Clone Read LE_HBa0030A11_SP6_138633

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0030A11_SP6_138633
Primer
SP6
ID from Seq. Facility
LE_HBa_030_A11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
608 trimmed for vector and quality, 861 raw
Genbank Accession
Sequence
>LE_HBa0030A11_SP6_138633 (raw untrimmed)
TTTTAAAATGGTTTGCATCTTACTCGATTCCATTGTTAAAGTTTCGGATTTTACACAGTATGAACATCAATGGGATGGGAGAGCATGCTTTTCATTGGAA
TTAATGCTGCCATAAGGTAATAATATAAACATATCTTGATGGTTAATAGAACAAGTAGTCATAGTGCTATGGTAGTATTCTACAACTGTTCTGTTACTAT
GTGTTGTTTTGTTTACTACACATATTGTCTCTTGTACTCTCATTGCGCCTTTTTAGTCTGTTTTTGTTTTGAGTCGAGGGTCTATTGACTACCTAACCTT
CTGAGCAGAGTCAGAGGTAGAAGTAAGGTCTGCGTACACTTTATCCTCCCCAGACCCACTCTGTCGGAATACATTTGGTATACTGTTGTCGTTGACGACT
ATTTGATTTTCCAACAGCATCCGAGTCTCAAATGAACTGGGGCAAGGACATCCAAGAGCTACCAAATACTCGGTCTACATCACGGTGTTTCAGTCCCTCC
TAATAGGGATACTCTGCATGGTAATTGTACTAGTAGCTAGAGATCATCTGGCCATTATCTTTTCAAACAGCAAGGGAGATGCAAGAAGCTGTTGCTGATC
TTGCTTACCTTCTAGGGATTACCATGGTCCTTAATAGCGTTCAGCCGGTTATATCAGGTATTGCTTTTGCTTCAGCATTTCTGTGGTTTTAATGCTTCCG
GAACACCAATATTATTCGTGTTTTTTCATCCTGATTGGCTGGGGGTGCTGTTGGAGGTGGATGGCAAGCTTTAATTACTTATTTCATTTCTGGGTTGCTA
TTATTGTTTTTGGACCTCCTCTTGGGAAATCTTCCTTGGTTTTGTGAACAAAATTAGAAAA
>LE_HBa0030A11_SP6_138633 (trimmed for quality and cloning vector)
TCGGATTTTACACAGTATGAACATCAATGGGATGGGAGAGCATGCTTTTCATTGGAATTAATGCTGCCATAAGGTAATAATATAAACATATCTTGATGGT
TAATAGAACAAGTAGTCATAGTGCTATGGTAGTATTCTACAACTGTTCTGTTACTATGTGTTGTTTTGTTTACTACACATATTGTCTCTTGTACTCTCAT
TGCGCCTTTTTAGTCTGTTTTTGTTTTGAGTCGAGGGTCTATTGACTACCTAACCTTCTGAGCAGAGTCAGAGGTAGAAGTAAGGTCTGCGTACACTTTA
TCCTCCCCAGACCCACTCTGTCGGAATACATTTGGTATACTGTTGTCGTTGACGACTATTTGATTTTCCAACAGCATCCGAGTCTCAAATGAACTGGGGC
AAGGACATCCAAGAGCTACCAAATACTCGGTCTACATCACGGTGTTTCAGTCCCTCCTAATAGGGATACTCTGCATGGTAATTGTACTAGTAGCTAGAGA
TCATCTGGCCATTATCTTTTCAAACAGCAAGGGAGATGCAAGAAGCTGTTGCTGATCTTGCTTACCTTCTAGGGATTACCATGGTCCTTAATAGCGTTCA
GCCGGTTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.975498
Expected error %
0.2323
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g25640.1 Score 82 E Value 1e-23 Identity 71.70% Align. Length 234bp (38.49%) Frame 2
68417.m03692 MATE efflux family protein similar to ripening regulated protein DDTFR18 [Lycopersicon esculentum] GI:12231296; contains Pfam profile PF01554: Uncharacterized membrane protein family
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g00350.1 Score 75 E Value 1e-22 Identity 58.50% Align. Length 234bp (38.49%) Frame 2
68417.m00046 MATE efflux family protein similar to ripening regulated protein DDTFR18 [Lycopersicon esculentum] GI:12231296; contains Pfam profile PF01554 Uncharacterized membrane protein family
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ55183.1| Score 105 E Value 1e-31 Identity 100.00% Align. Length 234bp (38.49%) Frame 2
putative anthocyanin permease [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_194294.2| Score 82 E Value 6e-22 Identity 71.70% Align. Length 234bp (38.49%) Frame 2
MATE efflux family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0030A11
Clone
Clone name
hba-30a11
LE_HBa0030A11
C03HBa0030A11
P030A11
Clone type
BAC
Contamination
none
Estimated length
102,021
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found