Clone Read LE_HBa0034A02_T7_7299

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0034A02_T7_7299
Primer
T7
ID from Seq. Facility
LE_HBa_034_A02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
743 trimmed for vector and quality, 787 raw
Genbank Accession
Sequence
>LE_HBa0034A02_T7_7299 (raw untrimmed)
ACTCGGATCCGAGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAATTAACAGATGTATTGACCTGAAAGGTGCCTGCGCCAGGTAGGTTTTTC
ATTATCTCCGTCCTGCAGTGAGAAGGTGCCCTTGGGAATCTGGGACGCATTTGAAACCGCCTCTCGCCACCTGCAATTGGTATGACGGGACAGTTAAACT
TGCTAAACATGAAGTAAGAATGGTCGTTGGTATATTTCCTTACTATCACGTTTTATAATAAATTAGTGCAATGAGCTCGGGATATATCGTATAGCCTGAG
CATATATCCAGTTACCCGGGATGCATCTCATGCTATTTGACTAGGTACTCTCACAACTGACATCTAGCTTGCCCATAAGGAATTGTACTCAGTTTTAAGC
TACACCGCTTTCACGATGTTATGGGTTTTTTTAAAAGGATGCCTCGAAGAGAAGGTTCCATCAGAAAATATGCACAATGTTGACCAGCTAGCTATAATTT
TCAGTGAAGTGCATGGGGTCATATGCAAGGGAGTGTATCAGTCCAAACATGAGACCTCTTTGTCCTGCGGGCTATACTAAAATTATGGGAAACTTTTGAT
TGCCCTCGTTCAGGTACACTTGTATTTATTTGAGCTTGCTGGATTTGATTAAAGTCAACTACTAGATTCTGGATGACATCAGTTTATTTGAACTAGGTTG
ATGCCTTGATTGGAGTGTACTTATTAAATAGCTTCGTTGTGTACAAAAACGTACAGATTTTATACTTCTAAATGAAATTCAGATCTA
>LE_HBa0034A02_T7_7299 (trimmed for quality and cloning vector)
AGCTTAAATTAACAGATGTATTGACCTGAAAGGTGCCTGCGCCAGGTAGGTTTTTCATTATCTCCGTCCTGCAGTGAGAAGGTGCCCTTGGGAATCTGGG
ACGCATTTGAAACCGCCTCTCGCCACCTGCAATTGGTATGACGGGACAGTTAAACTTGCTAAACATGAAGTAAGAATGGTCGTTGGTATATTTCCTTACT
ATCACGTTTTATAATAAATTAGTGCAATGAGCTCGGGATATATCGTATAGCCTGAGCATATATCCAGTTACCCGGGATGCATCTCATGCTATTTGACTAG
GTACTCTCACAACTGACATCTAGCTTGCCCATAAGGAATTGTACTCAGTTTTAAGCTACACCGCTTTCACGATGTTATGGGTTTTTTTAAAAGGATGCCT
CGAAGAGAAGGTTCCATCAGAAAATATGCACAATGTTGACCAGCTAGCTATAATTTTCAGTGAAGTGCATGGGGTCATATGCAAGGGAGTGTATCAGTCC
AAACATGAGACCTCTTTGTCCTGCGGGCTATACTAAAATTATGGGAAACTTTTGATTGCCCTCGTTCAGGTACACTTGTATTTATTTGAGCTTGCTGGAT
TTGATTAAAGTCAACTACTAGATTCTGGATGACATCAGTTTATTTGAACTAGGTTGATGCCTTGATTGGAGTGTACTTATTAAATAGCTTCGTTGTGTAC
AAAAACGTACAGATTTTATACTTCTAAATGAAATTCAGATCTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.97672
Expected error %
0.0122548
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0034A02
Clone
Clone name
hba-34a2
LE_HBa0034A02
C03HBa0034A02
P034A02
Clone type
BAC
Contamination
none
Estimated length
121,565
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found