Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0139G01_T7_88225

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0139G01_T7_88225
Primer
T7
ID from Seq. Facility
LE_HBa_139_G01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
608 trimmed for vector and quality, 851 raw
Genbank Accession
Sequence
>LE_HBa0139G01_T7_88225 (raw untrimmed)
TCTACTTGGTTCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGGTTCTAGGTCCAGTGAATTCTCTAGGACCCTGCCAAATGCAACTTA
GCATTTTTAGTGCTACTTTGTTATGAAAATGGTTGATTTCCCCTTCTCATACGGAAGACATTTCCTAGCTCTAGGCAACCAATATCCTGAGGATTTCTTA
AGCCATCAACCGCCCTTTAAACTAGAACAATAACTGATTTTAAGAAGTTGCGTGTAATTGCCTGTATGTAACTAGCATAAGCTTGAATAATTCATTTTGA
AATACTCAAGTGAAGTTCATGAATAAAATATGTCGAGGAGATCCTTCGTCTTTGGTTTTTGTGTATGTTGTGTGTGTTGTAGAGCCTCTATAGTATCTTT
TATGTTGCAGAAATGGGTAATCCCCTCTTGATTTTTTACAACGTATGACAATTTAGTTGATATGGTTTCTTGAGAATGGTAGCTAAAGGCTATTTAGTTG
ATATGTTATTGTTCACTAAGTATATTATTAGGTGTATGTTAATCCAGAGTACCATCTTAAGGTGATAGCCTTATGATTAGCCTTTCCAGTACAGCTGGAC
GAGCTACTTCCAATATATCTTCATGTTATGTCTAAAAAATTATTTCCTTGCATCCATATTTAAATAATTTTCACTTTTTGAGCTGTGTTTTTTAGGTAAA
CTCTATGTTTTCATTCTTCGCTTATGTGATGTGTTCGGCTTGCTGGCCATCCTACCCGTCCTCCGACCCACTGTGGTGGGCCTCTTCTTGGGTATTTATG
TACATTTATTTCCTTAAATCAAGATACTTAGCCTCATACTTTCCTCTTTTC
>LE_HBa0139G01_T7_88225 (trimmed for quality and cloning vector)
AGCTTCGGTTCTAGGTCCAGTGAATTCTCTAGGACCCTGCCAAATGCAACTTAGCATTTTTAGTGCTACTTTGTTATGAAAATGGTTGATTTCCCCTTCT
CATACGGAAGACATTTCCTAGCTCTAGGCAACCAATATCCTGAGGATTTCTTAAGCCATCAACCGCCCTTTAAACTAGAACAATAACTGATTTTAAGAAG
TTGCGTGTAATTGCCTGTATGTAACTAGCATAAGCTTGAATAATTCATTTTGAAATACTCAAGTGAAGTTCATGAATAAAATATGTCGAGGAGATCCTTC
GTCTTTGGTTTTTGTGTATGTTGTGTGTGTTGTAGAGCCTCTATAGTATCTTTTATGTTGCAGAAATGGGTAATCCCCTCTTGATTTTTTACAACGTATG
ACAATTTAGTTGATATGGTTTCTTGAGAATGGTAGCTAAAGGCTATTTAGTTGATATGTTATTGTTCACTAAGTATATTATTAGGTGTATGTTAATCCAG
AGTACCATCTTAAGGTGATAGCCTTATGATTAGCCTTTCCAGTACAGCTGGACGAGCTACTTCCAATATATCTTCATGTTATGTCTAAAAAATTATTTCC
TTGCATCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.952451
Expected error %
1.03094
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0139G01
Clone
Clone name
hba-139g1
LE_HBa0139G01
P139G01
Clone type
BAC
Contamination
none
Estimated length
124,865
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found