Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0076F02_T7_17523

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0076F02_T7_17523
Primer
T7
ID from Seq. Facility
LE_HBa_076_F02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
700 trimmed for vector and quality, 797 raw
Genbank Accession
Sequence
>LE_HBa0076F02_T7_17523 (raw untrimmed)
GCGGGAACCCGGGGGTCCCCTAGAGTCGACCTGCAGGCATGCAAGCTTATGATCTTTCTTACTTTGGCCCTTAATTCTTTATAAACGAATCTTTAGTGAC
TATCCCTATTCCCTATATTATTGTCCTAATGTAAGAAGTCATTATAAGCCAATCTTATTTGGCTAATATCTTTTGCCAATTATATAAACCCATTATAAGA
CAATTTATATGGCTTTATCATTTTCATAACATGAGGATTCATTATTAGTTATGCCCTTTACTTATTGTAAACTTTATTGGACACGATTTGACTATCCTTA
CAACAAGTTATTCATTACGTGAAGTATTCATTACATTTATAAGGCATTCTCTATTAATTATGTCATTGATTTAATTACTTTCATGTTTTATATATTATAC
ATTTCATATACATTATACCTTGGAATCGTTCATATAGCATTAAGACATCTCAAGTGAGTGCCCAACATATGGGACCTCAACCCGATGACCTTCTTTAGCA
AACACAGAGTCTGCTTCATTCGTTCATTTGTACTTCACATTATTCATTTCATTCATTCGTAGGTTGATGTAAACACCACATATACCTAGGATGAAGTTTG
AGACTCTCATGGGATCATGAAGTGCAATAACCAAGAATGACCTAATGTTATTACTTGAATCTGATTTCACCTCCTGATTGTCTTGCACAAACACCAACGG
TATCGTTCATTTCATTATCTTTCATACTTTGAGGAACTCCAACCTTAACCGACATATATCAAGTGAACATCTTGAAATCCAGTGTCTACCTCTCACT
>LE_HBa0076F02_T7_17523 (trimmed for quality and cloning vector)
AGCTTATGATCTTTCTTACTTTGGCCCTTAATTCTTTATAAACGAATCTTTAGTGACTATCCCTATTCCCTATATTATTGTCCTAATGTAAGAAGTCATT
ATAAGCCAATCTTATTTGGCTAATATCTTTTGCCAATTATATAAACCCATTATAAGACAATTTATATGGCTTTATCATTTTCATAACATGAGGATTCATT
ATTAGTTATGCCCTTTACTTATTGTAAACTTTATTGGACACGATTTGACTATCCTTACAACAAGTTATTCATTACGTGAAGTATTCATTACATTTATAAG
GCATTCTCTATTAATTATGTCATTGATTTAATTACTTTCATGTTTTATATATTATACATTTCATATACATTATACCTTGGAATCGTTCATATAGCATTAA
GACATCTCAAGTGAGTGCCCAACATATGGGACCTCAACCCGATGACCTTCTTTAGCAAACACAGAGTCTGCTTCATTCGTTCATTTGTACTTCACATTAT
TCATTTCATTCATTCGTAGGTTGATGTAAACACCACATATACCTAGGATGAAGTTTGAGACTCTCATGGGATCATGAAGTGCAATAACCAAGAATGACCT
AATGTTATTACTTGAATCTGATTTCACCTCCTGATTGTCTTGCACAAACACCAACGGTATCGTTCATTTCATTATCTTTCATACTTTGAGGAACTCCAAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.937827
Expected error %
0.491971
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0076F02
Clone
Clone name
hba-76f2
LE_HBa0076F02
P076F02
Clone type
BAC
Contamination
none
Estimated length
116,629
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found