Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0153F02_T7_74355

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0153F02_T7_74355
Primer
T7
ID from Seq. Facility
LE_HBa_153_F02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
742 trimmed for vector and quality, 817 raw
Genbank Accession
Sequence
>LE_HBa0153F02_T7_74355 (raw untrimmed)
TTTTTTTTTATAGTTTTATGTCTACTGTCCGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTGCCAATGAAAAGAACAAAATTTTCAAATCT
TCAGTATTTCTATTGAAATTCTTCAACACATTGACTGATAAAACCATATGCATGCATAATGTTCTGATTCAAGATATACATTTGTTGTCCCTTTCCATAT
GTTTTCATTTCTGTCTGACATAAAACACATATTTTGTCTAACTCAATATGCTTCTCTAAACTGCTCAATGAACCATGTCCATTAAGCATCATTTCAGAAT
CTACTATCGCATACGCCAACGGAAGTATATGACCTGCTCATTAATTTAAAAAAAAATATCACACAAATCAGAAATATCATTCATATGTTTTTTCATTATA
TTATATAATTAGAAAATTAAATAGGCTAATAATTTACCTCCCGGATCCAATGTGCTTGCAGTTAACATTGTACCACCATATGAACATTTTAATGCGGCAC
CATCAACAACTATAATTGGCCTACAATAATCCCAACTCCTAATACAAGTTTCTAACGCAACAAATGCATATAAAGTGTGTCACCTTCATTCATTTTTATT
TTCAAAACAGATCCTGGATATGTTTGCTCCAAAATGTAAAAATAACTTGAAAATAACAGTCCAATTCACACATAAAATGTACATATTTTATACATAAAGA
ATACACCAAACTGTTACAGTACAACACAATGACTAATGTTTAAATTTATCCTTATTTTCGAAATTACCAGGTAATCTTGCTTAAGATTCTGCTGGATCTC
CTCGCACCAACTTTACT
>LE_HBa0153F02_T7_74355 (trimmed for quality and cloning vector)
AGCTTTTTGCCAATGAAAAGAACAAAATTTTCAAATCTTCAGTATTTCTATTGAAATTCTTCAACACATTGACTGATAAAACCATATGCATGCATAATGT
TCTGATTCAAGATATACATTTGTTGTCCCTTTCCATATGTTTTCATTTCTGTCTGACATAAAACACATATTTTGTCTAACTCAATATGCTTCTCTAAACT
GCTCAATGAACCATGTCCATTAAGCATCATTTCAGAATCTACTATCGCATACGCCAACGGAAGTATATGACCTGCTCATTAATTTAAAAAAAAATATCAC
ACAAATCAGAAATATCATTCATATGTTTTTTCATTATATTATATAATTAGAAAATTAAATAGGCTAATAATTTACCTCCCGGATCCAATGTGCTTGCAGT
TAACATTGTACCACCATATGAACATTTTAATGCGGCACCATCAACAACTATAATTGGCCTACAATAATCCCAACTCCTAATACAAGTTTCTAACGCAACA
AATGCATATAAAGTGTGTCACCTTCATTCATTTTTATTTTCAAAACAGATCCTGGATATGTTTGCTCCAAAATGTAAAAATAACTTGAAAATAACAGTCC
AATTCACACATAAAATGTACATATTTTATACATAAAGAATACACCAAACTGTTACAGTACAACACAATGACTAATGTTTAAATTTATCCTTATTTTCGAA
ATTACCAGGTAATCTTGCTTAAGATTCTGCTGGATCTCCTCG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.923345
Expected error %
0.335824
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31178.1| Score 86 E Value 1e-15 Identity 24.00% Align. Length 149bp (20.08%) Frame 2
putative transposase [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB77997.1| Score 50 E Value 1e-10 Identity 40.00% Align. Length 426bp (57.41%) Frame 2
putative protein [Arabidopsis thaliana] emb|CAB82108.1| putative protein [Arabidopsis thaliana] pir||E85087 hypothetical protein AT4g08720 [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0153F02
Clone
Clone name
hba-153f2
LE_HBa0153F02
P153F02
Clone type
BAC
Contamination
none
Estimated length
38,038
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found