Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0026O03_SP6_136985

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0026O03_SP6_136985
Primer
SP6
ID from Seq. Facility
LE_HBa_026_O03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
685 trimmed for vector and quality, 843 raw
Sequence
>LE_HBa0026O03_SP6_136985 (raw untrimmed)
CTTGGAGACCCTTACCTCTTGATTCATCAGGTTCAAGGTGAATGGGCTGTCAAGAACCCGAAAAAATTATACCTTACGTACAATATGTGCAAAATCTGTG
CAAAAGATTTCGCAGGATCGAGTTCAGACATACTCCCAGAATACAGAATGAATTAGCCGAAGCTCTTGCCACCATCGCTTCGATGATCAAACATCCGGAT
ACTGATTACATCGACCCGCTGGATATAGAGTTGAAGGAACATCCACTCCATTGTTCACATGTTGAATTAGAATAAGACGGTTTGCCTTTGTATTTTGACA
TAAAGAGGTACTTGGAGTCTGGGACATATCCAGAAGACGCTACATCCAATCAGAAGAAGTCGATACGCTGTATGACTCTCAATTTCTTTCTAAATGAAGA
AGTCCTGTATAGGAGGACTCCAGACTTAGGTCTTTTAAGATGTGTGGATGCTGCTGAAGCTGTGAGGCTTATTGAACAGATACATGCTGGAGTTTGTGGT
ACACATATGAATGGACTTACTTTGGCAAGAAAGATTCTTCGAGCCGGTTATTTCTGGATGACTATGGAGAATGACTGTTGCAAATTCGTGCAAAAATGCC
ACAGATGTCAAGTGCACGGCGATTTGATACGGGTGCCACCTCACGAACCTTAATGATATGAGCTCAACTTGGCCATTTGTTGCTTGGGGAATGGACGTCA
TCTTGTCTATAGAGCCCGGCGCCTTCTATGGACAGATTCATTTTGGGTTGCCATGGATTATTTTCCCAAGTGGGTGGGAGGCAGCTTCTTCCAGTCTGTT
ACCAAGAAAGAGGATGCGAATTTGGTCGCAACAACTAATATGA
>LE_HBa0026O03_SP6_136985 (trimmed for quality and cloning vector)
CCTCTTGATTCATCAGGTTCAAGGTGAATGGGCTGTCAAGAACCCGAAAAAATTATACCTTACGTACAATATGTGCAAAATCTGTGCAAAAGATTTCGCA
GGATCGAGTTCAGACATACTCCCAGAATACAGAATGAATTAGCCGAAGCTCTTGCCACCATCGCTTCGATGATCAAACATCCGGATACTGATTACATCGA
CCCGCTGGATATAGAGTTGAAGGAACATCCACTCCATTGTTCACATGTTGAATTAGAATAAGACGGTTTGCCTTTGTATTTTGACATAAAGAGGTACTTG
GAGTCTGGGACATATCCAGAAGACGCTACATCCAATCAGAAGAAGTCGATACGCTGTATGACTCTCAATTTCTTTCTAAATGAAGAAGTCCTGTATAGGA
GGACTCCAGACTTAGGTCTTTTAAGATGTGTGGATGCTGCTGAAGCTGTGAGGCTTATTGAACAGATACATGCTGGAGTTTGTGGTACACATATGAATGG
ACTTACTTTGGCAAGAAAGATTCTTCGAGCCGGTTATTTCTGGATGACTATGGAGAATGACTGTTGCAAATTCGTGCAAAAATGCCACAGATGTCAAGTG
CACGGCGATTTGATACGGGTGCCACCTCACGAACCTTAATGATATGAGCTCAACTTGGCCATTTGTTGCTTGGGGAATGGACGTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.977059
Expected error %
0.4762
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89777.1| Score 215 E Value 7e-55 Identity 23.40% Align. Length 443bp (64.67%) Frame 2
gag-pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39963.1| Score 187 E Value 2e-46 Identity 17.80% Align. Length 482bp (70.36%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0026O03
Clone
Clone name
hba-26o3
LE_HBa0026O03
P026O03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found