Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0127P06_SP6_60250

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0127P06_SP6_60250
Primer
SP6
ID from Seq. Facility
LE_HBa_127_P06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
824 trimmed for vector and quality, 864 raw
Sequence
>LE_HBa0127P06_SP6_60250 (raw untrimmed)
GGGCGTTGCGTTTTCCAGAGTGCATATCGGAACCTTCGTCAGACAAAAATAATTTTCTTTTATCAGGAGTTACATTGACTTCAAATTCTCTTGGTGGCAT
CGCAAAATTCATGATTGCCTTTGGATATTGCCGAGAGTTTGCACCTCTATATAATTCATTGATAAGCTTGCCAACTTTTGGCATATCCACCTGTCGTCCA
TTCACAAAAAAATATTGTCGATCTCCTAAGTTGCGTCCACTACCATAGCCAGACTTGGAAATGAATCCTTCAACAGTGCAATCATCAGACATACACACTT
CCAGAGGCTCCAGACAAGTGAAGGTACTCATACCAAATACTGTTATAATGTTATCTTTCAGAGATCCACTTCCCTGAGTCTTCAGAACTACAGATTTTGC
ATTTTTTAGAGCTGAGTTGGTACAAACTAGTCTGACTCCCTTAGAAATAAGAGCATAGGCCTAGAAGTTCAACCAACAAAAGAAAGCAAATAAATAACTT
AAACAACAAAAGCATTAAAATACTTCTTCAGCAGAAACCATGCACATACTCTCTCAAGATTAAGAACCTTGACAAGAACAAATTATTAAGCAGTCTAACA
TGAAAGGTCACCAAACTATAGCACAATGAAATTCACAATCACCAGAAGCAAAAAGATTTTTTGATGAAGTTAATCGATTTCACTAAAGAGAGAAATCTCC
CCTATACAAGAAGTATACCCAAAGAAAAAGTGGATAGCCTACACAAAAGTATGAGTCTCTACATATTGCTCCACAATTTGTGCAATCTTCAATTTAGATA
GGAACTTCAATTTCCTGGGAAGCTTTTGTATTTCTTACCCCTTGTAATGCTTGAGTTCATAAAG
>LE_HBa0127P06_SP6_60250 (trimmed for quality and cloning vector)
AACCTTCGTCAGACAAAAATAATTTTCTTTTATCAGGAGTTACATTGACTTCAAATTCTCTTGGTGGCATCGCAAAATTCATGATTGCCTTTGGATATTG
CCGAGAGTTTGCACCTCTATATAATTCATTGATAAGCTTGCCAACTTTTGGCATATCCACCTGTCGTCCATTCACAAAAAAATATTGTCGATCTCCTAAG
TTGCGTCCACTACCATAGCCAGACTTGGAAATGAATCCTTCAACAGTGCAATCATCAGACATACACACTTCCAGAGGCTCCAGACAAGTGAAGGTACTCA
TACCAAATACTGTTATAATGTTATCTTTCAGAGATCCACTTCCCTGAGTCTTCAGAACTACAGATTTTGCATTTTTTAGAGCTGAGTTGGTACAAACTAG
TCTGACTCCCTTAGAAATAAGAGCATAGGCCTAGAAGTTCAACCAACAAAAGAAAGCAAATAAATAACTTAAACAACAAAAGCATTAAAATACTTCTTCA
GCAGAAACCATGCACATACTCTCTCAAGATTAAGAACCTTGACAAGAACAAATTATTAAGCAGTCTAACATGAAAGGTCACCAAACTATAGCACAATGAA
ATTCACAATCACCAGAAGCAAAAAGATTTTTTGATGAAGTTAATCGATTTCACTAAAGAGAGAAATCTCCCCTATACAAGAAGTATACCCAAAGAAAAAG
TGGATAGCCTACACAAAAGTATGAGTCTCTACATATTGCTCCACAATTTGTGCAATCTTCAATTTAGATAGGAACTTCAATTTCCTGGGAAGCTTTTGTA
TTTCTTACCCCTTGTAATGCTTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952683
Expected error %
0.478136
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g02460.1 Score 205 E Value 2e-53 Identity 22.50% Align. Length 425bp (51.58%) Frame 3
68417.m00333 DNA mismatch repair protein, putative similar to SP|P54278 PMS1 protein homolog 2 (DNA mismatch repair protein PMS2) {Homo sapiens}; contains Pfam profiles PF02518: ATPase, histidine kinase-, DNA gyrase B-, and HSP90-like domain protein, PF01119: DNA mismatch repair protein, C-terminal domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_466491.1| Score 206 E Value 6e-52 Identity 22.30% Align. Length 425bp (51.58%) Frame 3
putative PMS2 postmeiotic segregation increased 2 [Oryza sativa (japonica cultivar-group)] dbj|BAD34084.1| putative PMS2 postmeiotic segregation increased 2 [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL01156.1| Score 205 E Value 1e-51 Identity 22.50% Align. Length 425bp (51.58%) Frame 3
DNA mismatch repair protein [Arabidopsis thaliana] ref|NP_567236.1| DNA mismatch repair protein, putative [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0127P06
Clone
Clone name
hba-127p6
LE_HBa0127P06
P127P06
Clone type
BAC
Contamination
none
Estimated length
94,355
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found