Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0231I01_SP6_407243

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0231I01_SP6_407243
Primer
SP6
ID from Seq. Facility
LE_HBa_231_I01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
802 trimmed for vector and quality, 846 raw
Sequence
>LE_HBa0231I01_SP6_407243 (raw untrimmed)
CGGGCCGCGTTCTATNAAATTTTTGATTCTCTTGTTGAATCCAAACAACTACTTTTTGATCATCTTTGTACTTTTTTTTTTCTTGTTTGGTTTAGACTTT
TGAACACATTTGACTTTTAAACATGGATATCATAGTTTAACTAAGGTTTATTAGGTTCCTAAATCGTTTAAGGCATGATAAGTGTTTAAAGAAAAAACAA
ATTAAATGGATTAATGAAAAATCGTTTAACGTGTGATTGTGTATTTTGAAATAGAAAAAGAGATTTCAAGCTTACAAGAATTCTTCATAGACAAAAGAAA
GACATGATGAATCGAAAGTCTTGTTTCGACTTTTTGACAAGTCAGGTTTAAACACCTCCATCATCAATTGATAGGTTGAGAGTTTAAGTAATACCGAAAG
ATTCTTCTTGAAATAGAAGGAAAAAAAACTCTATATATATATATACACACACCAAACAATCATATACCAAGCACTCGTGTAAAAAAATATTAATGTCACT
AATAAGGTACTACAAATACATTTTTATGAGAATAAGTTACATATTTGATTGTTCGATAAAAGATATTTACAGTTGGTAATTAATTACATTCTTAACTAAT
ACAAAAAAAGAAATATTTTAGCGCCATTGAATATTGTCATTAATAAAGAGTGTTAAAGTTATTTTCGGTATTAACAAAGTGTCATTAGAATCAATGTCGC
TAAAGGATTTAGGGACATATACAAAGAGTGCTAATTACCGCTAAAAATATATATTTAGTGATGATTAAAAATTAATTGCTGCTAATAATATTTTTGATAT
AGTTTATGTTATATCGTTATTATAATTATACAGATAAAATATATGN
>LE_HBa0231I01_SP6_407243 (trimmed for quality and cloning vector)
CAAACAACTACTTTTTGATCATCTTTGTACTTTTTTTTTTCTTGTTTGGTTTAGACTTTTGAACACATTTGACTTTTAAACATGGATATCATAGTTTAAC
TAAGGTTTATTAGGTTCCTAAATCGTTTAAGGCATGATAAGTGTTTAAAGAAAAAACAAATTAAATGGATTAATGAAAAATCGTTTAACGTGTGATTGTG
TATTTTGAAATAGAAAAAGAGATTTCAAGCTTACAAGAATTCTTCATAGACAAAAGAAAGACATGATGAATCGAAAGTCTTGTTTCGACTTTTTGACAAG
TCAGGTTTAAACACCTCCATCATCAATTGATAGGTTGAGAGTTTAAGTAATACCGAAAGATTCTTCTTGAAATAGAAGGAAAAAAAACTCTATATATATA
TATACACACACCAAACAATCATATACCAAGCACTCGTGTAAAAAAATATTAATGTCACTAATAAGGTACTACAAATACATTTTTATGAGAATAAGTTACA
TATTTGATTGTTCGATAAAAGATATTTACAGTTGGTAATTAATTACATTCTTAACTAATACAAAAAAAGAAATATTTTAGCGCCATTGAATATTGTCATT
AATAAAGAGTGTTAAAGTTATTTTCGGTATTAACAAAGTGTCATTAGAATCAATGTCGCTAAAGGATTTAGGGACATATACAAAGAGTGCTAATTACCGC
TAAAAATATATATTTAGTGATGATTAAAAATTAATTGCTGCTAATAATATTTTTGATATAGTTTATGTTATATCGTTATTATAATTATACAGATAAAATA
TA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.898526
Expected error %
0.0855127
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0231I01
Clone
Clone name
hba-231i1
LE_HBa0231I01
P231I01
Clone type
BAC
Contamination
none
Estimated length
45,936
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found