_prob="0.989" e_score="1.000"/>
          <exon-intron don_prob="0.983" acc_prob="0.999" e_score="0.991"/>
          <exon-only e_score="1.000"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="1.000">
            <gDNA_exon_boundary e_start="42406" e_stop="42623" e_length="218"/>
          </exon>
          <intron i_serial="1" don_prob="0.998" acc_prob="0.989">
            <gDNA_intron_boundary i_start="42624" i_stop="42762" i_length="139"/>
          </intron>
          <exon e_serial="2" e_score="0.991">
            <gDNA_exon_boundary e_start="42763" e_stop="42868" e_length="106"/>
          </exon>
          <intron i_serial="2" don_prob="0.983" acc_prob="0.999">
            <gDNA_intron_boundary i_start="42869" i_stop="42957" i_length="89"/>
          </intron>
          <exon e_serial="3" e_score="1.000">
            <gDNA_exon_boundary e_start="42958" e_stop="43018" e_length="61"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="42406" stop="42623"/>
              <exon start="42763" stop="42868"/>
              <exon start="42958" stop="43018"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M1405" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="1" AGS_serial="1" gDNA_strand="+"/>
          <translation>
            <gDNA_template>AAGAACTTGAGGCTGGTTGCTCAAGAAAAAGAAATTGATGAGAAGAAACAGACTGATGGGGACAGATGGAAGGGACTTGTTAACGATGTGTCCGATGATCAACAAGACATTGCAAGGGGTAAAGGTTTGGTTGATTCGCTTTTCCAGGCTCCAACGGGTACTGGTACTCACCACGCCATCATGAATTCCTATGAATACCTCAGCCAAGGTCTTCGCCA : ATATAACTTGGACAACAAGTTGGACGGATTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTTCACATCACCAAGAACTTCTTAACGTTGCCCAACATCAAG : GTTCCACTTATTTTGGGTGTTTGGGGAGGAAAAGGTCAAGGTAAATCATTCCAATGTGAGC</gDNA_template>
            <first_frame> K  N  L  R  L  V  A  Q  E  K  E  I  D  E  K  K  Q  T  D  G  D  R  W  K  G  L  V  N  D  V  S  D  D  Q  Q  D  I  A  R  G  K  G  L  V  D  S  L  F  Q  A  P  T  G  T  G  T  H  H  A  I  M  N  S  Y  E  Y  L  S  Q  G  L  R  Q :   Y  N  L  D  N  K  L  D  G  F  Y  I  A  P  A  F  M  D  K  L  V  V  H  I  T  K  N  F  L  T  L  P  N  I  K  :  V  P  L  I  L  G  V  W  G  G  K  G  Q  G  K  S  F  Q  C  E  </first_frame>
            <second_frame>  R  T  *  G  W  L  L  K  K  K  K  L  M  R  R  N  R  L  M  G  T  D  G  R  D  L  L  T  M  C  P  M  I  N  K  T  L  Q  G  V  K  V  W  L  I  R  F  S  R  L  Q  R  V  L  V  L  T  T  P  S  *  I  P  M  N  T  S  A  K  V  F  A   : N  I  T  W  T  T  S  W  T  D  S  T  S  L  L  L  S  W  T  S  L  L  F  T  S  P  R  T  S  *  R  C  P  T  S  R :   F  H  L  F  W  V  F  G  E  E  K  V  K  V  N  H  S  N  V  S </second_frame>
            <third_frame>   E  L  E  A  G  C  S  R  K  R  N  *  *  E  E  T  D  *  W  G  Q  M  E  G  T  C  *  R  C  V  R  *  S  T  R  H  C  K  G  *  R  F  G  *  F  A  F  P  G  S  N  G  Y  W  Y  S  P  R  H  H  E  F  L  *  I  P  Q  P  R  S  S  P  :  I  *  L  G  Q  Q  V  G  R  I  L  H  R  S  C  F  H  G  Q  A  C  C  S  H  H  Q  E  L  L  N  V  A  Q  H  Q   : G  S  T  Y  F  G  C  L  G  R  K  R  S  R  *  I  I  P  M  *   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C09HBa0317H24.1" strand="+"/>
