Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0139G01_SP6_88224

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0139G01_SP6_88224
Primer
SP6
ID from Seq. Facility
LE_HBa_139_G01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
277 trimmed for vector and quality, 908 raw
Genbank Accession
Sequence
>LE_HBa0139G01_SP6_88224 (raw untrimmed)
GGGGGAGGCCCCTATTGGAAGTAAAATTAGTCGGTGTTTTTACCTAATAAGCTAAAATGGTACTTAATAAATTGTTGACTTCTTAGCAAAGCAAGACAAA
AGGAAGAAAACACACCGGACCTTTTGCAG
GGATTTCACCAGTAGGGGTCAAGATTCTTGCACTGAAGTTGATAAAAATTGAGAATGGTTTGTGGTTTTCA
TCCATTTTGGGCGTTGATTCGCTTTCTTTTTTGGATTCCATAGGACAAAAATTGCACTCTTTGATGATGATGTTGCCATGAAAAGGTTAGTGAGTAAGGT
TTTGTTTATTTGTGAACTATCCTGTTTGGAGGTTGATGAGAGGTTTTTAAAAAAAAAAAAAAAAAAACTTATTAATGTATTGTAATTTTAACAAAAATAA
AAATATTATTATTTAATGTATTTGAGCTACATATCGTGTATTCAATTTGATTTTTTAATTTTTAAAAAATTAATTTAATTAAAAACTTATTATAAATAGA
TTGTTATTTCATATAAAAACGATGAAATTTATGTAACTTCCCCAAATTATTTAAAAAATAATTTTTCCGAATTACCCCTATAAAAAGAAAAATTTATGGA
TTATATGAGGATGATGCAAACACAAATCAGATCGATTTTGAATTCACTACTTTTTTCCCTCATCAACCATTATTTCTCCTTTTTTAATCACCCCTCCTCC
CTTTTAGCATTTTCATCCCACTGCAGAACATTTAATCTTATTACATCAACACTCATTTAATTTATATTTCCCAGTAAAATATCAATTTAACCTCCATATA
TTCTCTTTTAGCCTCCGCCTACTTCTACCAGAATACTTTTTAATTTATCAGCGTTACCCTCATCCCACCCTCCACCACCCTTCTCTCTCTTTATCTAATT
TCCATAAC
>LE_HBa0139G01_SP6_88224 (trimmed for quality and cloning vector)
GGATTTCACCAGTAGGGGTCAAGATTCTTGCACTGAAGTTGATAAAAATTGAGAATGGTTTGTGGTTTTCATCCATTTTGGGCGTTGATTCGCTTTCTTT
TTTGGATTCCATAGGACAAAAATTGCACTCTTTGATGATGATGTTGCCATGAAAAGGTTAGTGAGTAAGGTTTTGTTTATTTGTGAACTATCCTGTTTGG
AGGTTGATGAGAGGTTTTTAAAAAAAAAAAAAAAAAAACTTATTAATGTATTGTAATTTTAACAAAAATAAAAATAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.895133
Expected error %
0.633628
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0139G01
Clone
Clone name
hba-139g1
LE_HBa0139G01
P139G01
Clone type
BAC
Contamination
none
Estimated length
124,865
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found