Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0239H21_T7_400276

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0239H21_T7_400276
Primer
T7
ID from Seq. Facility
LE_HBa_239_H21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
732 trimmed for vector and quality, 843 raw
Sequence
>LE_HBa0239H21_T7_400276 (raw untrimmed)
NNGGTACGTCGGGNTCTCTGAGTCACTTAGGCAGCAAGCTTAAAATTTTTTAATTGAGTTTTCTTTTTCCTTCGTTCACTCACTGTAGAACAAGAAGATA
CCTCCTTTTTATAGATGAAGTTGAAGAGATGATGTTGCTTATATTAGGGATTTCAGCCTTCTTTTTAATTTATGATCTCGTTTTTTAAATGAGAGCTAAA
TGGCATATATTTCCTTTATTAAGATTGGGTATTATTGATACGGGAACGTTGGACCATACATTTGCTAATAGTGTAGGCAAGAGTATATGTTAGTACAATC
AATTACTAAATATGATGGCTATCATAAACAACATAAACATGAGAATTAGTCAATATAATACATAAGGCATAAGCATAATCAATACACATAAAGCATCGTG
ATGAAAGAAGAATGCTTCCTTATGTTACCTCACTTATCCTTATCAAAGACTTAGGTCATTCGCCTCTAGTCAAGCTTATATCATGGAAGAAATATCTAGC
AACACTCCAAGAAATCATGATCATAACATAATCACATTAATCATAACTACTTTTATATACATGGGGATTTGCCTCAATGCCTATCTCATAATGGCTAATG
GGTATTCACCTCTTGCATTACTTACTTTTAGGTTGCGGGTACTCGCCTCCACAAGCTCATCATATGATGGGGGTAAACCTCCACATCATTTCATAAGGAT
CATGGGTACTCACCTCCATGTCCATTCAACATACTANGAACAGGTGGACTCACCTTTTGTTCAATTATATGGTGTAGGGGAATCGACTCATATTATTTCA
TATAGAAGTTAAGGGTAATTGCCTCTAGCCCTCTTATTCTTTA
>LE_HBa0239H21_T7_400276 (trimmed for quality and cloning vector)
AAGCTTAAAATTTTTTAATTGAGTTTTCTTTTTCCTTCGTTCACTCACTGTAGAACAAGAAGATACCTCCTTTTTATAGATGAAGTTGAAGAGATGATGT
TGCTTATATTAGGGATTTCAGCCTTCTTTTTAATTTATGATCTCGTTTTTTAAATGAGAGCTAAATGGCATATATTTCCTTTATTAAGATTGGGTATTAT
TGATACGGGAACGTTGGACCATACATTTGCTAATAGTGTAGGCAAGAGTATATGTTAGTACAATCAATTACTAAATATGATGGCTATCATAAACAACATA
AACATGAGAATTAGTCAATATAATACATAAGGCATAAGCATAATCAATACACATAAAGCATCGTGATGAAAGAAGAATGCTTCCTTATGTTACCTCACTT
ATCCTTATCAAAGACTTAGGTCATTCGCCTCTAGTCAAGCTTATATCATGGAAGAAATATCTAGCAACACTCCAAGAAATCATGATCATAACATAATCAC
ATTAATCATAACTACTTTTATATACATGGGGATTTGCCTCAATGCCTATCTCATAATGGCTAATGGGTATTCACCTCTTGCATTACTTACTTTTAGGTTG
CGGGTACTCGCCTCCACAAGCTCATCATATGATGGGGGTAAACCTCCACATCATTTCATAAGGATCATGGGTACTCACCTCCATGTCCATTCAACATACT
ANGAACAGGTGGACTCACCTTTTGTTCAATTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952805
Expected error %
0.465064
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0239H21
Clone
Clone name
hba-239h21
LE_HBa0239H21
P239H21
Clone type
BAC
Contamination
none
Estimated length
114,560
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found