Clone Read LE_HBa0185E03_T7_259052

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0185E03_T7_259052
Primer
T7
ID from Seq. Facility
LE_HBa_185_E03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
677 trimmed for vector and quality, 965 raw
Sequence
>LE_HBa0185E03_T7_259052 (raw untrimmed)
NTGATGACGGGGATCTCTGAGTCGACCTGCAGGCATGCAAGCTTAGTCCCCGATATGTAGGCTCATATCAGATTTTGAGGCATGTTAGTAAGGTTGCTTA
TGAACTAGATTTGCCTAACGATTTGGCATCGGTGCATACGGTTTTCCATGTCTCTATGTATGTGTTGGTCACTTGACATCTATAGTTCCCTTAGAAGGTT
TAGGAGATTCTTTCATAAGAAGAAGTTTCTATTGAGATCTTAGACCAACAGGTTAAGAAGTTGAGAACTAAAAAAGTTTCTTATGTGAAAGTGTTTTGAA
GGAATCAATTAGTTGAGGTTGTTACTTAGGAGGTCGATATGACGTCCCGATATCATCATTTTTTACCTTCTACCCCTACTTTAGCTTGACATAATGAGTT
CCTTAGGGTTTTATCTCTTAGTATCATGTGTCTTAGGCATTTCCATGATTTCTTCATTCATGCATGTCCATGAAAAAGTTTATGTTTTGAAAAAATAAGC
TTGCTCAATCAATTTCTACATGTTTATGTGCATTTGAGTAAGATTTGCATATAGACTTCATGATATGATGTTTGAATGTACTTAGCTTGAAGTTGATGAT
TCCTCCTCAGATATGTGCATTTATGAATTGGATGTATGTTGGGCTGCTAGGTCTAGTTCCTATCTTCCTTATGATGTTTTGAATATGTTCTAGCTTGGCG
TTGGAGTTCCTCTTTTGTTGTTAGCATTCAAATGAAAGTGCGTATATGAGTTGCTAGTTTAGAGTCCTTTTCCTTCTCTTATGGCTTGAATCTAATTCCA
AAACAAAGGAATTCCATGGGAGATCAGGGNCCACCTCATAATTCAAAAAATGGGAAAAATTTCAAGTTTTTCAAAAATTTTTTGGTCTCATTTAAGGAGG
CCACCTTCAAATCCTGGATTTACCCAGGAACCTTGGGTTTTTTTTTTGATATCCCCCCATAAAAG
>LE_HBa0185E03_T7_259052 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTAGTCCCCGATATGTAGGCTCATATCAGATTTTGAGGCATGTTAGTAAGGTTGCTTATGAACTAGATTTGCCTAACGATTTGG
CATCGGTGCATACGGTTTTCCATGTCTCTATGTATGTGTTGGTCACTTGACATCTATAGTTCCCTTAGAAGGTTTAGGAGATTCTTTCATAAGAAGAAGT
TTCTATTGAGATCTTAGACCAACAGGTTAAGAAGTTGAGAACTAAAAAAGTTTCTTATGTGAAAGTGTTTTGAAGGAATCAATTAGTTGAGGTTGTTACT
TAGGAGGTCGATATGACGTCCCGATATCATCATTTTTTACCTTCTACCCCTACTTTAGCTTGACATAATGAGTTCCTTAGGGTTTTATCTCTTAGTATCA
TGTGTCTTAGGCATTTCCATGATTTCTTCATTCATGCATGTCCATGAAAAAGTTTATGTTTTGAAAAAATAAGCTTGCTCAATCAATTTCTACATGTTTA
TGTGCATTTGAGTAAGATTTGCATATAGACTTCATGATATGATGTTTGAATGTACTTAGCTTGAAGTTGATGATTCCTCCTCAGATATGTGCATTTATGA
ATTGGATGTATGTTGGGCTGCTAGGTCTAGTTCCTATCTTCCTTATGATGTTTTGAATATGTTCTAGCTTGGCGTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944758
Expected error %
0.0885592
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 83 E Value 5e-15 Identity 15.90% Align. Length 332bp (49.04%) Frame 2
putative retrotransposon protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 77 E Value 3e-13 Identity 14.70% Align. Length 332bp (49.04%) Frame 2
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0185E03
Clone
Clone name
hba-185e3
LE_HBa0185E03
P185E03
Clone type
BAC
Contamination
none
Estimated length
101,034
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found