Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0191N02_T7_114667

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0191N02_T7_114667
Primer
T7
ID from Seq. Facility
LE_HBa_191_N02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
2 trimmed for vector and quality, 866 raw
Sequence
>LE_HBa0191N02_T7_114667 (raw untrimmed)
TGTTCGCGTACACAAATATTAATTTCGAAAGGGGGTGCCTCTTTATCAATATCCCTCTTTCATGTGGGTGCTCCACTGACGGTACGGATGCGGCACTCAA
TAACCATGGAGCACCGAGGATCTGCACTACGACTCTAGATACAAGGGCACGACCACGACATTGACCCCAACTACCGCGCGGACACGCCACAACACACTTC
CATCACACAATTGTCACCCAAAGACTGATTATATTGCAATATTCGTTCCCCACTGCCGAGGAGGGGAGGAGAGCTGGACTAGTAAGACAGAACGATTCTA
CACTGATACGGCTTAGGACCGAGCGGAATTAGCCTACAAAGCAAGAGAAGCTGAGTGTTGTCTATCCTCCTGCTCTCATGCTTCGCGCTTTACTAATAAA
GAAGAGTGGAGGCGTGGGGGGATATAAAAATACGGCTATATTTTTTACACCCCCCCCGAAATGCAGCCACTACGTAAATAAAAGAGAAGGGAGGGGGACT
TATGCACGTTGTTGAATCTGAAGATAATAATGCCCCGCGCCGCAATTGTGTAAGTGTGGAGTAAATGTGATGAGGGCAAGAGGAGTGAGGATTCTAATCT
TATGACAAGTGCTTTTTTTATTTTTAGTTTTTGTTATTGTTTCTATTATTATTTCTTTTATACTTCTGTAGTGTAATCCATGGTATTCGTGTGATATATA
GTATCTTATACTAACCTCTTTCCATGTTGAGTTTTGCTCGACGTTGGGATCTAATGGACGCGCTCACCTCTATTTCTATTCTATTGTGTTGCTGCATTGT
CTTTTATTTATTTTAT
TTTTTTTTATTTGTTTTGTCAGAGATCTCGTACGTTGTGTCTAGTCTTGC
>LE_HBa0191N02_T7_114667 (trimmed for quality and cloning vector)
TT

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
4.3688
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0191N02
Clone
Clone name
hba-191n2
LE_HBa0191N02
P191N02
Clone type
BAC
Contamination
none
Estimated length
90,771
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found