Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0134A15_T7_60317

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0134A15_T7_60317
Primer
T7
ID from Seq. Facility
LE_HBa_134_A15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
0 trimmed for vector and quality, 882 raw
Sequence
>LE_HBa0134A15_T7_60317 (raw untrimmed)
AGCTAACCTGGTCCCGCGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGTATGTCTATAGTGTCACCTAGATAGCTTGGCGTAATCATGGTC
ATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGC
TAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCTTGCGG
CCGCCCGGGCCGTCAACCAATTCTCATGTTTGACAGCTATATCGTCTAATTTCTGCCATTCATCCGCTTATTATCACTTAATCAGGCGTAGCCACCAGGC
GTTTAAGGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCGCTCATCTCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACGAGGAAGC
CATCTCAAACCGCATGATGAACCTGAATCGCCAGCGGCATCAACACCTTGTCGCCTTGCGTATAATATTTGCCCCTGGTGAAAACCGGGGCGAAGAAGTT
GTCCATATTGGCCACGTTTAAATCATAACTGGTCAAACTCGCCCCCGGATTGGCTGAGACAAAACAAAATCCTCCATAAACCCCTTTAAGGGAAAAGGCC
GGTTTTTCACTGAACACGCCACCATCTTGCAAATAGATGTGTATAAACTTCCCCCAAATCTCCCTGGTATGCTCTCCACAGCAATAAAAACTATCCCCTT
CCATATGGAAAACCGGGTAACAAGGGGGGATACATTGCCTTCCCCAACCCCCCATCTTTCAATGTCCATCCGAATTCCGAAG
>LE_HBa0134A15_T7_60317 (trimmed for quality and cloning vector)

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Probable foreign DNA contamination
  • High predicted error rate
  • Low complexity
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, no insert found (only flanking vectors)
Quality trim threshold
14.5
Sequence entropy
not recorded
Expected error %
100
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0134A15
Clone
Clone name
hba-134a15
LE_HBa0134A15
C02HBa0134A15
P134A15
Clone type
BAC
Contamination
none
Estimated length
121,816
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found