Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0076F02_SP6_17522

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0076F02_SP6_17522
Primer
SP6
ID from Seq. Facility
LE_HBa_076_F02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
725 trimmed for vector and quality, 798 raw
Genbank Accession
Sequence
>LE_HBa0076F02_SP6_17522 (raw untrimmed)
TTAGTAGTAGATTTAGAAATTAGGAGATGGGATGAAACAATTTCACTCTTTTTTATATTTGTTTTGATGCTCTTTAAAAGGGTTTCCAACAAGGATACAG
AAGATGTATAGGGTTAGATGGGTGTTTTCTAAAGAGAAATTTGTAAGGGTCACCTTTTGGTAGCTATTGCTAAAGATGCAAACAAACAAATGTATCCAAT
AGCATGGGCAGTAATTGGTACTGAAAGCAAGTTGACATGGAAATGGTTCATGACCATTCTGAAAGATGATCTCAATCTAGGAAATGGTTCCCAACTCACT
ATCATTAGTGATATGCAAAAGGTAATTGAATATCTTTCTTTTGTATGTTTAATTTAATTGCCAATTTAATTTGACCAAAATTTAACTATCTTGTTTTGGT
TTGCAACTGCATGGACTAATAGCTGCTGTAGATGAACTATTTCCAAAATGTGAGAAAAAATGTGTGCTAGACACATATTAGCAAATTGGTCACAAAACTT
CAGAGGCATAGAGAGAAGGAAGAAATTTTGGGCTTGTGCTAGATCAACATTTGAGGCACAACTTCACTACAATATAAATGCCCTATCCAAGCTGGGAACA
AGTATTGTTAAATACCTTATCAAATAATGGTGCAAAGATTTCCTCCAAACATTTTCAAGGTGTGATAATATAGATAACAACATGACAGAGAGTTTCAATT
CTTGGATCTTGGAACCTAGAAACTAGGCCATTGTAACTATGTTGGAAAAAATTAAAGTTAAGGTGATGAGTAGAATGAAGTAAGTCAAGAAAAATTGT
>LE_HBa0076F02_SP6_17522 (trimmed for quality and cloning vector)
TAGGAGATGGGATGAAACAATTTCACTCTTTTTTATATTTGTTTTGATGCTCTTTAAAAGGGTTTCCAACAAGGATACAGAAGATGTATAGGGTTAGATG
GGTGTTTTCTAAAGAGAAATTTGTAAGGGTCACCTTTTGGTAGCTATTGCTAAAGATGCAAACAAACAAATGTATCCAATAGCATGGGCAGTAATTGGTA
CTGAAAGCAAGTTGACATGGAAATGGTTCATGACCATTCTGAAAGATGATCTCAATCTAGGAAATGGTTCCCAACTCACTATCATTAGTGATATGCAAAA
GGTAATTGAATATCTTTCTTTTGTATGTTTAATTTAATTGCCAATTTAATTTGACCAAAATTTAACTATCTTGTTTTGGTTTGCAACTGCATGGACTAAT
AGCTGCTGTAGATGAACTATTTCCAAAATGTGAGAAAAAATGTGTGCTAGACACATATTAGCAAATTGGTCACAAAACTTCAGAGGCATAGAGAGAAGGA
AGAAATTTTGGGCTTGTGCTAGATCAACATTTGAGGCACAACTTCACTACAATATAAATGCCCTATCCAAGCTGGGAACAAGTATTGTTAAATACCTTAT
CAAATAATGGTGCAAAGATTTCCTCCAAACATTTTCAAGGTGTGATAATATAGATAACAACATGACAGAGAGTTTCAATTCTTGGATCTTGGAACCTAGA
AACTAGGCCATTGTAACTATGTTGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.937982
Expected error %
0.107995
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU43947.1| Score 121 E Value 2e-33 Identity 33.80% Align. Length 699bp (96.41%) Frame 2
hypothetical protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE05840.2| Score 120 E Value 4e-33 Identity 33.80% Align. Length 699bp (96.41%) Frame 2
OSJNBa0091C07.2 [Oryza sativa (japonica cultivar-group)] ref|XP_472021.1| OSJNBa0091C07.2 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0076F02
Clone
Clone name
hba-76f2
LE_HBa0076F02
P076F02
Clone type
BAC
Contamination
none
Estimated length
116,629
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found