Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0121P03_SP6_42580

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0121P03_SP6_42580
Primer
SP6
ID from Seq. Facility
LE_HBa_121_P03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
731 trimmed for vector and quality, 814 raw
Genbank Accession
Sequence
>LE_HBa0121P03_SP6_42580 (raw untrimmed)
ACCTCCGCGAAGGGGGCAGTTACTATATAGANAGAAAGATAAGGATATCCAAAATCTTACTACTCAACTAACCATGCCCTACTTAAGGTAAACCCGTCTA
AGGGAAACTTAATATAACCATAAGAAATTATAACTTACCGGGGCCTTCATTTCAGATTAGATCCTTTGTAAGCTTGAAGCACATAAAAATGGTTCTTCTT
TGGAGTATTAGGATCCGGACTATCATGCAGAGATAGGTTTGTCTCTCACCCAAAGTACCTATCCATATAGGCAAGACAGTTATCCAAATGTTGCTTGCCA
CACTTGGAACACCTAGATCATTCAAAGGAGGAACAACCTCCATTTTCTTCTTGAGAATTTAAGTTAAAACCTTATACTTGTTTACTATAGGGGAGTATCG
GATATGGAACCTCCTCTTAGACATAGTTTGACTTGGTTCATCGGATCTAGATCTCTTCAACTCCTTGTTCTTTTCTTCTAACATACCTGCTTTCATAGAT
TGCGCATGACCCATGAATCTATAGATGTTCATATCATCATGAAGAACTGCCAACCTACACTCTTTCTTAACTAGGTCAAATATCTCGGTCATAAACATAT
TCATCTCATCTCTATAATTTGACACCTAATAAAGGGCATATTATGACATTTTGGTGAATTTCAAGGAGTGCTCATGCACACTAATTCTACCTTGCCTATT
GTTAATAACCTCTTCAACTTTCACTTCCCTATTCTCACGAAATAGTAATTAATGTGAAATGATTTCTCAAACTCTTTGAACTCTAAAATACCCGATTCAA
GTTGCCCAATTGGC
>LE_HBa0121P03_SP6_42580 (trimmed for quality and cloning vector)
AAGATAAGGATATCCAAAATCTTACTACTCAACTAACCATGCCCTACTTAAGGTAAACCCGTCTAAGGGAAACTTAATATAACCATAAGAAATTATAACT
TACCGGGGCCTTCATTTCAGATTAGATCCTTTGTAAGCTTGAAGCACATAAAAATGGTTCTTCTTTGGAGTATTAGGATCCGGACTATCATGCAGAGATA
GGTTTGTCTCTCACCCAAAGTACCTATCCATATAGGCAAGACAGTTATCCAAATGTTGCTTGCCACACTTGGAACACCTAGATCATTCAAAGGAGGAACA
ACCTCCATTTTCTTCTTGAGAATTTAAGTTAAAACCTTATACTTGTTTACTATAGGGGAGTATCGGATATGGAACCTCCTCTTAGACATAGTTTGACTTG
GTTCATCGGATCTAGATCTCTTCAACTCCTTGTTCTTTTCTTCTAACATACCTGCTTTCATAGATTGCGCATGACCCATGAATCTATAGATGTTCATATC
ATCATGAAGAACTGCCAACCTACACTCTTTCTTAACTAGGTCAAATATCTCGGTCATAAACATATTCATCTCATCTCTATAATTTGACACCTAATAAAGG
GCATATTATGACATTTTGGTGAATTTCAAGGAGTGCTCATGCACACTAATTCTACCTTGCCTATTGTTAATAACCTCTTCAACTTTCACTTCCCTATTCT
CACGAAATAGTAATTAATGTGAAATGATTTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956984
Expected error %
0.126685
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39297.1| Score 70 E Value 6e-11 Identity 13.00% Align. Length 314bp (42.95%) Frame 1
putative gag-pol protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 69 E Value 3e-11 Identity 39.50% Align. Length 463bp (63.34%) Frame 2
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0121P03
Clone
Clone name
hba-121p3
LE_HBa0121P03
P121P03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found