                <serials PGL_serial="1" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="42406" stop="42623"/>
                    <exon start="42763" stop="42868"/>
                    <exon start="42958" stop="43017"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>384</number_coding_nucleotides>
                  <number_encoded_amino_acids>128</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>KNLRLVAQEKEIDEKKQTDGDRWKGLVNDVSDDQQDIARGKGLVDSLFQAPTGTGTHHAIMNSYEYLSQGLRQYNLDNKLDGFYIAPAFMDKLVVHITKNFLTLPNIKVPLILGVWGGKGQGKSFQCE</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
    <predicted_gene_location>
      <PGL_line PGL_serial="2" PGL_strand="-" PGL_start="73087" PGL_stop="72442"/>
      <AGS_information>
        <AGS_line AGS_serial="1">
          <exon_coordinates>
            <exon e_start="73087" e_stop="72442"/>
          </exon_coordinates>
        </AGS_line>
        <SCR_line>
          <exon-only e_score="0.994"/>
        </SCR_line>
        <exon-intron_info xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/exon-intron_info/">
          <exon e_serial="1" e_score="0.994">
            <gDNA_exon_boundary e_start="73087" e_stop="72442" e_length="646"/>
          </exon>
        </exon-intron_info>
        <supporting_evidence xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/supporting_evidence/">
          <PGS_line>
            <gDNA_exon_coordinates>
              <exon start="73087" stop="72442"/>
            </gDNA_exon_coordinates>
            <referenceDNA id="SGN-M3167" strand="+"/>
          </PGS_line>
        </supporting_evidence>
        <three_phase_translation xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/">
          <description PGL_serial="2" AGS_serial="1" gDNA_strand="-"/>
          <translation>
            <gDNA_template>AAAATTTCAGATTCCTTCACACATCCTCTCTCTCTGTCCCCAAAACTCAAACACTTTCAATTCACAATGGAATTACTTCTCTTCTTCTTCCTCACACCATTTCTCTTCTTTATTAACTGTTCTTCCATTACTCAAATTTCTTCACCATTGTTGATTTTACCCCTAAAAACTCAACAAATCTCATCTGGGTTTTCATCTCCAAATAAACTCCCATTTACTCACAATGTTACTCTTACTGTTTCCCTTTCAGTTGGTACACCTCCACAGAATGTAACAATGGTGCTCGATACTGGTAGTGAACTTTCATGGCTACATTCAAATTCAACCCGAATCAAACAACCCATTTTCAACCCCAACCGTTCACTCTCCTACAGACCCGTTTCTTGCTCCGAACCCATTTGCACGACCCGAACCCAAGATTTTTCCATACCAGCTTCTTGTGATTCGAAGAATTTCTGTCATGCTGTGCTTTCTTACGCAGATGCTTCGTCTTCAGAAGGGAATTTAGCTATGGATACGTTTACGATTGGCGGGTCGAATTTTACGGGTACGATATTCGGGTCAATGGATTCGGGTTTCAGTAGTGATTCGGATGAAGATGAAAAGACAACCGGGTTAATGGGTATGAACCGTGGATCTCTATCTT</gDNA_template>
            <first_frame> K  I  S  D  S  F  T  H  P  L  S  L  S  P  K  L  K  H  F  Q  F  T  M  E  L  L  L  F  F  F  L  T  P  F  L  F  F  I  N  C  S  S  I  T  Q  I  S  S  P  L  L  I  L  P  L  K  T  Q  Q  I  S  S  G  F  S  S  P  N  K  L  P  F  T  H  N  V  T  L  T  V  S  L  S  V  G  T  P  P  Q  N  V  T  M  V  L  D  T  G  S  E  L  S  W  L  H  S  N  S  T  R  I  K  Q  P  I  F  N  P  N  R  S  L  S  Y  R  P  V  S  C  S  E  P  I  C  T  T  R  T  Q  D  F  S  I  P  A  S  C  D  S  K  N  F  C  H  A  V  L  S  Y  A  D  A  S  S  S  E  G  N  L  A  M  D  T  F  T  I  G  G  S  N  F  T  G  T  I  F  G  S  M  D  S  G  F  S  S  D  S  D  E  D  E  K  T  T  G  L  M  G  M  N  R  G  S  L  S  </first_frame>
