Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0127P06_T7_60251

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0127P06_T7_60251
Primer
T7
ID from Seq. Facility
LE_HBa_127_P06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
759 trimmed for vector and quality, 857 raw
Sequence
>LE_HBa0127P06_T7_60251 (raw untrimmed)
CTGAGTCGGGTCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTCGGGTGATTTGGGACACCCTTTATAATCCTCCTAAAAGAAATAGAG
GGAAACGCACAGTATTTTATACTGAAACTACAGCCTGTCATAGAGAAAAAAAGTCACAATTTTTAACACTCTGGTAAAGAAATTACCTTATCACCATCAA
GCCCATTACAAATTGCAGGTGCATCTGGCGTTAGATAATCCGGGGTACTGCATTCCAAAAAATTATTTATAAGCAGAAAACAAAACTAGAGGATACAATG
TGAATATATGATCTTTTATATTTATAAAATCGGGGGAGGAGATTACAAGTTGGGAATCAAACCCTTACCAACAAGGTGCAAGTTAAGTTAGTGAACCAAC
TAAGCTACTAAGATTCACCAATACCAAGATACGATCAGGAATTGGGGGTAAAAGTTAAAAAACAAAACCTAACCAATATAAAATTGAACAGTAAGCAATC
AACTTATTACACCTTAATCAGTTCCCGGTCTCATATGGAACATCAAGGGACCAAAAAAAGGGCACAATCGGAACCAGTTCAAATCTCAGTGGCTACTCTA
CATCTTATTCCATTCAAACCCATATCCTTCTAATCGAAAAAAAAAGGGAAAAAAGATTTACCAGAAGAAATCTTGACTGAGAATGAAGTCCTTTTCAGCA
ACATCGGCAACATCGGCATCATCATCAGCATCGAGATTCAACGGCAAAACTGAAGAGAACTGAGATTGAGCTGGCGGAAGGTCATCAGAATCCAGAAGTT
TCTGGAATCTAAAAGCCTCCGGTACCGAACATTAGAAAGTGAGGAATGAGCTGGTGT
>LE_HBa0127P06_T7_60251 (trimmed for quality and cloning vector)
AGCTTCTCGGGTGATTTGGGACACCCTTTATAATCCTCCTAAAAGAAATAGAGGGAAACGCACAGTATTTTATACTGAAACTACAGCCTGTCATAGAGAA
AAAAAGTCACAATTTTTAACACTCTGGTAAAGAAATTACCTTATCACCATCAAGCCCATTACAAATTGCAGGTGCATCTGGCGTTAGATAATCCGGGGTA
CTGCATTCCAAAAAATTATTTATAAGCAGAAAACAAAACTAGAGGATACAATGTGAATATATGATCTTTTATATTTATAAAATCGGGGGAGGAGATTACA
AGTTGGGAATCAAACCCTTACCAACAAGGTGCAAGTTAAGTTAGTGAACCAACTAAGCTACTAAGATTCACCAATACCAAGATACGATCAGGAATTGGGG
GTAAAAGTTAAAAAACAAAACCTAACCAATATAAAATTGAACAGTAAGCAATCAACTTATTACACCTTAATCAGTTCCCGGTCTCATATGGAACATCAAG
GGACCAAAAAAAGGGCACAATCGGAACCAGTTCAAATCTCAGTGGCTACTCTACATCTTATTCCATTCAAACCCATATCCTTCTAATCGAAAAAAAAAGG
GAAAAAAGATTTACCAGAAGAAATCTTGACTGAGAATGAAGTCCTTTTCAGCAACATCGGCAACATCGGCATCATCATCAGCATCGAGATTCAACGGCAA
AACTGAAGAGAACTGAGATTGAGCTGGCGGAAGGTCATCAGAATCCAGAAGTTTCTGGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.954663
Expected error %
0.553658
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0127P06
Clone
Clone name
hba-127p6
LE_HBa0127P06
P127P06
Clone type
BAC
Contamination
none
Estimated length
94,355
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found