Clone Read LE_HBa0030F10_SP6_138871

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0030F10_SP6_138871
Primer
SP6
ID from Seq. Facility
LE_HBa_030_F10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
466 trimmed for vector and quality, 871 raw
Genbank Accession
Sequence
>LE_HBa0030F10_SP6_138871 (raw untrimmed)
TTTTTTTAACACCGTTATAAACACATACTTTCCAACCTTTCACCCTTAGAAGAAAAGAATTATACACATCCATTTAGGAACCACGGGCCAATTTTCAGAA
GCAGCCAATGCAATGACTATTCTTACAGTAGCCATTTTCACCACTGGTTAAAAGGTTTCTTGATAATCAATTCCAGCAATCTGATTGTATCCCTTAGCTA
CTAGTCTTGCTTTGTACCTTTCCACATCACCATTAGCCTTGTATTTGATCTTATAAACTCGCTTGCAACCAATTACTGAGTGACCAACAGGTAAAGGAAC
AATTTTTCAAGTCCCATTGTCTTCTAGAGCTTGCAATTCTTGTTTCATAACATCAACCAATTTTGCATCTGCCACGGCTTCCTCATAAGTGGAAGGTTCC
ATTCATGTAGATATTTTGGCTATGTATGCATGATATGGAGAAGAAATATGCTGGTAAGAAACATAGTTTGCCATATAATGAGGAATTGGTTAAGTAACTC
TGGTGCCAGTATGATAATCCTTCTAGGTGGTGCAATGATCCTTGCTGACCTCCTTGGAGCAACATGAACACCAGGTACTTTGTGAGCGAAACCTAAATCA
GGCATATCAAGTTGAAGCATATCTGATGGAGGATCTATATTTATGATAACAACCTACCGTTGCACCTTCTCGGCGATATCTCACAATTATCAAATGAAAT
CCCCTGAAGAGTCCTCAATAGTCTAGGTTTACCCGTCTACACACTGCCCAAGAAAGGAGGTCCACTTCTACACTCACTCACCATAGAGGAGAGGAAGCCC
AGTAAAACATTTAGAACGATTCCCTTGTCTGCTATACCGCGCACTCTGCTACCGCGAAGTGGTCCCCCCTC
>LE_HBa0030F10_SP6_138871 (trimmed for quality and cloning vector)
GCAGCCAATGCAATGACTATTCTTACAGTAGCCATTTTCACCACTGGTTAAAAGGTTTCTTGATAATCAATTCCAGCAATCTGATTGTATCCCTTAGCTA
CTAGTCTTGCTTTGTACCTTTCCACATCACCATTAGCCTTGTATTTGATCTTATAAACTCGCTTGCAACCAATTACTGAGTGACCAACAGGTAAAGGAAC
AATTTTTCAAGTCCCATTGTCTTCTAGAGCTTGCAATTCTTGTTTCATAACATCAACCAATTTTGCATCTGCCACGGCTTCCTCATAAGTGGAAGGTTCC
ATTCATGTAGATATTTTGGCTATGTATGCATGATATGGAGAAGAAATATGCTGGTAAGAAACATAGTTTGCCATATAATGAGGAATTGGTTAAGTAACTC
TGGTGCCAGTATGATAATCCTTCTAGGTGGTGCAATGATCCTTGCTGACCTCCTTGGAGCAACATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959894
Expected error %
1.4558
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 114 E Value 2e-26 Identity 15.10% Align. Length 377bp (80.90%) Frame 1
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU93584.1| Score 146 E Value 2e-34 Identity 20.10% Align. Length 362bp (77.68%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89789.1| Score 146 E Value 2e-34 Identity 20.10% Align. Length 362bp (77.68%) Frame 1
hypothetical protein [Solanum tuberosum] gb|AAU89746.1| hypothetical protein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0030F10
Clone
Clone name
hba-30f10
LE_HBa0030F10
C03HBa0030F10
P030F10
Clone type
BAC
Contamination
none
Estimated length
130,745
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found