Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0028D10_T7_138008

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0028D10_T7_138008
Primer
T7
ID from Seq. Facility
LE_HBa_028_D10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
790 trimmed for vector and quality, 1017 raw
Genbank Accession
Sequence
>LE_HBa0028D10_T7_138008 (raw untrimmed)
ACCCGGGGACCGGGGGAATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAGACGACACAAACATGACCTACTCGGGTATCAAATATATGGAATTGTT
TCCAGAACAAAAAAAATGCAACATACGCTCGTGCATTTCAGTTACATGCAAAAGTTTCCACAGAATTCAGGACATCCATAGATTTCCTTTTGTTGATGAT
AAATTAATTAAGCAATCAAGAACTCAGACAGAGAGCCACAGATTACAAATAGGAGTATTTACAGTTATTTGAGATGAATAAACCTGCACAAGGACTTCAA
ACATTGACCAAATGGCTAACCATGTAGTACAAGGAAATAGACATTAAGACTCCAAAATGATGAAGCAAATCAATCATAAGAAAGAAGGAAAATCCCTAGT
TTTAAAGGAACATATGGACAAGGTAAGAATTAAAGATGAAACCGATAAAACCAAATAAACAACTAAGTGTCCAACAGCTGAAGGTGGTAAAGACTACCCT
TTTAGACTAACCTTCATCAGACATTCAGACATTTGCTCCCACTGGCTTGAAGCAATCAATATTGCACAATACGGCAGATCTCATCATGTTGCCAAAGCTG
CCACCAATAACATCTATCAGTCATAACAGTTATCACATTTTATACAAGATAAGGCTATTCTGAATTAACATAGCGGCAAAAGAGACAAAAATAAATAAAG
TGAAGAACTCTTAGACAGTAGTAACCTAACCGATCAATGCTTTTTTCTAGCTTTCTCTTGTTGTTCTGTATTATCATTTGCCTTATCCTGAGAGATCCAC
CCTCTTGCTCGACTTCTCCTTGCGTCCATGCTAGCTCTGGATTTTTCTCTTTGATCTGTGCTTATTCTAGGCTCTCTTCTTCCCGTGCTTAGCCCAGATT
TTTCCTCTGATTTGTGCTCGACGGGGGCCTCAATCGTAACTGCTCGAGGTTTATCTTTTGGGTTAAGCTAAAAGCGAATCTTTTCTAAAACTGTTGAATT
TCCATAGCTGAATGAAC
>LE_HBa0028D10_T7_138008 (trimmed for quality and cloning vector)
AGCTTCAGACGACACAAACATGACCTACTCGGGTATCAAATATATGGAATTGTTTCCAGAACAAAAAAAATGCAACATACGCTCGTGCATTTCAGTTACA
TGCAAAAGTTTCCACAGAATTCAGGACATCCATAGATTTCCTTTTGTTGATGATAAATTAATTAAGCAATCAAGAACTCAGACAGAGAGCCACAGATTAC
AAATAGGAGTATTTACAGTTATTTGAGATGAATAAACCTGCACAAGGACTTCAAACATTGACCAAATGGCTAACCATGTAGTACAAGGAAATAGACATTA
AGACTCCAAAATGATGAAGCAAATCAATCATAAGAAAGAAGGAAAATCCCTAGTTTTAAAGGAACATATGGACAAGGTAAGAATTAAAGATGAAACCGAT
AAAACCAAATAAACAACTAAGTGTCCAACAGCTGAAGGTGGTAAAGACTACCCTTTTAGACTAACCTTCATCAGACATTCAGACATTTGCTCCCACTGGC
TTGAAGCAATCAATATTGCACAATACGGCAGATCTCATCATGTTGCCAAAGCTGCCACCAATAACATCTATCAGTCATAACAGTTATCACATTTTATACA
AGATAAGGCTATTCTGAATTAACATAGCGGCAAAAGAGACAAAAATAAATAAAGTGAAGAACTCTTAGACAGTAGTAACCTAACCGATCAATGCTTTTTT
CTAGCTTTCTCTTGTTGTTCTGTATTATCATTTGCCTTATCCTGAGAGATCCACCCTCTTGCTCGACTTCTCCTTGCGTCCATGCTAGCT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.947231
Expected error %
0.5166
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0028D10
Clone
Clone name
hba-28d10
LE_HBa0028D10
P028D10
Clone type
BAC
Contamination
none
Estimated length
81,907
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found