            <second_frame>  K  F  Q  I  P  S  H  I  L  S  L  C  P  Q  N  S  N  T  F  N  S  Q  W  N  Y  F  S  S  S  S  S  H  H  F  S  S  L  L  T  V  L  P  L  L  K  F  L  H  H  C  *  F  Y  P  *  K  L  N  K  S  H  L  G  F  H  L  Q  I  N  S  H  L  L  T  M  L  L  L  L  F  P  F  Q  L  V  H  L  H  R  M  *  Q  W  C  S  I  L  V  V  N  F  H  G  Y  I  Q  I  Q  P  E  S  N  N  P  F  S  T  P  T  V  H  S  P  T  D  P  F  L  A  P  N  P  F  A  R  P  E  P  K  I  F  P  Y  Q  L  L  V  I  R  R  I  S  V  M  L  C  F  L  T  Q  M  L  R  L  Q  K  G  I  *  L  W  I  R  L  R  L  A  G  R  I  L  R  V  R  Y  S  G  Q  W  I  R  V  S  V  V  I  R  M  K  M  K  R  Q  P  G  *  W  V  *  T  V  D  L  Y  L </second_frame>
            <third_frame>   N  F  R  F  L  H  T  S  S  L  S  V  P  K  T  Q  T  L  S  I  H  N  G  I  T  S  L  L  L  P  H  T  I  S  L  L  Y  *  L  F  F  H  Y  S  N  F  F  T  I  V  D  F  T  P  K  N  S  T  N  L  I  W  V  F  I  S  K  *  T  P  I  Y  S  Q  C  Y  S  Y  C  F  P  F  S  W  Y  T  S  T  E  C  N  N  G  A  R  Y  W  *  *  T  F  M  A  T  F  K  F  N  P  N  Q  T  T  H  F  Q  P  Q  P  F  T  L  L  Q  T  R  F  L  L  R  T  H  L  H  D  P  N  P  R  F  F  H  T  S  F  L  *  F  E  E  F  L  S  C  C  A  F  L  R  R  C  F  V  F  R  R  E  F  S  Y  G  Y  V  Y  D  W  R  V  E  F  Y  G  Y  D  I  R  V  N  G  F  G  F  Q  *  *  F  G  *  R  *  K  D  N  R  V  N  G  Y  E  P  W  I  S  I   </third_frame>
          </translation>
          <probable_ORFs xmlns="http://www.genomethreader.org/GTH_output/PGL_module/predicted_gene_location/AGS_information/three_phase_translation/probable_ORFs/">
            <orf_entry>
              <id_line>
                <gDNA id="C09HBa0317H24.1" strand="-"/>
                <serials PGL_serial="2" AGS_serial="1" PPS_serial="1"/>
                <orf_info>
                  <exon_boundaries>
                    <exon start="73087" stop="72443"/>
                  </exon_boundaries>
                  <frame>0</frame>
                  <number_coding_nucleotides>645</number_coding_nucleotides>
                  <number_encoded_amino_acids>215</number_encoded_amino_acids>
                </orf_info>
              </id_line>
              <predicted_protein_sequence>KISDSFTHPLSLSPKLKHFQFTMELLLFFFLTPFLFFINCSSITQISSPLLILPLKTQQISSGFSSPNKLPFTHNVTLTVSLSVGTPPQNVTMVLDTGSELSWLHSNSTRIKQPIFNPNRSLSYRPVSCSEPICTTRTQDFSIPASCDSKNFCHAVLSYADASSSEGNLAMDTFTIGGSNFTGTIFGSMDSGFSSDSDEDEKTTGLMGMNRGSLS</predicted_protein_sequence>
            </orf_entry>
          </probable_ORFs>
        </three_phase_translation>
      </AGS_information>
    </predicted_gene_location>
  </PGL_module>
</GTH_output>
<!--
$ general statistics:
$ 5 chains have been computed
$ 
$ memory statistics:
$ 4320 bytes spliced alignments in total
$ 2 spliced alignments have been stored
$ 2160 bytes was the average size of a spliced alignment
$ 6768 bytes predicted gene locations in total
$ 2 predicted gene locations have been stored
$ 3384 bytes was the average size of a predicted gene location
$ 0 megabytes was the average size of the backtrace matrix
$ 5 backtrace matrices have been allocated
$ 
$ date finished: 2009-02-23 14:51:10
-->
