Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0201C12_T7_359915

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0201C12_T7_359915
Primer
T7
ID from Seq. Facility
LE_HBa_201_C12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
686 trimmed for vector and quality, 805 raw
Sequence
>LE_HBa0201C12_T7_359915 (raw untrimmed)
CTTATTAGGGTTGATAGGTATCCAAGCATTCAAAAGATGGTCCTTAGAATCTACCTTGCAGCTCATTATGGTTGTTGCATGAGACACCTTGGGGATAATA
TTAAAACTAACTTTAAAATTTCGAACATAGTGTCCCATTTTTAAAAAACAGAAAAGGCATACGATATATTTGAGTTCAATGACCATTTCAATCAAATAAG
AGATTTGGTACCAAGGCGGATGAAGCTCTTGAACGTATTGGATTTCACATGGACTAGGGCATTTTTCCCGGAAAATTAGTACCATATCATTTGAGTTTAT
TTTTACTTTACGTGCGTTGTTTGATTTTTATCTTTTGTTGTGTAGATATAAAATTATGACGTCAAACATCATGGAGTCTATGAATGCAATGTTTGATGTT
AAAAGAGAATTCCCATTGTCGCACTATTTGATGAAATAAACAGGATGTTGCATTGTTATTTTATCAGAGGCGTATGGAACTGGTGCACTCTGCAAAGTGA
TTTGTTCCCTCAATTGAAAAAGACATATTATGGTATGTCAATGCGGGCAACAAGTTGTTGGCCCATCAAATCGCTAACTACAAGTTCAGTGTCACAAGTC
ATGGAGATGGTTCTACTGCGAATCTACAAAAAAGAACTTGTACTCAAAGAATTTTTGACTTGGACAAAATACCTTGTCCACATGACATGGCAGCGCTTCG
ATCCCAACATGGTGCAGATTTTGGAAATCAGATTTACATGTACTAATCTCCATATTATTCCGGGGAAAAATACACAATGGCATATTGGCAGAAAATTCCC
CCGGC
>LE_HBa0201C12_T7_359915 (trimmed for quality and cloning vector)
TGATAGGTATCCAAGCATTCAAAAGATGGTCCTTAGAATCTACCTTGCAGCTCATTATGGTTGTTGCATGAGACACCTTGGGGATAATATTAAAACTAAC
TTTAAAATTTCGAACATAGTGTCCCATTTTTAAAAAACAGAAAAGGCATACGATATATTTGAGTTCAATGACCATTTCAATCAAATAAGAGATTTGGTAC
CAAGGCGGATGAAGCTCTTGAACGTATTGGATTTCACATGGACTAGGGCATTTTTCCCGGAAAATTAGTACCATATCATTTGAGTTTATTTTTACTTTAC
GTGCGTTGTTTGATTTTTATCTTTTGTTGTGTAGATATAAAATTATGACGTCAAACATCATGGAGTCTATGAATGCAATGTTTGATGTTAAAAGAGAATT
CCCATTGTCGCACTATTTGATGAAATAAACAGGATGTTGCATTGTTATTTTATCAGAGGCGTATGGAACTGGTGCACTCTGCAAAGTGATTTGTTCCCTC
AATTGAAAAAGACATATTATGGTATGTCAATGCGGGCAACAAGTTGTTGGCCCATCAAATCGCTAACTACAAGTTCAGTGTCACAAGTCATGGAGATGGT
TCTACTGCGAATCTACAAAAAAGAACTTGTACTCAAAGAATTTTTGACTTGGACAAAATACCTTGTCCACATGACATGGCAGCGCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959941
Expected error %
0.603056
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0201C12
Clone
Clone name
hba-201c12
LE_HBa0201C12
C10HBa0201C12
P201C12
Clone type
BAC
Contamination
none
Estimated length
126,143
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found