Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0177F14_T7_256292

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0177F14_T7_256292
Primer
T7
ID from Seq. Facility
LE_HBa_177_F14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
577 trimmed for vector and quality, 967 raw
Sequence
>LE_HBa0177F14_T7_256292 (raw untrimmed)
NGGTATCTTTTTNCCGCGGTCGGGGATCTCTGAGTGACCTGCAGCATGCAAGCTTTATGCCAAGTTCTCTAAGTGTGAGTTTTGGCTAGATGCAGTGTCC
TTCTTGGGGCATGTAGTTTCTAAGGATGGAGTGATGGTGGATCCTTCTAAGATTGAGACAGTGAAGAATTGGGTAAGACCTACTAATGTGTCAGAAATAA
GGAGCTTTGTTGGGTTAGCGAGCTATTACCGTCGATACGTCAAGGGATTCTCTTCCATTGCTTCCCAATTGACGAACTTGACTAAGCAGAACGATCCATT
TGTATGGTCGAACGAAGTGAGGAAAGCTTTCAGAAGCTCAAGACTTTGTTGACTACTGCACCCATCCTTACCTTGCCAGTGGACGGTAAGAACTTCATTG
TCTATTGTGATGCATCCTATTCTGGTTTGGGTGCAGTGCTAATGCAAGAGAAGAGTGTAATTGCTTATGCTTCGAGGCAATTAAAACTGCATGAACATAA
CTATCCGACCCATGATTTGGAATTGGCTGCGGTAGTGTTTGCATTAAAGCAATGGAGGCACTATTTATATGGGGTTAAGTGTGAAGTCTATACGGATCAT
CGTANCCTACAGTATGTCTTTACTCCGAAAGATTTGAATTTGAGACAGAGGAGATGGATGGAACTACTAAAGGACTATGACATCCCTATTTTGGATCAAA
CGGGGAAAGGAAATGTTGTAGCCTAAGCTTTATGTAGAAAAGGCGGAAGCCTGGGAAATTCAGCCCCACTTTTCAAAATTCTAAAGCCCCATTGGCTAGA
AAAAGTTCTAAATTCGGCCTAACGACCTTATTGAGGGTTAAAATTAAATATAAAGGGAAGATTTTTGGCCTTTTTGTGAAGCCAAAATTTTTCTTTTTTT
CGCACATATTAGAGGCAAAACTTTTTTATGACTCTAAATATTATTTTCCATTTCCCTTTAAAATCTC
>LE_HBa0177F14_T7_256292 (trimmed for quality and cloning vector)
GCATGCAAGCTTTATGCCAAGTTCTCTAAGTGTGAGTTTTGGCTAGATGCAGTGTCCTTCTTGGGGCATGTAGTTTCTAAGGATGGAGTGATGGTGGATC
CTTCTAAGATTGAGACAGTGAAGAATTGGGTAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGGTTAGCGAGCTATTACCGTCGATACGTCAA
GGGATTCTCTTCCATTGCTTCCCAATTGACGAACTTGACTAAGCAGAACGATCCATTTGTATGGTCGAACGAAGTGAGGAAAGCTTTCAGAAGCTCAAGA
CTTTGTTGACTACTGCACCCATCCTTACCTTGCCAGTGGACGGTAAGAACTTCATTGTCTATTGTGATGCATCCTATTCTGGTTTGGGTGCAGTGCTAAT
GCAAGAGAAGAGTGTAATTGCTTATGCTTCGAGGCAATTAAAACTGCATGAACATAACTATCCGACCCATGATTTGGAATTGGCTGCGGTAGTGTTTGCA
TTAAAGCAATGGAGGCACTATTTATATGGGGTTAAGTGTGAAGTCTATACGGATCATCGTANCCTACAGTATGTCTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.983045
Expected error %
0.380732
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 144 E Value 1e-69 Identity 66.00% Align. Length 568bp (98.44%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO45752.1| Score 135 E Value 6e-61 Identity 58.60% Align. Length 565bp (97.92%) Frame 2
pol protein [Cucumis melo]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0177F14
Clone
Clone name
hba-177f14
LE_HBa0177F14
C10HBa0177F14
P177F14
Clone type
BAC
Contamination
none
Estimated length
77,255
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found