Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0040F10_T7_8323

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0040F10_T7_8323
Primer
T7
ID from Seq. Facility
LE_HBa_040_F10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
781 trimmed for vector and quality, 963 raw
Genbank Accession
Sequence
>LE_HBa0040F10_T7_8323 (raw untrimmed)
GGTGGCTGGGTACCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTTAATTCTTCCCACTCAATAGGACCCGACTCCACCAGCCTATTATC
CTTCTATTGAGTGTACCATATTTGAGATATATCCCTCAATAGATATGAAGACAACTTTAGCCTTCTCCTTAGATGTAACCCCATAGCACTCAACACCTTG
TAAACACCATCAAGGAACTCTTGGGGATCCTCTTCCACCTTAGATCCAAGAAAGATAGGAGGATTCATCCTCACAAAGTCTATCAACCTAGAGGTCAGAG
TTCTCTCTACAACATTCACCCTAGGCACAATACTCAAATTTATTTGAGTAGTCACGGCTTGATCTAAAGTAACCAAATCCTCTCTAATCTCCCTATTAGT
CAACTCCGGATGAACCTCCGGGACCTCATTACCTCCTTCCACATTAGGGACATGATCACCTAGGGAAGGCACTTAAGCACCTTGAGCACCTTGGACTCCT
TGTCCATCTTGAGAAACCTTCTCAACTTGCTTAACTTGAGGAGGAATATCCTCATTCACCTCTCCTCTTCAATATACTAGTGATCATCTTACTAGTATTC
ATCTCCTAAAAACACAAGGAAACATATAAGAAGGATATTCATAAAATTTACTATACCACACGACATAGGAGTAGAAAAGAAGGAAAACTCTATCATCCTA
TAGCCTCTCGCCCATAGATGTGTCGCGACTCACACCGATGATCGAGAGTCTACTGCACGTGACTCGATGAGACTTTTTGATTCCTAAGACTAATTTCACC
AATCTATGCTCTAATACCAAGATTGCCACATCCCGATACCACACCTTAGAAAGTTAGGGAATAATCTCGGATTGTAACCGGTTTACTCGACCTCTTGGAG
GGTCTTATACAGCCCTTTCAAATCCTTTCTTTCTTATTCCTGGTAAAAGTAGTTGCAAAATTA
>LE_HBa0040F10_T7_8323 (trimmed for quality and cloning vector)
AGCTTCTTTAATTCTTCCCACTCAATAGGACCCGACTCCACCAGCCTATTATCCTTCTATTGAGTGTACCATATTTGAGATATATCCCTCAATAGATATG
AAGACAACTTTAGCCTTCTCCTTAGATGTAACCCCATAGCACTCAACACCTTGTAAACACCATCAAGGAACTCTTGGGGATCCTCTTCCACCTTAGATCC
AAGAAAGATAGGAGGATTCATCCTCACAAAGTCTATCAACCTAGAGGTCAGAGTTCTCTCTACAACATTCACCCTAGGCACAATACTCAAATTTATTTGA
GTAGTCACGGCTTGATCTAAAGTAACCAAATCCTCTCTAATCTCCCTATTAGTCAACTCCGGATGAACCTCCGGGACCTCATTACCTCCTTCCACATTAG
GGACATGATCACCTAGGGAAGGCACTTAAGCACCTTGAGCACCTTGGACTCCTTGTCCATCTTGAGAAACCTTCTCAACTTGCTTAACTTGAGGAGGAAT
ATCCTCATTCACCTCTCCTCTTCAATATACTAGTGATCATCTTACTAGTATTCATCTCCTAAAAACACAAGGAAACATATAAGAAGGATATTCATAAAAT
TTACTATACCACACGACATAGGAGTAGAAAAGAAGGAAAACTCTATCATCCTATAGCCTCTCGCCCATAGATGTGTCGCGACTCACACCGATGATCGAGA
GTCTACTGCACGTGACTCGATGAGACTTTTTGATTCCTAAGACTAATTTCACCAATCTATGCTCTAATACCAAGATTGCCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.954294
Expected error %
0.446772
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38733.1| Score 101 E Value 3e-20 Identity 15.10% Align. Length 350bp (44.81%) Frame 1
putative retrotransposon gag protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0040F10
Clone
Clone name
hba-40f10
LE_HBa0040F10
P040F10
Clone type
BAC
Contamination
none
Estimated length
112,227
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found