Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0018F09_SP6_131189

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018F09_SP6_131189
Primer
SP6
ID from Seq. Facility
LE_HBa_018_F09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
628 trimmed for vector and quality, 916 raw
Sequence
>LE_HBa0018F09_SP6_131189 (raw untrimmed)
TTCTTTCCCGGATGGTACCTNTCCACCAAGAGTTTTTGCATCACCTCGACAAATACATTAGTGGTAATATTCAACTTATCAGCGTCTGGCACTCTTGCTG
CAGTAAAGTATTGTTCTATGTCCCATATGAAATTTTCAAGTTCTTTAGCACTCCTTGCGCCACTGAATGCTTTAGGGTCTGGAATCTTGACCTTAGATGA
TTCAACACGAGTCGAACTCAACATAGCCACAGCCCGACACAAGACAACGAGTTCTGCACGAAAGTTTTCATTTTTCTTCTGCAGTCCCTCTAGTTTCTGT
GTAGTTGTGGAACGGAAGTCCAAGATTTCAGTGATGTGGTTATCAACATTCTGTCGATACCCACCAATTTCTCCCTGAACTTTCTCAGCGTCCACTCTCA
ACTCAATGATTTGTGTGAATAAATCCACAAACGTAGGGTCTGCCAGGATATCTTCAGTAAACCCGACGAAGGATTCAATTCTTCTTGCCAATTCCCACAA
TTCTGCGTTTTTCATCATTATTTAACCTTGCTCTGATACCAATTGAAAGAGGGTCGATTTATTTTTGTCGCACACCACTCTAGGCAGTCTTACAGCGTCT
GTAATACTTCAGCCTACTTAAACCCACAGAGTTGACTAAGTATAGAAATACTTAAACAGCAATGTCAAACAAGCAATAAACAAGCAGCGTTTACAGGAAC
AAGTCCCAACCTTTTATTAATCAATTATTAATACAAAAGGAAGGCTTTCCCAATTCAGTCTAAAGCTAGAAAACTTCTCTCCTCCTTGCCCTTAAAACAA
ATTTCAACCTTAAAATCAAAAATTCTGCAAAAAGGGCAATTTAAATGCCATTTTACCTGCCGGCGGGTTACCAAATGAACACCCTGGTCCCAAACACATG
GTCCACCCCCCGGGGT
>LE_HBa0018F09_SP6_131189 (trimmed for quality and cloning vector)
ATCACCTCGACAAATACATTAGTGGTAATATTCAACTTATCAGCGTCTGGCACTCTTGCTGCAGTAAAGTATTGTTCTATGTCCCATATGAAATTTTCAA
GTTCTTTAGCACTCCTTGCGCCACTGAATGCTTTAGGGTCTGGAATCTTGACCTTAGATGATTCAACACGAGTCGAACTCAACATAGCCACAGCCCGACA
CAAGACAACGAGTTCTGCACGAAAGTTTTCATTTTTCTTCTGCAGTCCCTCTAGTTTCTGTGTAGTTGTGGAACGGAAGTCCAAGATTTCAGTGATGTGG
TTATCAACATTCTGTCGATACCCACCAATTTCTCCCTGAACTTTCTCAGCGTCCACTCTCAACTCAATGATTTGTGTGAATAAATCCACAAACGTAGGGT
CTGCCAGGATATCTTCAGTAAACCCGACGAAGGATTCAATTCTTCTTGCCAATTCCCACAATTCTGCGTTTTTCATCATTATTTAACCTTGCTCTGATAC
CAATTGAAAGAGGGTCGATTTATTTTTGTCGCACACCACTCTAGGCAGTCTTACAGCGTCTGTAATACTTCAGCCTACTTAAACCCACAGAGTTGACTAA
GTATAGAAATACTTAAACAGCAATGTCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.969566
Expected error %
0.2057
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD13304.1| Score 290 E Value 2e-77 Identity 31.60% Align. Length 458bp (72.93%) Frame 1
polyprotein [Lycopersicon esculentum] pir||T17459 polyprotein - tomato
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU90321.1| Score 106 E Value 5e-22 Identity 13.70% Align. Length 452bp (71.97%) Frame 1
hypothetical protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018F09
Clone
Clone name
hba-18f9
LE_HBa0018F09
P018F09
Clone type
BAC
Contamination
none
Estimated length
91,819
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found