Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0018F09_T7_131190

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0018F09_T7_131190
Primer
T7
ID from Seq. Facility
LE_HBa_018_F09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
787 trimmed for vector and quality, 912 raw
Sequence
>LE_HBa0018F09_T7_131190 (raw untrimmed)
CGGGGACCGAGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAAACTATTTAAACTTCACTGTTTTCCTTATCGGCTTCATCAAAGGAGACAAA
ATGGACGAGACACACTTTACAAATTTTCAAGTTACTAGATAAACCCAAGAAACTCCTAATATGAGATGGAGATGTGGGTATAGGCCAATTTTCTGTTACC
TAAATATTTTGGTTATCAACTCTAATACCATCACCAAAAATTATCTACCCATGAATTCCACAGACTCAAGCCAAAACTCGCACTTAAAGAACCAGGCATA
CAACTCTCAATCCTTAAAAGTCTGAAGAACTATTCTGAGATGACAAATATGATCTTCTTCATTCCTTCAAGAGATAAGTATGTCATTAATGAAGGCGATA
ATAAACAAATCTAAAGAAGTTTTCAAGACGTTATTCATAATATCTACGAATGTTGCAGGTGCATTGGTCAATCCAAAGGACATGATCAAAAGCTCATAGT
GCCCATATCTTGTTCTAAAAGTTGTCTTTGGAATATCACATTGCGTACTCTCAACATGTGGTAGTTTGATCTAAGTTCAATCATTGAAAAACAAAATGCA
CCCCAAATCTTATTCAAAAGATCATCAATTCTAGGAAGAGGATACTGATTCGTAATGGTAACCTTTTTCAACTATTGTTAATCTATACATATCTTAAGGG
ATCCATCCTTCTTTCTCACAAATAAGAGCGAAGCCCCGCAAGGTTTGACACTTGGCTAAATGAATCCTTTCTCTAAAAGGTATTTTAACCTCTCTTTTAA
CTATTTCACTTCTTTTGGTGCTATTTTATATGGCCGGAATTAGAAATACCAACAAAGTATTTTTAAAGAAAAATTTTATACCCCAAATTTCCTTTCTTTT
CTTTAGGGGGGG
>LE_HBa0018F09_T7_131190 (trimmed for quality and cloning vector)
AGCTTCAAACTATTTAAACTTCACTGTTTTCCTTATCGGCTTCATCAAAGGAGACAAAATGGACGAGACACACTTTACAAATTTTCAAGTTACTAGATAA
ACCCAAGAAACTCCTAATATGAGATGGAGATGTGGGTATAGGCCAATTTTCTGTTACCTAAATATTTTGGTTATCAACTCTAATACCATCACCAAAAATT
ATCTACCCATGAATTCCACAGACTCAAGCCAAAACTCGCACTTAAAGAACCAGGCATACAACTCTCAATCCTTAAAAGTCTGAAGAACTATTCTGAGATG
ACAAATATGATCTTCTTCATTCCTTCAAGAGATAAGTATGTCATTAATGAAGGCGATAATAAACAAATCTAAAGAAGTTTTCAAGACGTTATTCATAATA
TCTACGAATGTTGCAGGTGCATTGGTCAATCCAAAGGACATGATCAAAAGCTCATAGTGCCCATATCTTGTTCTAAAAGTTGTCTTTGGAATATCACATT
GCGTACTCTCAACATGTGGTAGTTTGATCTAAGTTCAATCATTGAAAAACAAAATGCACCCCAAATCTTATTCAAAAGATCATCAATTCTAGGAAGAGGA
TACTGATTCGTAATGGTAACCTTTTTCAACTATTGTTAATCTATACATATCTTAAGGGATCCATCCTTCTTTCTCACAAATAAGAGCGAAGCCCCGCAAG
GTTTGACACTTGGCTAAATGAATCCTTTCTCTAAAAGGTATTTTAACCTCTCTTTTAACTATTTCACTTCTTTTGGTGCTATTTTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.951936
Expected error %
1.1976
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39297.1| Score 162 E Value 1e-64 Identity 54.50% Align. Length 724bp (91.99%) Frame 2
putative gag-pol protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 160 E Value 2e-51 Identity 53.90% Align. Length 628bp (79.80%) Frame 2
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0018F09
Clone
Clone name
hba-18f9
LE_HBa0018F09
P018F09
Clone type
BAC
Contamination
none
Estimated length
91,819
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found