Clone Read LE_HBa0229N08_T7_389758

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0229N08_T7_389758
Primer
T7
ID from Seq. Facility
LE_HBa_229_N08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
4 trimmed for vector and quality, 988 raw
Sequence
>LE_HBa0229N08_T7_389758 (raw untrimmed)
CGGCCATCTTACGACCTCTCCCCCCGTAAAAGCGCCTATATTTATGACGTACATCCCCTCTTCACCAACGGGCATATATCGAGGATAAAAAAAGGTGCCT
TTTAGACTCATTAGCTCCGTTAACCATCACAATTAGACGCCTCTTTGGAAACACTTTTACAACTTACGTCCTCTTATAAGATGAAGAACCCCTCTTCTAA
AAAATCTCCCACAAGGATAACGACTATCTTCACTGGATGATTAATATGACGACTATCTTCCTCCACGGCACCGATGATATTGGACCCCCCGCACATTTGT
ATATTC
ATTAACTACACTACCGGATCGGCATCTTCCGCTGCGAGATAAACAACGCTAGTGTTAAACGCCACAAGATGGCGTAAAAAATGATTGGTAATTG
CCACAATCACGCTGTCCACATCAACCGAAGAGTGGCTCAACTCAACCCACCATCTATCTCGTTTCGATCAATAAGATCGACTAGCTGCCATAGCATTCTT
AGCACATAAATGTATAAGTTAAATCGGGGGCGAAATAAAATATAATTCGAACTGTAGAGCGAGTAAAAGTAGAACGTAGCCCTGTACATTTCTATCCCAC
ATTATCTTTTTCTCGCCACTCGAATAAACGACACGCTACTGCCCATAGCCCACACTTTACAAATCCCTGATCACTTTCCTTTGCCCTTCTTGCTATCTTC
TCATCCATATTTTGTGTCCTTATACCGCGGTGCCAAAAATAAAAATATTCGGGTTAAATTAATGATAGCTGCGTCAAATAGTCTCGCATTCCCGTTTTTC
AAAGGTTGTCCCCTCCCCTCTTTCTCTTGCATTCTTCTACATTTCTTCAATGACCCTTCCCCCCCGGTTTATCCTTATCATTTTTTCAATTCAAAGCACT
TTGAAAAACTTTGTGAAAAACGCCTAATTCATATCTGGTTGCCGCCAATTCATTCTTCTTTTTATCCTCAACTTTCCTCTCTTGTTTC
>LE_HBa0229N08_T7_389758 (trimmed for quality and cloning vector)
ATTA

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for contaminants
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
1.41867
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0229N08
Clone
Clone name
hba-229n8
LE_HBa0229N08
C07HBa0229N08
P229N08
Clone type
BAC
Contamination
none
Estimated length
124,233
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found