Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0036J03_T7_142122

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0036J03_T7_142122
Primer
T7
ID from Seq. Facility
LE_HBa_036_J03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
206 trimmed for vector and quality, 781 raw
Genbank Accession
Sequence
>LE_HBa0036J03_T7_142122 (raw untrimmed)
ATACTAGGAGGCGCGATCCTGAAGGCACAATAGCATGTCTCGGACTACCTCGAGGAAATCTGAACAAATTCCGAATGAAGACATAGAGATCGATACAGCC
ATCGACAA
AGAAAAAGACACAATTCGAGCTGAGATTGGCAAAGCTCTGTCTTGAAAGGATATACCTTACTTGGGAATATGTCGAGGGTCACAGGTACAAT
CAAATTTCTCTATAATAACGTTCCAATAAAAAAAATTAACTTTTTTAGTAAAAATAAGAAAAATCAAATACTCTCATTATATATTTATTGTCTCTTTCTC
TACCCTTATACCCTCTCATTATAATGCTTGTATAGATTTTATTTTTTTTTGTATAGATTGTATACATACGACTCTGGATACAACTTTTAATTTACATACT
AAAGACAACAAATAAGAAAATAACTCAATTCTTCACACAACAACTAGGTGCAATCTTGATACGCTACTTAGACTTTTTCGTATGCACAAATTCATATCAT
TATCCTACCCTATTGTATTCAGACATTCATGGACTTATACAAGTAAACTAATACTTTCTTGGATCAATTCAAACTCAACCCCCCTTTCTCTCTTCACTCC
AATCCAGCAATCCCTTCCCACACCAATCATTATATTCACCTGACATCTTACCCATCTTCTACTCTATCACAATACATGGAACCCTCACACAATGCTTATA
TAACTACAATCTATCATCAGGAATACAAGTTAAAGTGCTAACAAAACCATAATTCATTCATTTTAAATCTTACAAATAATC
>LE_HBa0036J03_T7_142122 (trimmed for quality and cloning vector)
AGAAAAAGACACAATTCGAGCTGAGATTGGCAAAGCTCTGTCTTGAAAGGATATACCTTACTTGGGAATATGTCGAGGGTCACAGGTACAATCAAATTTC
TCTATAATAACGTTCCAATAAAAAAAATTAACTTTTTTAGTAAAAATAAGAAAAATCAAATACTCTCATTATATATTTATTGTCTCTTTCTCTACCCTTA
TACCCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.917567
Expected error %
1.8133
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0036J03
Clone
Clone name
hba-36j3
LE_HBa0036J03
P036J03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found